ID: 1149849993

View in Genome Browser
Species Human (GRCh38)
Location 17:60028522-60028544
Sequence GGGCAGCCCCACAGAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149849982_1149849993 11 Left 1149849982 17:60028488-60028510 CCCCTTCTGTGGACAGAGGTCAG No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data
1149849979_1149849993 15 Left 1149849979 17:60028484-60028506 CCTCCCCCTTCTGTGGACAGAGG No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data
1149849984_1149849993 9 Left 1149849984 17:60028490-60028512 CCTTCTGTGGACAGAGGTCAGAC No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data
1149849983_1149849993 10 Left 1149849983 17:60028489-60028511 CCCTTCTGTGGACAGAGGTCAGA No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data
1149849978_1149849993 16 Left 1149849978 17:60028483-60028505 CCCTCCCCCTTCTGTGGACAGAG No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data
1149849977_1149849993 20 Left 1149849977 17:60028479-60028501 CCTGCCCTCCCCCTTCTGTGGAC No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data
1149849981_1149849993 12 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data
1149849975_1149849993 23 Left 1149849975 17:60028476-60028498 CCTCCTGCCCTCCCCCTTCTGTG No data
Right 1149849993 17:60028522-60028544 GGGCAGCCCCACAGAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149849993 Original CRISPR GGGCAGCCCCACAGAGGGCT GGG Intergenic
No off target data available for this crispr