ID: 1149845730

View in Genome Browser
Species Human (GRCh38)
Location 17:60008626-60008648
Sequence GGCTGAACACCCTGCGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149845730_1149845737 -2 Left 1149845730 17:60008626-60008648 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1149845737 17:60008647-60008669 CCTGCCAGCAGGTGGCCGGCTGG No data
1149845730_1149845734 -10 Left 1149845730 17:60008626-60008648 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1149845734 17:60008639-60008661 GTGTTCAGCCTGCCAGCAGGTGG No data
1149845730_1149845740 8 Left 1149845730 17:60008626-60008648 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1149845740 17:60008657-60008679 GGTGGCCGGCTGGTCCTCCTGGG No data
1149845730_1149845735 -6 Left 1149845730 17:60008626-60008648 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1149845735 17:60008643-60008665 TCAGCCTGCCAGCAGGTGGCCGG No data
1149845730_1149845743 19 Left 1149845730 17:60008626-60008648 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1149845743 17:60008668-60008690 GGTCCTCCTGGGATATGGCACGG No data
1149845730_1149845742 14 Left 1149845730 17:60008626-60008648 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1149845742 17:60008663-60008685 CGGCTGGTCCTCCTGGGATATGG No data
1149845730_1149845739 7 Left 1149845730 17:60008626-60008648 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1149845739 17:60008656-60008678 AGGTGGCCGGCTGGTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149845730 Original CRISPR GGCTGAACACCCTGCGGAGC GGG (reversed) Intergenic