ID: 1149840717

View in Genome Browser
Species Human (GRCh38)
Location 17:59962273-59962295
Sequence GGATTAAAAGAGTTAGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149840717_1149840720 24 Left 1149840717 17:59962273-59962295 CCGTGTTCTAACTCTTTTAATCC 0: 1
1: 0
2: 5
3: 30
4: 363
Right 1149840720 17:59962320-59962342 ATTTTTTTTTCTTACAAAGAAGG 0: 1
1: 3
2: 33
3: 482
4: 5658
1149840717_1149840721 29 Left 1149840717 17:59962273-59962295 CCGTGTTCTAACTCTTTTAATCC 0: 1
1: 0
2: 5
3: 30
4: 363
Right 1149840721 17:59962325-59962347 TTTTTCTTACAAAGAAGGTAAGG 0: 2
1: 0
2: 3
3: 59
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149840717 Original CRISPR GGATTAAAAGAGTTAGAACA CGG (reversed) Intronic
900010636 1:103912-103934 GAATTAAGAGAGCTAGAACTAGG - Intergenic
900026740 1:280478-280500 GAATTAAGAGAGCTAGAACTAGG - Intergenic
900036535 1:414381-414403 GAATTAAGAGAGCTAGAACTAGG - Intergenic
900058164 1:650135-650157 GAATTAAGAGAGCTAGAACTAGG - Intergenic
900820572 1:4884016-4884038 GGATTTAATGAGTTAGTATATGG - Intergenic
901286099 1:8080081-8080103 GAATTGAAAGAGTAAGAAGAGGG + Intergenic
901889518 1:12250638-12250660 GAATTAAATGAGTTAAATCATGG - Intronic
902813283 1:18901790-18901812 GGATTAAATGAGTTAATACATGG - Intronic
903894543 1:26595341-26595363 GGATTAAAAGAGTTAATATGTGG + Intergenic
904541586 1:31237338-31237360 GGATTAAATGAGTTAATACCTGG + Intronic
906094177 1:43209426-43209448 GGATTGAATGAGTTGCAACATGG + Intronic
906727852 1:48056999-48057021 GGATTATAAGAGATAGGACTGGG + Intergenic
907743811 1:57192468-57192490 GGATTAATTGAGTTAACACAAGG + Intronic
907892002 1:58645527-58645549 GGATTAAATGAGTTCATACATGG - Intergenic
909910636 1:81253904-81253926 AGATTATAAGAGTTAGTATATGG - Intergenic
910943296 1:92560403-92560425 GGGTTGAAAGAGTATGAACAGGG + Intronic
911048459 1:93649078-93649100 GGATAAGAAGACTGAGAACAAGG + Intronic
911086001 1:93978139-93978161 GGTTTTGCAGAGTTAGAACAGGG - Intergenic
911234657 1:95399051-95399073 GGATACACGGAGTTAGAACAAGG - Intergenic
911234666 1:95399129-95399151 GGAGTAAAAGGGATAGATCAAGG - Intergenic
912000316 1:104824867-104824889 GGATTAAATGATTAAGATCAGGG - Intergenic
912327091 1:108776776-108776798 TGATTAAATGAGTTAATACATGG + Intronic
912469802 1:109898754-109898776 GGATTAACTGAGTTACTACAGGG - Intergenic
913549191 1:119900319-119900341 GAATTAAAAGTGTTAGATCCAGG + Intergenic
917850409 1:179058635-179058657 CCATTAAAAGAGTTTGAATATGG + Intronic
918488320 1:185053152-185053174 GGATTAAATGAGATAAAACCTGG - Intronic
919426141 1:197433538-197433560 GGAATAATAGAGTGAGACCATGG + Intronic
919662813 1:200263875-200263897 GGAATAAAAAATTTACAACAGGG + Intergenic
920253716 1:204639752-204639774 GGATTAAAAGAGATAGTGAATGG - Intronic
920675612 1:208036531-208036553 GAATTAAAGAAGTTAAAACACGG + Intronic
920959541 1:210652176-210652198 GGATTGGAAGAGAGAGAACAGGG + Intronic
922259076 1:223919919-223919941 GAATTAAGAGAGCTAGAACTAGG - Intergenic
923308943 1:232716398-232716420 GGATTAAATGAGTTAATACTTGG + Intergenic
923944058 1:238862634-238862656 GGAATAAAAGATTTATTACAGGG - Intergenic
924159505 1:241216321-241216343 GAATAAAAAGAGGTAAAACATGG + Intronic
924226905 1:241929313-241929335 GGATTAAATGAGGTAATACATGG + Intergenic
924340266 1:243022669-243022691 GAATTAAGAGAGCTAGAACTAGG - Intergenic
924580655 1:245321133-245321155 GGATGAATAGAGAGAGAACAGGG - Intronic
1064495158 10:15901863-15901885 GGATTTAGAGAGTTAAGACATGG + Intergenic
1064643869 10:17440624-17440646 GGATAAGAAGTTTTAGAACACGG - Intronic
1065901059 10:30208357-30208379 GGATTAAATGAGATAATACATGG + Intergenic
