ID: 1149850000

View in Genome Browser
Species Human (GRCh38)
Location 17:60028537-60028559
Sequence GGGCTGGGTGGAGGCACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149849982_1149850000 26 Left 1149849982 17:60028488-60028510 CCCCTTCTGTGGACAGAGGTCAG No data
Right 1149850000 17:60028537-60028559 GGGCTGGGTGGAGGCACTGGTGG No data
1149849984_1149850000 24 Left 1149849984 17:60028490-60028512 CCTTCTGTGGACAGAGGTCAGAC No data
Right 1149850000 17:60028537-60028559 GGGCTGGGTGGAGGCACTGGTGG No data
1149849979_1149850000 30 Left 1149849979 17:60028484-60028506 CCTCCCCCTTCTGTGGACAGAGG No data
Right 1149850000 17:60028537-60028559 GGGCTGGGTGGAGGCACTGGTGG No data
1149849989_1149850000 0 Left 1149849989 17:60028514-60028536 CCATGGGAGGGCAGCCCCACAGA No data
Right 1149850000 17:60028537-60028559 GGGCTGGGTGGAGGCACTGGTGG No data
1149849983_1149850000 25 Left 1149849983 17:60028489-60028511 CCCTTCTGTGGACAGAGGTCAGA No data
Right 1149850000 17:60028537-60028559 GGGCTGGGTGGAGGCACTGGTGG No data
1149849981_1149850000 27 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149850000 17:60028537-60028559 GGGCTGGGTGGAGGCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149850000 Original CRISPR GGGCTGGGTGGAGGCACTGG TGG Intergenic
No off target data available for this crispr