ID: 1149847589

View in Genome Browser
Species Human (GRCh38)
Location 17:60016662-60016684
Sequence TGTAGCCCTAGGAGAACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149847589_1149847599 11 Left 1149847589 17:60016662-60016684 CCCCCCGTTCTCCTAGGGCTACA No data
Right 1149847599 17:60016696-60016718 CACCATGCCTTTTCCCCTCACGG No data
1149847589_1149847600 12 Left 1149847589 17:60016662-60016684 CCCCCCGTTCTCCTAGGGCTACA No data
Right 1149847600 17:60016697-60016719 ACCATGCCTTTTCCCCTCACGGG No data
1149847589_1149847604 22 Left 1149847589 17:60016662-60016684 CCCCCCGTTCTCCTAGGGCTACA No data
Right 1149847604 17:60016707-60016729 TTCCCCTCACGGGACAGTGAGGG No data
1149847589_1149847603 21 Left 1149847589 17:60016662-60016684 CCCCCCGTTCTCCTAGGGCTACA No data
Right 1149847603 17:60016706-60016728 TTTCCCCTCACGGGACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149847589 Original CRISPR TGTAGCCCTAGGAGAACGGG GGG (reversed) Intergenic