1065917792 10:30367021-30367043 GGATTAAATGAGATAATACATGG - Intronic
1066341374 10:34537294-34537316 GGAATCAAAAAGTTAGAATACGG - Intronic
1066400748 10:35073510-35073532 GGATTAAACGAGTTTGTACAGGG - Intronic
1066736232 10:38482937-38482959 GAATTAAGAGAGCTAGAACTAGG + Intergenic
1067580590 10:47443112-47443134 GGATTAAAATAGTGAAAACGTGG + Intergenic
1067662316 10:48245631-48245653 TGGGTAAAAGACTTAGAACAAGG - Intronic
1067669293 10:48305023-48305045 GGATAAAAAGATTTTCAACATGG + Intergenic
1068834662 10:61540930-61540952 GGCTTTAAAGGGGTAGAACATGG - Intergenic
1069507895 10:69018205-69018227 TGATTAGAAGAGTGAGAGCAGGG - Intergenic
1070762661 10:79034415-79034437 GGATTGAAAGAGCAGGAACAGGG - Intergenic
1070939301 10:80329219-80329241 GGATTAAATGAGTTAATTCATGG - Intergenic
1070981309 10:80650432-80650454 TGATTAAAAGAGTCAGGAAAAGG - Intergenic
1072559677 10:96559537-96559559 GGATTAAAAGATTTAGCTAATGG - Intronic
1072566898 10:96624213-96624235 AGATTAAATGAGTTAATACATGG + Intronic
1074274570 10:111989128-111989150 GGATTAAAATCGATAGAACTGGG - Intergenic
1075243165 10:120796778-120796800 GGATTATAATAATTATAACATGG + Intergenic
1075431978 10:122392719-122392741 AGATTAAAAGAGTTAACATATGG + Intronic
1075526988 10:123195264-123195286 GGATAAACAGAGTGAGAAAATGG - Intergenic
1077852116 11:6083268-6083290 GAAATAAAAGTCTTAGAACAGGG + Intergenic
1078798774 11:14621928-14621950 GGATTAAATGAGTTACTAAATGG - Intronic
1078872377 11:15360855-15360877 GGATGAAAAGAGATAGAAGGTGG - Intergenic
1079087277 11:17455600-17455622 GGTTTAAAAGGGATAGAACCTGG + Intronic
1079370840 11:19850824-19850846 GAATAAAATGAGTTAAAACATGG - Intronic
1079912399 11:26327558-26327580 GGATTAAAAGAGTTTGTAAAAGG + Intronic
1079987904 11:27217705-27217727 GGATTAAATGAGATAATACAGGG - Intergenic
1080419796 11:32099669-32099691 GGATTGAAACAGTTGGAACTGGG - Intronic
1080464682 11:32485665-32485687 GGTTTAGAAGGGTTAGAAAATGG + Intergenic
1080892926 11:36425193-36425215 GGAATAAATGAGTTAGCCCAGGG - Intronic
1084032740 11:66490678-66490700 GGCTTAAAGGAGTTAACACACGG + Intronic
1084431408 11:69113498-69113520 GAATGAGAGGAGTTAGAACAGGG - Intergenic
1085085395 11:73663268-73663290 GGCTTAAATCAGTTTGAACAGGG - Intergenic
1085211920 11:74789008-74789030 GGATTAAATGACTTAGCCCAAGG - Intronic
1085373792 11:76039203-76039225 GGATTAAATGAGTGAATACATGG + Intronic
1086204656 11:84243435-84243457 AAAGTAAAAGAGTTAGAAAATGG + Intronic
1088251981 11:107869112-107869134 GGATTAAAAGAGCTTGAGCTAGG + Intronic
1088502755 11:110498902-110498924 CGATTGAAAGAGGTAGAATAAGG - Intergenic
1088990042 11:114945557-114945579 GGATTAAATGAGTTAACATATGG + Intergenic
1089022195 11:115227899-115227921 AGATTCCAAGGGTTAGAACATGG - Intronic
1089613537 11:119682670-119682692 GGATTAAAAGAGGGAGTCCATGG + Intronic
1089926002 11:122258383-122258405 GGAAGAAAAGAGGTAGAAGAAGG + Intergenic
1090153161 11:124406306-124406328 GGGTTAAATGATTTAGTACATGG + Intergenic
1090599362 11:128354554-128354576 GGATTACATGAGTTAACACATGG - Intergenic
1091627137 12:2130146-2130168 GGACTAAATGAGTTAACACACGG - Intronic
1091690650 12:2595048-2595070 GGTTTATAAGAGTTAGGAGATGG - Intronic
1094825070 12:34263608-34263630 GGATTAAAAAAGAAAGAAAAAGG - Intergenic
1095208350 12:39463981-39464003 GGATTAAATGAGTTAATATATGG - Intergenic
1095672176 12:44875293-44875315 GTCTTAACAGAGTTAGAACTTGG - Exonic
1097442345 12:59625602-59625624 GGAATAAATGAGTTACTACATGG + Intronic
1098591066 12:72213534-72213556 AAATTAACAGAGCTAGAACAGGG + Intronic
1099028192 12:77492011-77492033 GGAATAAAAGGGTAATAACAAGG - Intergenic
1099234478 12:80067643-80067665 GGATTAAATTAGTTAAAATATGG - Intergenic
