ID: 1149847971

View in Genome Browser
Species Human (GRCh38)
Location 17:60018380-60018402
Sequence CTGCTGCCCTTGGGCAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149847971_1149847976 -7 Left 1149847971 17:60018380-60018402 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1149847976 17:60018396-60018418 GCAGCAGGCTCCCCCGGACAAGG No data
1149847971_1149847984 14 Left 1149847971 17:60018380-60018402 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1149847984 17:60018417-60018439 GGGACCATGTGTGTTCAGTGGGG No data
1149847971_1149847977 -6 Left 1149847971 17:60018380-60018402 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1149847977 17:60018397-60018419 CAGCAGGCTCCCCCGGACAAGGG No data
1149847971_1149847983 13 Left 1149847971 17:60018380-60018402 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1149847983 17:60018416-60018438 AGGGACCATGTGTGTTCAGTGGG No data
1149847971_1149847982 12 Left 1149847971 17:60018380-60018402 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1149847982 17:60018415-60018437 AAGGGACCATGTGTGTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149847971 Original CRISPR CTGCTGCCCTTGGGCAGCTG TGG (reversed) Intergenic
No off target data available for this crispr