ID: 1149840511

View in Genome Browser
Species Human (GRCh38)
Location 17:59960636-59960658
Sequence GTACTTTTTTTAGTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232876
Summary {0: 24, 1: 1074, 2: 1936, 3: 11029, 4: 218813}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149840511_1149840516 27 Left 1149840511 17:59960636-59960658 CCTGTCTCTACTAAAAAAAGTAC 0: 24
1: 1074
2: 1936
3: 11029
4: 218813
Right 1149840516 17:59960686-59960708 GCCTGTAATCCCAGCTACTCAGG 0: 72761
1: 205379
2: 228437
3: 173801
4: 346072
1149840511_1149840512 -9 Left 1149840511 17:59960636-59960658 CCTGTCTCTACTAAAAAAAGTAC 0: 24
1: 1074
2: 1936
3: 11029
4: 218813
Right 1149840512 17:59960650-59960672 AAAAAGTACAAAAGTTAGCCAGG 0: 19
1: 1006
2: 17962
3: 112649
4: 162974
1149840511_1149840518 30 Left 1149840511 17:59960636-59960658 CCTGTCTCTACTAAAAAAAGTAC 0: 24
1: 1074
2: 1936
3: 11029
4: 218813
Right 1149840518 17:59960689-59960711 TGTAATCCCAGCTACTCAGGAGG 0: 53856
1: 140530
2: 227977
3: 201243
4: 144859
1149840511_1149840513 -1 Left 1149840511 17:59960636-59960658 CCTGTCTCTACTAAAAAAAGTAC 0: 24
1: 1074
2: 1936
3: 11029
4: 218813
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840511 Original CRISPR GTACTTTTTTTAGTAGAGAC AGG (reversed) Intronic