1099682390 12:85844738-85844760 GGGTTGAAAGAGCTATAACAGGG + Intergenic
1100797787 12:98200646-98200668 TGATAAAAAGACTTAAAACAAGG - Intergenic
1102301360 12:111773979-111774001 AGTTTAAAAGAGTGGGAACATGG + Intronic
1102725931 12:115064781-115064803 GGTTTAAATGAGATAAAACATGG - Intergenic
1102843664 12:116154112-116154134 GGATTACATGAGTTAACACATGG - Intronic
1104157508 12:126148108-126148130 GGATTAAATGAGTTAATAAATGG - Intergenic
1104679201 12:130737472-130737494 GAAATAAAATAGTTAAAACAGGG - Intergenic
1105347239 13:19585181-19585203 GGATTAAATGGGTTAAAATATGG + Intergenic
1105626272 13:22116073-22116095 AAATAAAAAGAGTCAGAACATGG - Intergenic
1105713841 13:23041172-23041194 GGAGTATAAGATTTACAACATGG + Intergenic
1105845873 13:24293128-24293150 GGACTAAAGGAATTAGAAAAAGG + Intronic
1105891210 13:24683742-24683764 AGATTAAATGAGATAAAACAGGG + Intronic
1105998786 13:25699561-25699583 AGATAAAAAGAGTAAGAACCAGG + Intronic
1106069884 13:26399699-26399721 GGATTAAATGAGTTAATATATGG - Intronic
1107093636 13:36511618-36511640 AGATTAAATGAGTTTGATCAGGG - Intergenic
1108177985 13:47813536-47813558 GGATTAAAGGAGATAGGGCACGG - Intergenic
1108774255 13:53745065-53745087 GGATTAAAAAAATAAGAATAAGG + Intergenic
1108946966 13:56038963-56038985 GCATTAAAAGAGAAAGAAGAGGG + Intergenic
1110127813 13:71969202-71969224 AAATTAAATGAGTTAGAATACGG + Intergenic
1111677234 13:91401817-91401839 GGCTTAAAAGAATTGGAGCAGGG - Intronic
1112729079 13:102339089-102339111 GGATTAGAAGATTAAAAACAAGG + Intronic
1113142750 13:107173460-107173482 GGGTTGAATGAGTTAGAAGAGGG - Intronic
1114071664 14:19114519-19114541 GTATTAAAAAAGTATGAACAAGG + Intergenic
1115819351 14:37197644-37197666 GGATTAGAAGAGGGAGAACGCGG - Intergenic
1115961680 14:38840981-38841003 GGGTTAAAAGAACTAGTACATGG + Intergenic
1116539270 14:46078622-46078644 GGAATTAAAGAGTTAGAAGAAGG - Intergenic
1116678105 14:47931615-47931637 GGATTAAATGAGATAAAGCATGG + Intergenic
1118279964 14:64419438-64419460 GGATTAAAAGAGAAAGTACTAGG - Intronic
1119148986 14:72341036-72341058 GGAATAAAAAATATAGAACATGG + Intronic
1119395556 14:74323676-74323698 GGAGTCCAAGAGTTAGTACAGGG + Intronic
1120596435 14:86443082-86443104 GGATTCAATGAGTTAAGACATGG + Intergenic
1121221751 14:92290641-92290663 GCATTGAAAGAGATTGAACAAGG - Intergenic
1122057865 14:99117133-99117155 GGATTAAATGAGATAGTGCATGG - Intergenic
1123473257 15:20570144-20570166 GGATTAAATGAGATAATACATGG + Intergenic
1123644751 15:22430209-22430231 GGATTAAATGAGATAATACATGG - Intergenic
1123733557 15:23165155-23165177 GGATTAAATGAGATAATACATGG + Intergenic
1123751689 15:23362530-23362552 GGATTAAATGAGATAATACATGG + Intronic
1124284061 15:28386455-28386477 GGATTAAATGAGATAATACATGG + Intronic
1124298636 15:28525159-28525181 GGATTAAATGAGATAATACATGG - Intronic
1125499694 15:40231865-40231887 GGATTAAATGAGTTAGTGTATGG + Intergenic
1125697125 15:41648377-41648399 GGATTAAATGAGTTAATATATGG + Intronic
1126194446 15:45916809-45916831 GGATGAACAGAGGGAGAACAAGG - Intergenic
1126483355 15:49152519-49152541 GAAATAAAAAAGTTAAAACAAGG + Intronic
1126822217 15:52515534-52515556 AGATTAAATGAGATAGTACATGG - Intronic
1128030692 15:64477451-64477473 GAAGTAGAAGAGTTAGAAAAGGG - Intronic
1128231976 15:66041746-66041768 GGCTTAAATGAGTTAATACAGGG - Intronic
1128874350 15:71190031-71190053 GGATTAGAAGAGCTAGACCCGGG + Intronic
1129203371 15:74019767-74019789 GGATTAAATGAGTTAATATATGG - Intronic
1131394954 15:92078787-92078809 CGATTAAATGAGGTAGTACATGG + Intronic
1133346367 16:5073481-5073503 GGACTAAATGAGTTAATACATGG - Intronic
