ID: 1149846859

View in Genome Browser
Species Human (GRCh38)
Location 17:60013428-60013450
Sequence GATGAAGGAGTCGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149846859_1149846863 -7 Left 1149846859 17:60013428-60013450 CCTCCTGGGGCGACTCCTTCATC No data
Right 1149846863 17:60013444-60013466 CTTCATCCTCCAAGTCTCCAGGG No data
1149846859_1149846862 -8 Left 1149846859 17:60013428-60013450 CCTCCTGGGGCGACTCCTTCATC No data
Right 1149846862 17:60013443-60013465 CCTTCATCCTCCAAGTCTCCAGG No data
1149846859_1149846864 -4 Left 1149846859 17:60013428-60013450 CCTCCTGGGGCGACTCCTTCATC No data
Right 1149846864 17:60013447-60013469 CATCCTCCAAGTCTCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149846859 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr