ID: 1149849999

View in Genome Browser
Species Human (GRCh38)
Location 17:60028534-60028556
Sequence AGAGGGCTGGGTGGAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149849979_1149849999 27 Left 1149849979 17:60028484-60028506 CCTCCCCCTTCTGTGGACAGAGG No data
Right 1149849999 17:60028534-60028556 AGAGGGCTGGGTGGAGGCACTGG No data
1149849978_1149849999 28 Left 1149849978 17:60028483-60028505 CCCTCCCCCTTCTGTGGACAGAG No data
Right 1149849999 17:60028534-60028556 AGAGGGCTGGGTGGAGGCACTGG No data
1149849982_1149849999 23 Left 1149849982 17:60028488-60028510 CCCCTTCTGTGGACAGAGGTCAG No data
Right 1149849999 17:60028534-60028556 AGAGGGCTGGGTGGAGGCACTGG No data
1149849983_1149849999 22 Left 1149849983 17:60028489-60028511 CCCTTCTGTGGACAGAGGTCAGA No data
Right 1149849999 17:60028534-60028556 AGAGGGCTGGGTGGAGGCACTGG No data
1149849989_1149849999 -3 Left 1149849989 17:60028514-60028536 CCATGGGAGGGCAGCCCCACAGA No data
Right 1149849999 17:60028534-60028556 AGAGGGCTGGGTGGAGGCACTGG No data
1149849981_1149849999 24 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149849999 17:60028534-60028556 AGAGGGCTGGGTGGAGGCACTGG No data
1149849984_1149849999 21 Left 1149849984 17:60028490-60028512 CCTTCTGTGGACAGAGGTCAGAC No data
Right 1149849999 17:60028534-60028556 AGAGGGCTGGGTGGAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149849999 Original CRISPR AGAGGGCTGGGTGGAGGCAC TGG Intergenic
No off target data available for this crispr