1135075290 16:19387924-19387946 GGATTAAATGCGTTAGTATATGG + Intergenic
1135965914 16:27034895-27034917 GGTTTATAAAAGTCAGAACAGGG - Intergenic
1136069706 16:27780554-27780576 GGATTAAACAAGTTAGAGCCAGG - Intergenic
1136383019 16:29905662-29905684 ACATTTAAAGGGTTAGAACAAGG + Intronic
1137384674 16:48030395-48030417 GGATTCAGTGAGTTAAAACATGG + Intergenic
1137394826 16:48109515-48109537 AGATAAATAGAGTTAGAAGAGGG + Intronic
1137413375 16:48248419-48248441 AGATTCAAAAAGGTAGAACATGG - Intronic
1139140294 16:64254180-64254202 GGATTATTGGACTTAGAACAAGG - Intergenic
1139370189 16:66462499-66462521 GCAATAAAAGAGTCAGGACAAGG + Intronic
1139432662 16:66919394-66919416 GTATTAATAGAGATAGCACATGG - Intergenic
1140044056 16:71428095-71428117 TGATTAGAAAACTTAGAACAAGG - Intergenic
1142453710 16:90202997-90203019 GAATTAAGAGAGCTAGAACTAGG + Intergenic
1143394095 17:6578100-6578122 GGATTAAATAAGTTACTACATGG + Intergenic
1143595227 17:7909926-7909948 AGATTCAAGGAATTAGAACAGGG - Intronic
1144426065 17:15143562-15143584 GATTTAACAGAGTAAGAACAAGG + Intergenic
1144471841 17:15550021-15550043 GGAAATAAAGAGTTAGAAAATGG - Intronic
1144924636 17:18794663-18794685 GGAAATAAAGAGTTAGAAAATGG + Intronic
1146521281 17:33527467-33527489 GGATTAAATGAGATACATCAGGG + Intronic
1147973882 17:44236644-44236666 GGAGGAAAAGAGTAAGAACACGG + Intergenic
1148084634 17:44986667-44986689 GGATTAAATGATTTATTACATGG - Intergenic
1148335521 17:46838292-46838314 GGATCAGAAGAGATAGAACGGGG + Intronic
1148920692 17:51030552-51030574 GGCATAAAAGAGTTACAAAATGG + Intronic
1149406398 17:56356211-56356233 GGATTAAAGGAGTCAATACATGG - Intronic
1149840717 17:59962273-59962295 GGATTAAAAGAGTTAGAACACGG - Intronic
1151452664 17:74208211-74208233 GTTTTTAAAGAGTTGGAACAAGG + Intronic
1151529269 17:74694212-74694234 GGATTAAATTAGTTACTACATGG + Intronic
1153135758 18:1916011-1916033 GAATTAGAAGACTTAGAAGATGG + Intergenic
1153713875 18:7825928-7825950 GGATTAAATGAGTTAATATATGG - Intronic
1153906264 18:9664141-9664163 GGCTTAAAAAAATTAAAACACGG + Intergenic
1154105654 18:11520470-11520492 GGTTTTAAAGAGGTAAAACATGG - Intergenic
1156190069 18:34708839-34708861 GGATTAAATGAGATAGTCCAAGG - Intronic
1157305382 18:46513340-46513362 GGATTCCAAGATTTAGAACACGG - Intronic
1157690071 18:49674416-49674438 GAATTATAAGAGGGAGAACAAGG + Intergenic
1158362153 18:56687491-56687513 GGATTAAAAGAAATAATACATGG - Intronic
1158591124 18:58779731-58779753 TGAGTAATAGAGTTAGGACAAGG - Intergenic
1159682199 18:71368583-71368605 TGATAAACAGAGTTAAAACAAGG - Intergenic
1159826530 18:73219533-73219555 GGGCTAAAAGAGCTGGAACAGGG - Intronic
1160040661 18:75342441-75342463 GGATTAAATGAGTCAAAGCATGG + Intergenic
1160281484 18:77494847-77494869 TGATTAAAAGGGTAAGAACATGG + Intergenic
1161258176 19:3321252-3321274 GGATTGAAGGAGATACAACATGG - Intergenic
1164539720 19:29113812-29113834 GAATTGAAAGAGTTGGCACAGGG - Intergenic
1164840242 19:31387780-31387802 GGCTAAAAAGTGGTAGAACAGGG - Intergenic
1165326646 19:35117984-35118006 GGGTTAAGTGAGTGAGAACACGG + Intronic
1165390535 19:35536169-35536191 GGATTAAATGAGGTAATACATGG - Intronic
1165908613 19:39209602-39209624 ACGTGAAAAGAGTTAGAACAGGG + Intergenic
1166520333 19:43475717-43475739 GGATTAAATGAATTAACACAAGG + Intronic
1168503099 19:56910003-56910025 GGGTTAAAATAGTGATAACAGGG - Intergenic
925762784 2:7202202-7202224 GGATTAAAAAAGGAAGAAAATGG + Intergenic
926185152 2:10684505-10684527 TGAGTAAAAGCATTAGAACATGG + Intronic
926969174 2:18449790-18449812 GGATTAAATGAGGTAGCACATGG + Intergenic
928023964 2:27724655-27724677 TTAATAAAAGAGTGAGAACAGGG - Intergenic
929022510 2:37567581-37567603 GGATTAAAGGAATTAATACATGG - Intergenic
