ID: 1149845366

View in Genome Browser
Species Human (GRCh38)
Location 17:60006428-60006450
Sequence CCCCCACACCTCCCCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149845362_1149845366 -4 Left 1149845362 17:60006409-60006431 CCCAGACACTCTGGGCTTCCCCC No data
Right 1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG No data
1149845363_1149845366 -5 Left 1149845363 17:60006410-60006432 CCAGACACTCTGGGCTTCCCCCC No data
Right 1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG No data
1149845360_1149845366 1 Left 1149845360 17:60006404-60006426 CCCTGCCCAGACACTCTGGGCTT No data
Right 1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG No data
1149845355_1149845366 26 Left 1149845355 17:60006379-60006401 CCCAGTAGACGCTCTGGGTTTCC No data
Right 1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG No data
1149845356_1149845366 25 Left 1149845356 17:60006380-60006402 CCAGTAGACGCTCTGGGTTTCCT No data
Right 1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG No data
1149845357_1149845366 5 Left 1149845357 17:60006400-60006422 CCTACCCTGCCCAGACACTCTGG No data
Right 1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG No data
1149845361_1149845366 0 Left 1149845361 17:60006405-60006427 CCTGCCCAGACACTCTGGGCTTC No data
Right 1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149845366 Original CRISPR CCCCCACACCTCCCCCAGCC TGG Intergenic
No off target data available for this crispr