ID: 1149846972

View in Genome Browser
Species Human (GRCh38)
Location 17:60014001-60014023
Sequence CCTCCCGTGGCTCCTACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149846960_1149846972 17 Left 1149846960 17:60013961-60013983 CCCTAATTCTCCCAGCATTTGGT No data
Right 1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG No data
1149846963_1149846972 6 Left 1149846963 17:60013972-60013994 CCAGCATTTGGTGCCCTCTATCC No data
Right 1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG No data
1149846962_1149846972 7 Left 1149846962 17:60013971-60013993 CCCAGCATTTGGTGCCCTCTATC No data
Right 1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG No data
1149846965_1149846972 -8 Left 1149846965 17:60013986-60014008 CCTCTATCCTGCCACCCTCCCGT No data
Right 1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG No data
1149846961_1149846972 16 Left 1149846961 17:60013962-60013984 CCTAATTCTCCCAGCATTTGGTG No data
Right 1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG No data
1149846958_1149846972 18 Left 1149846958 17:60013960-60013982 CCCCTAATTCTCCCAGCATTTGG No data
Right 1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG No data
1149846957_1149846972 24 Left 1149846957 17:60013954-60013976 CCAGGACCCCTAATTCTCCCAGC No data
Right 1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG No data
1149846964_1149846972 -7 Left 1149846964 17:60013985-60014007 CCCTCTATCCTGCCACCCTCCCG No data
Right 1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149846972 Original CRISPR CCTCCCGTGGCTCCTACCAT GGG Intergenic
No off target data available for this crispr