ID: 1149850001

View in Genome Browser
Species Human (GRCh38)
Location 17:60028538-60028560
Sequence GGCTGGGTGGAGGCACTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149849983_1149850001 26 Left 1149849983 17:60028489-60028511 CCCTTCTGTGGACAGAGGTCAGA No data
Right 1149850001 17:60028538-60028560 GGCTGGGTGGAGGCACTGGTGGG No data
1149849984_1149850001 25 Left 1149849984 17:60028490-60028512 CCTTCTGTGGACAGAGGTCAGAC No data
Right 1149850001 17:60028538-60028560 GGCTGGGTGGAGGCACTGGTGGG No data
1149849989_1149850001 1 Left 1149849989 17:60028514-60028536 CCATGGGAGGGCAGCCCCACAGA No data
Right 1149850001 17:60028538-60028560 GGCTGGGTGGAGGCACTGGTGGG No data
1149849982_1149850001 27 Left 1149849982 17:60028488-60028510 CCCCTTCTGTGGACAGAGGTCAG No data
Right 1149850001 17:60028538-60028560 GGCTGGGTGGAGGCACTGGTGGG No data
1149849981_1149850001 28 Left 1149849981 17:60028487-60028509 CCCCCTTCTGTGGACAGAGGTCA No data
Right 1149850001 17:60028538-60028560 GGCTGGGTGGAGGCACTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149850001 Original CRISPR GGCTGGGTGGAGGCACTGGT GGG Intergenic
No off target data available for this crispr