ID: 1149849981

View in Genome Browser
Species Human (GRCh38)
Location 17:60028487-60028509
Sequence TGACCTCTGTCCACAGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149849981_1149849994 15 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849994 17:60028525-60028547 CAGCCCCACAGAGGGCTGGGTGG No data
1149849981_1149850001 28 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149850001 17:60028538-60028560 GGCTGGGTGGAGGCACTGGTGGG No data
1149849981_1149849990 6 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849990 17:60028516-60028538 ATGGGAGGGCAGCCCCACAGAGG No data
1149849981_1149849996 18 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849996 17:60028528-60028550 CCCCACAGAGGGCTGGGTGGAGG No data
1149849981_1149849992 11 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849992 17:60028521-60028543 AGGGCAGCCCCACAGAGGGCTGG No data
1149849981_1149849993 12 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data
1149849981_1149850000 27 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149850000 17:60028537-60028559 GGGCTGGGTGGAGGCACTGGTGG No data
1149849981_1149849999 24 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849999 17:60028534-60028556 AGAGGGCTGGGTGGAGGCACTGG No data
1149849981_1149849987 -9 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849987 17:60028501-60028523 CAGAGGTCAGACTCCATGGGAGG No data
1149849981_1149849988 -8 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849981_1149849991 7 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849991 17:60028517-60028539 TGGGAGGGCAGCCCCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149849981 Original CRISPR TGACCTCTGTCCACAGAAGG GGG (reversed) Intergenic
No off target data available for this crispr