929035425 2:37686894-37686916 TGATTAAACCAGTAAGAACATGG + Intronic
929468404 2:42167801-42167823 CGATTAAAAGAATAAGAACTTGG - Intergenic
930308272 2:49704167-49704189 GGATTAAAAGAATTCAGACAAGG + Intergenic
930373417 2:50533636-50533658 GGTTTAAAAAAGTAGGAACACGG - Intronic
930901794 2:56516120-56516142 GGTTTAAAAAAGTGAGAGCAGGG - Intergenic
930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG + Intergenic
932277791 2:70464293-70464315 TGATTAAATGAGTTAGCACACGG + Intronic
932829858 2:74978583-74978605 GGATTAAATGAGTTAATATATGG + Intergenic
933072908 2:77883903-77883925 GGATTAAAAGTGTTAAAATATGG + Intergenic
935523713 2:104141156-104141178 GGATTAAAGGATTTATAAAAAGG + Intergenic
936599869 2:113885310-113885332 GCATTAAAAGAGTAGGCACATGG + Intergenic
937139495 2:119586938-119586960 GGATTAAAATAGTTAATACATGG + Intronic
938759270 2:134409227-134409249 GGATTACATGAGATAGTACATGG - Intronic
938807667 2:134821936-134821958 GGATTAAAGGAATTAAATCAGGG - Intergenic
940302799 2:152193359-152193381 GGATTAACAGAGTTAATAAAAGG + Intergenic
941958556 2:171230104-171230126 GGATAAAAAGAGTTAGATGGTGG - Intronic
942121516 2:172782489-172782511 GGGTTGAAAGAGTTAGAGAAGGG - Intronic
942515016 2:176742856-176742878 TGATTCAAAGAGTCAGGACAAGG - Intergenic
943142873 2:184004634-184004656 GGATTGAAAGATTTAGATTAGGG + Intergenic
943486773 2:188495015-188495037 GGATTAGAAGAATTAGGACAGGG - Intronic
943719846 2:191192321-191192343 CAATTAAAAGAGGTAGAGCAGGG - Intergenic
945150275 2:206783587-206783609 GGATTAAGAGAGTAAGTACTGGG + Intronic
945167249 2:206959103-206959125 GGATTAAGAGACTTAGCATATGG + Intronic
945989914 2:216387227-216387249 GGAATAAAAATGTTAGAAAAGGG - Intergenic
946627907 2:221634648-221634670 GGATTGAAGGTGTTTGAACAGGG + Intergenic
947274411 2:228373941-228373963 AGAATGAAAGAGTTAGAAGATGG + Intergenic
948247684 2:236500173-236500195 GGATTACACGAGTTATTACATGG - Intronic
949085156 2:242147660-242147682 GAATTAAGAGAGCTAGAACTAGG + Intergenic
1170776428 20:19378786-19378808 GGAATTAAAGAGTTAGATCTTGG + Intronic
1172418776 20:34796321-34796343 ATATTAAAAAAGTTAGAACCAGG + Intronic
1172657212 20:36544473-36544495 GGATTAAAGGAGATAAAGCATGG + Intronic
1172840429 20:37899965-37899987 GGATTAAATGAGTTGTTACATGG - Intergenic
1173859909 20:46276562-46276584 GGATTAAAGGAGATAGAACCTGG - Intronic
1173951000 20:46993206-46993228 GGATGAAATGAGTTGAAACAGGG + Intronic
1174581247 20:51573475-51573497 GGATGAAATGAGTTAGCACATGG + Intergenic
1174766724 20:53261321-53261343 GCATTAAAAGAAAGAGAACAAGG - Intronic
1175133816 20:56808465-56808487 GGATTAAAATAGTTAAATCAAGG + Intergenic
1177746749 21:25223868-25223890 GAACTATAAGAGTTAGAAGAAGG + Intergenic
1179393378 21:41014417-41014439 GGATTAAAACAGAAAGAGCATGG + Intergenic
1180490105 22:15836850-15836872 GTATTAAAAAAGTATGAACAAGG + Intergenic
1180930781 22:19589445-19589467 GGATTAAAATTGATAGAACTTGG - Intergenic
1181092062 22:20480582-20480604 TGATTTAAAGAGTTTGGACAAGG - Intronic
1181379474 22:22489395-22489417 GGAATAAAAAAATTAGAAAATGG - Exonic
1181948586 22:26538126-26538148 GGATGAAAACATTTAGAACTAGG - Intronic
1182953319 22:34397544-34397566 GGATTAAAAGAAGTGCAACAGGG - Intergenic
1184897812 22:47422134-47422156 GGCTTCAAAGAGAGAGAACAGGG + Intergenic
949323787 3:2841206-2841228 GGATCAAAAGAGTTACAGCTGGG + Intronic
950112309 3:10427152-10427174 GGATTGAAAGAGAGAGAAGATGG - Intronic
950310574 3:11954310-11954332 GGATTAAATGAGATAGTGCATGG + Intergenic
950314585 3:11989345-11989367 GAGTTAAAAGAGTTAAAACCAGG - Intergenic
950315546 3:11998812-11998834 GGATTAAATCAGATAGCACATGG + Intergenic
