ID: 1149840510

View in Genome Browser
Species Human (GRCh38)
Location 17:59960622-59960644
Sequence AGAGACAGGTTTCACCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14633
Summary {0: 616, 1: 1826, 2: 3144, 3: 3590, 4: 5457}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149840510_1149840513 13 Left 1149840510 17:59960622-59960644 CCAACATGGTGAAACCTGTCTCT 0: 616
1: 1826
2: 3144
3: 3590
4: 5457
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573
1149840510_1149840512 5 Left 1149840510 17:59960622-59960644 CCAACATGGTGAAACCTGTCTCT 0: 616
1: 1826
2: 3144
3: 3590
4: 5457
Right 1149840512 17:59960650-59960672 AAAAAGTACAAAAGTTAGCCAGG 0: 19
1: 1006
2: 17962
3: 112649
4: 162974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840510 Original CRISPR AGAGACAGGTTTCACCATGT TGG (reversed) Intronic