ID: 1149849988

View in Genome Browser
Species Human (GRCh38)
Location 17:60028502-60028524
Sequence AGAGGTCAGACTCCATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149849983_1149849988 -10 Left 1149849983 17:60028489-60028511 CCCTTCTGTGGACAGAGGTCAGA No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849973_1149849988 19 Left 1149849973 17:60028460-60028482 CCTGACCTGGAATCAGCCTCCTG No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849974_1149849988 14 Left 1149849974 17:60028465-60028487 CCTGGAATCAGCCTCCTGCCCTC No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849982_1149849988 -9 Left 1149849982 17:60028488-60028510 CCCCTTCTGTGGACAGAGGTCAG No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849978_1149849988 -4 Left 1149849978 17:60028483-60028505 CCCTCCCCCTTCTGTGGACAGAG No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849979_1149849988 -5 Left 1149849979 17:60028484-60028506 CCTCCCCCTTCTGTGGACAGAGG No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849981_1149849988 -8 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849975_1149849988 3 Left 1149849975 17:60028476-60028498 CCTCCTGCCCTCCCCCTTCTGTG No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849972_1149849988 20 Left 1149849972 17:60028459-60028481 CCCTGACCTGGAATCAGCCTCCT No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849977_1149849988 0 Left 1149849977 17:60028479-60028501 CCTGCCCTCCCCCTTCTGTGGAC No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data
1149849971_1149849988 30 Left 1149849971 17:60028449-60028471 CCTAACAGCTCCCTGACCTGGAA No data
Right 1149849988 17:60028502-60028524 AGAGGTCAGACTCCATGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149849988 Original CRISPR AGAGGTCAGACTCCATGGGA GGG Intergenic
No off target data available for this crispr