950386965 3:12667540-12667562 GGATTAAATGAGATAAAACCTGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950703136 3:14763770-14763792 GGATTAGAGGAGTCAGCACATGG + Intronic
950897041 3:16462205-16462227 TGATTTATAGAGTCAGAACAAGG + Intronic
951104862 3:18730953-18730975 GGATAAAATGAGTTAATACATGG - Intergenic
951226786 3:20129674-20129696 GGTTTCAAAGAGTTAGTATAAGG - Intronic
951671749 3:25190985-25191007 GGAGGAAAAGAGTTAGATGATGG - Intronic
952428222 3:33197013-33197035 GGATTAAATGAGTGAACACAGGG + Intronic
953234397 3:41093529-41093551 GGATTAAATGAGTTAGTACATGG - Intergenic
953381464 3:42475890-42475912 GGATTAAATGAGTTAGCACACGG - Intergenic
955867027 3:63395948-63395970 AGATTAAATGAATAAGAACATGG + Intronic
956286562 3:67616156-67616178 GGATTATAAGAGTTACAACATGG + Intronic
956342948 3:68246900-68246922 GGATGATAAATGTTAGAACATGG + Intronic
956439614 3:69267093-69267115 GGATAGAAAGAGATAGGACAGGG + Intronic
957513550 3:81221576-81221598 GTATTAAATGAGTTACAACGGGG - Intergenic
959033541 3:101332826-101332848 GACATAAAAGAGTAAGAACATGG - Exonic
960667129 3:120120338-120120360 GGACTAAATGAGATAGCACACGG - Intergenic
960748575 3:120918595-120918617 GGATTAATAGTGTAAGCACAGGG - Intronic
962196019 3:133364361-133364383 GAATTAAATGAGTGAGAAGAAGG + Intronic
962875014 3:139529237-139529259 GGATTAAAAGAATTAATGCATGG + Intronic
963136773 3:141912817-141912839 GGAGTAAAATGGTTAGAACTTGG - Intronic
963184844 3:142402764-142402786 GGACTAGAAAAGTTAAAACAGGG - Intronic
963286508 3:143439173-143439195 GGATTAACAGAGTTAACCCAGGG - Intronic
964002951 3:151798102-151798124 GGATGAATAAAGTTAGAACATGG - Intergenic
964555820 3:157936749-157936771 GGCTTAAAAGAGTCAAAACCAGG + Intergenic
966130553 3:176633510-176633532 GGTTTAAAATAGTTAAACCAAGG + Intergenic
967995534 3:195163590-195163612 GGATCAAACGAGTTAAAGCATGG - Intronic
969640510 4:8395528-8395550 GGATTAACAAAGTTAGGGCATGG - Intronic
970924642 4:21436952-21436974 GGATTGAAGGTGTTAGAATATGG - Intronic
970988725 4:22188784-22188806 GGATTAAATGAGTTAAGACATGG - Intergenic
971280234 4:25237200-25237222 TGATTAAAATAACTAGAACAAGG - Intronic
971689742 4:29817557-29817579 GAAATAAAAGAGTTATTACATGG + Intergenic
971759307 4:30744651-30744673 GGCTCACAAGAGTTAGAATATGG + Intronic
971954444 4:33397495-33397517 GGCTTAAAAGAGTAAGTAGAGGG + Intergenic
971987299 4:33842983-33843005 GGATAAAAAGAGTAAGAACATGG - Intergenic
973090303 4:46127329-46127351 GGATTAAATGAATTAATACATGG + Intergenic
974545160 4:63295559-63295581 GGATTAAATGAGTTATAAATTGG - Intergenic
975028978 4:69589801-69589823 GGATTTTAAGAGTTACAAAAAGG + Intronic
975382803 4:73721835-73721857 GGATTAAATGACTTAATACATGG + Intergenic
979262587 4:118665905-118665927 GAATTAAGAGAGCTAGAACTAGG + Intergenic
980622944 4:135333181-135333203 GTGTTAAAAGGGTTAGAAAATGG + Intergenic
980889777 4:138802168-138802190 GGAATAAATGAGTGAGAAGATGG - Intergenic
982391081 4:154864341-154864363 GGATTAAATGACTTAATACATGG + Intergenic
982950872 4:161693936-161693958 AGATTAAAAGAATTACAAGAAGG - Intronic
983361584 4:166730411-166730433 GGATGAAATGAGTTAATACATGG - Intergenic
983571176 4:169209513-169209535 GGAATAACAGAGTGAGGACAGGG + Intronic
984090429 4:175367750-175367772 GCATTAAATGAGTAAGAAAAGGG - Intergenic
987059910 5:14232821-14232843 GGATGAAAATATTTAAAACAAGG + Intronic
988417533 5:30964330-30964352 GGCTTACAAGAGCTAGAACAAGG + Intergenic
988706780 5:33734492-33734514 GAATTAAAAAAATTATAACAAGG + Intronic
990697238 5:58433806-58433828 GGATTAATAGTGTTATAAAAGGG - Intergenic
992768636 5:80026773-80026795 GTATTAAAAGTTTTAGACCAGGG - Intronic
