ID: 1149840513

View in Genome Browser
Species Human (GRCh38)
Location 17:59960658-59960680
Sequence CAAAAGTTAGCCAGGCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117973
Summary {0: 1, 1: 25, 2: 1129, 3: 21245, 4: 95573}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149840510_1149840513 13 Left 1149840510 17:59960622-59960644 CCAACATGGTGAAACCTGTCTCT 0: 616
1: 1826
2: 3144
3: 3590
4: 5457
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573
1149840509_1149840513 14 Left 1149840509 17:59960621-59960643 CCCAACATGGTGAAACCTGTCTC 0: 6
1: 19
2: 49
3: 58
4: 232
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573
1149840511_1149840513 -1 Left 1149840511 17:59960636-59960658 CCTGTCTCTACTAAAAAAAGTAC 0: 24
1: 1074
2: 1936
3: 11029
4: 218813
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573
1149840507_1149840513 22 Left 1149840507 17:59960613-59960635 CCAGCCTGCCCAACATGGTGAAA 0: 1012
1: 109077
2: 182407
3: 160051
4: 147832
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573
1149840508_1149840513 18 Left 1149840508 17:59960617-59960639 CCTGCCCAACATGGTGAAACCTG 0: 7
1: 1219
2: 14239
3: 138815
4: 205200
Right 1149840513 17:59960658-59960680 CAAAAGTTAGCCAGGCGCCGTGG 0: 1
1: 25
2: 1129
3: 21245
4: 95573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840513 Original CRISPR CAAAAGTTAGCCAGGCGCCG TGG Intronic