ID: 1149840510 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:59960622-59960644 |
Sequence | AGAGACAGGTTTCACCATGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 14633 | |||
Summary | {0: 616, 1: 1826, 2: 3144, 3: 3590, 4: 5457} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149840510_1149840513 | 13 | Left | 1149840510 | 17:59960622-59960644 | CCAACATGGTGAAACCTGTCTCT | 0: 616 1: 1826 2: 3144 3: 3590 4: 5457 |
||
Right | 1149840513 | 17:59960658-59960680 | CAAAAGTTAGCCAGGCGCCGTGG | 0: 1 1: 25 2: 1129 3: 21245 4: 95573 |
||||
1149840510_1149840512 | 5 | Left | 1149840510 | 17:59960622-59960644 | CCAACATGGTGAAACCTGTCTCT | 0: 616 1: 1826 2: 3144 3: 3590 4: 5457 |
||
Right | 1149840512 | 17:59960650-59960672 | AAAAAGTACAAAAGTTAGCCAGG | 0: 19 1: 1006 2: 17962 3: 112649 4: 162974 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149840510 | Original CRISPR | AGAGACAGGTTTCACCATGT TGG (reversed) | Intronic | ||