993212552 5:84971796-84971818 GGATTAAAACAGATAGCTCAAGG - Intergenic
993439886 5:87943552-87943574 TCATTTGAAGAGTTAGAACATGG - Intergenic
993815485 5:92539679-92539701 AGATGCAAAGAGTTAAAACAGGG - Intergenic
994469512 5:100185181-100185203 TGATTAAAATAGTTAAAACTTGG - Intergenic
994915426 5:105970302-105970324 AGATTAAAAGAGTGAGACTATGG - Intergenic
995739074 5:115335405-115335427 GGATTAAATAAGTTAGAACAAGG + Intergenic
995904796 5:117110621-117110643 GGATTAAACCAGTTAGGGCATGG + Intergenic
996544870 5:124667706-124667728 GGATTAAAAGAGTTAATATTTGG - Intronic
997149902 5:131482030-131482052 GGATTAAAATACTTACAACTTGG + Intronic
997817256 5:137031148-137031170 GAATAAAAAGAGTTAGGAAATGG - Intronic
997925905 5:138031385-138031407 GGATTAAAAAAGTAAGAAGGGGG + Intronic
999663146 5:153886456-153886478 GGATTAAATGAGTTAACACAAGG + Intergenic
1000806769 5:165804903-165804925 GGATTAAAAGTGGTAGAGAATGG - Intergenic
1001541941 5:172545709-172545731 GGATTAAATGAGTTAATTCATGG + Intergenic
1002737286 5:181404483-181404505 GAATTAAGAGAGCTAGAACTAGG + Intergenic
1005410762 6:25543466-25543488 GGATCAAAAGAGGGAAAACAGGG - Intronic
1006827645 6:36947977-36947999 GCATTAAATGAGTTAGTACATGG - Intergenic
1008465874 6:51829995-51830017 GGATTAAATTAGTTGGTACATGG + Intronic
1010455216 6:76046724-76046746 ATATTAAATGAGTTATAACATGG + Intronic
1010509388 6:76699604-76699626 TGATTAAAAGAGGGACAACATGG - Intergenic
1010760488 6:79716903-79716925 GGATGATAAGAGTTTGAACTAGG + Intergenic
1011413324 6:87089210-87089232 GGTTTCAAAGAGTTAGCACTGGG + Intronic
1011729463 6:90245815-90245837 GGATTAAAATATTTGTAACAGGG + Intronic
1012069756 6:94599159-94599181 GGATTAAATGATTTTGCACATGG - Intergenic
1012100119 6:95073385-95073407 AGAATAAAAGAGTTAGAAGGAGG - Intergenic
1013270269 6:108538517-108538539 GGATGAAAGGTGTTAGACCATGG - Intergenic
1014308823 6:119772998-119773020 GGATTAAGAGACTTAGATTAAGG - Intergenic
1015040923 6:128717833-128717855 GGATTAATAGAGTTAAAAGCTGG - Intergenic
1015862376 6:137694459-137694481 GGATTAAATGAGCTAACACAAGG + Intergenic
1016506391 6:144785187-144785209 TGAATAGAAGTGTTAGAACAAGG - Intronic
1019242381 6:170680039-170680061 GAATTAAGAGAGCTAGAACTAGG + Intergenic
1022150306 7:27596293-27596315 GGATTAATAATGTTAGAAAAGGG - Intronic
1022503248 7:30895548-30895570 GGATTAAGTGAGTTACTACATGG + Intergenic
1023491775 7:40750641-40750663 GCATGAAAAGAGTAAGAAGAGGG + Intronic
1023681996 7:42696757-42696779 GGATTAAAGGAGATAGGGCATGG - Intergenic
1024447683 7:49500688-49500710 GGATTAGAAGAGTAGGAAGAAGG - Intergenic
1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG + Intronic
1030444382 7:109630783-109630805 GGATTAAAAGAGTTTATACATGG - Intergenic
1030883506 7:114911349-114911371 GGATAAAAAGAGATGGACCAAGG + Intergenic
1031072735 7:117179998-117180020 GGTGTAAAAGAGTTAGAATTTGG + Intronic
1031179890 7:118400524-118400546 AAATTAAAAGAGATAGAATAAGG + Intergenic
1032994913 7:137434165-137434187 GGAAAAAAGGAGTTAGAAAAAGG - Intronic
1033122670 7:138679699-138679721 TGATTAAATGAGTTAGTTCACGG + Intronic
1033175247 7:139117686-139117708 GGATTAAAAGACTCAGAAAAGGG - Intergenic
1033943699 7:146687383-146687405 GGTTTAAATGAGATAGTACATGG + Intronic
1034257286 7:149731547-149731569 TGATTAAATGAGATAGAAGACGG - Intronic
1034724070 7:153319074-153319096 GGAATAAAAGAGGTACAACAAGG + Intergenic
1035505736 8:128115-128137 GAATTAAGAGAGCTAGAACTAGG - Intergenic
1035942251 8:3914424-3914446 GAAATAGAAGATTTAGAACATGG - Intronic
1035986369 8:4436620-4436642 GGATTAAAAAAAATAGAAGAAGG - Intronic
1036977522 8:13430906-13430928 AGTTTAAAAGAGTTATAACATGG + Intronic
