ID: 1149845789

View in Genome Browser
Species Human (GRCh38)
Location 17:60008844-60008866
Sequence CGGGAAGACACCTACCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149845789_1149845806 27 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845806 17:60008894-60008916 AGAACGAGGTGCCCGTGGCGGGG No data
1149845789_1149845795 -3 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845795 17:60008864-60008886 CCGGACAGCCCCACCAGGACAGG No data
1149845789_1149845797 3 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845797 17:60008870-60008892 AGCCCCACCAGGACAGGGTGTGG No data
1149845789_1149845805 26 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845805 17:60008893-60008915 AAGAACGAGGTGCCCGTGGCGGG No data
1149845789_1149845803 22 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845803 17:60008889-60008911 GTGGAAGAACGAGGTGCCCGTGG No data
1149845789_1149845792 -8 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845792 17:60008859-60008881 TCTTCCCGGACAGCCCCACCAGG No data
1149845789_1149845804 25 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845804 17:60008892-60008914 GAAGAACGAGGTGCCCGTGGCGG No data
1149845789_1149845802 13 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845802 17:60008880-60008902 GGACAGGGTGTGGAAGAACGAGG No data
1149845789_1149845796 -2 Left 1149845789 17:60008844-60008866 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1149845796 17:60008865-60008887 CGGACAGCCCCACCAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149845789 Original CRISPR CGGGAAGACACCTACCCTGT GGG (reversed) Intergenic
No off target data available for this crispr