1038359234 8:26860968-26860990 GGATAAAAAAAGTGGGAACAGGG - Intronic
1039366560 8:36934159-36934181 GAATTAAAACAGCTAGGACACGG + Intronic
1041415631 8:57605137-57605159 GGATTAAAATAGGTAGTGCATGG + Intergenic
1041829773 8:62141521-62141543 GGATTAAAACTATTAGAACTAGG - Intergenic
1043305934 8:78795139-78795161 GGATTAAATTAGTTAACACATGG + Intronic
1043658887 8:82709592-82709614 TAATTCAAAGAGTAAGAACAAGG - Intergenic
1044357199 8:91236324-91236346 GGAATAATAGAGTTAGGAGAAGG + Intronic
1045163475 8:99575961-99575983 GGACTAAATGAGTTATTACAAGG - Intronic
1045182462 8:99799370-99799392 GGATAAAATGAGTTAGGACAAGG + Intronic
1045629007 8:104094198-104094220 GGATTAAAAATTTTATAACAGGG + Intronic
1045946273 8:107800125-107800147 GGATTAAGTGAGTTGGTACACGG + Intergenic
1048783617 8:138027327-138027349 GGATTGAATGAATTAGTACATGG - Intergenic
1050226736 9:3466465-3466487 GAATTAAAAGATGAAGAACATGG + Intronic
1051436221 9:17035432-17035454 GGATCAAAAGATTTAGCATAGGG - Intergenic
1052299732 9:26940544-26940566 AGATAAAAAGAGTTAAAAGATGG + Intronic
1052768744 9:32668326-32668348 GCATACAAAGAGTTAGAACAGGG + Intergenic
1053456957 9:38240644-38240666 GAATCAACACAGTTAGAACAAGG - Intergenic
1055769362 9:79700613-79700635 GGATTAAAAGACTTATTACATGG - Intronic
1057450469 9:95154647-95154669 GAAGTAAAAGTGTTAAAACATGG + Intronic
1059409148 9:114121298-114121320 GGATTAAATGAGTTAATACATGG + Intergenic
1059725263 9:117002488-117002510 GGAATAAGAGAGTAAGACCAGGG + Intronic
1059998881 9:119940226-119940248 GGATTAAATGAGCTAGTCCATGG + Intergenic
1060189858 9:121585447-121585469 GGATTAAAGCACTTAGAACAGGG + Intronic
1060400340 9:123344955-123344977 GGATTGAATGAGTTAGAATTTGG + Intergenic
1203602572 Un_KI270748v1:29263-29285 GAATTAAGAGAGCTAGAACTAGG + Intergenic
1185495485 X:551116-551138 GAAATAAAAGAGTAAGATCAAGG + Intergenic
1186092060 X:6060597-6060619 GGATTAGAAGAGGAAGAAGAAGG - Intronic
1187560682 X:20400145-20400167 AGATGAAAAGAGTTTGAAAATGG - Intergenic
1187830533 X:23376682-23376704 GGATAACAAGAGTTATAATAAGG - Intronic
1188360650 X:29248651-29248673 GGATTAACAAAGTTAAAAAATGG + Intronic
1188485207 X:30674851-30674873 GGATAAATAGTATTAGAACAAGG + Intronic
1188559016 X:31446615-31446637 GGATTAAAAGTATCAGAATAAGG + Intronic
1188829339 X:34877021-34877043 GGATTAGAAGAGACAGAAAATGG + Intergenic
1190417686 X:50197303-50197325 GGACTGAAAGAGATAAAACATGG - Intronic
1192296123 X:69850448-69850470 GGATTAAATGAGTTGGAGAAAGG - Intronic
1192318901 X:70073230-70073252 GGATTAAAAGAGTTTTATCAGGG + Intergenic
1193130337 X:77913113-77913135 AGATAAAAGGAGTTATAACAAGG - Intronic
1193596129 X:83447716-83447738 GTTTTAGAATAGTTAGAACAGGG + Intergenic
1193859823 X:86651627-86651649 TAATGAAAAGAGGTAGAACAGGG + Intronic
1193980643 X:88177466-88177488 GTATTAAAAGGGGCAGAACATGG - Intergenic
1195320151 X:103715125-103715147 GCCCTAAAAGAGTTAGAGCAGGG - Intronic
1195858429 X:109355639-109355661 GGATGAGAAGAGGAAGAACAAGG + Intergenic
1195938923 X:110150929-110150951 GGATTAAATGAGTTAATGCATGG - Intronic
1196083042 X:111653657-111653679 GGGTTAAAAAAATAAGAACATGG + Intergenic
1196319023 X:114266911-114266933 GGATTAAATGAGTTAACAGATGG - Intergenic
1196701712 X:118677029-118677051 GGATTAAATGAGTTAATATATGG + Intronic
1197124432 X:122927511-122927533 GGATTAAATGAGATAATACATGG - Intergenic
1197854094 X:130896511-130896533 GTATAAAAAGAGAAAGAACAAGG - Intronic
1201061140 Y:10047841-10047863 GTATTAAAAGACTAAGAACTGGG + Intergenic
1202384658 Y:24314361-24314383 GAATTAAGAGAGCTAGAACTAGG + Intergenic
1202486126 Y:25355761-25355783 GAATTAAGAGAGCTAGAACTAGG - Intergenic