ID: 1149852196

View in Genome Browser
Species Human (GRCh38)
Location 17:60044551-60044573
Sequence CAGTGTCTGGATGCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149852196 Original CRISPR CAGTGTCTGGATGCTGTTGC AGG (reversed) Intronic
900446470 1:2683574-2683596 GAGTGTGTGGGTGCTGTTCCAGG - Intronic
900446641 1:2684458-2684480 GGGTGTGTGGGTGCTGTTGCAGG - Intronic
900447246 1:2687467-2687489 GAGTGTGTGGGTGCTGTTCCAGG - Intronic
900448738 1:2694893-2694915 GAGTGTGTGGGTGCTGTTCCAGG - Intronic
900448803 1:2695257-2695279 GGGTGTGTGGGTGCTGTTGCAGG - Intronic
900452272 1:2756208-2756230 GGGTGTGTGGGTGCTGTTGCAGG - Intronic
902963336 1:19979934-19979956 CAGAGACTGTCTGCTGTTGCAGG + Intronic
903330228 1:22593372-22593394 CAGCGTCTCGCTGCTGTGGCAGG + Exonic
903772948 1:25775495-25775517 CACTGGCTGGAGGCTGCTGCTGG + Intronic
904118295 1:28178143-28178165 CTGAGACTGGATGCTGATGCAGG - Intronic
904356078 1:29940798-29940820 CAGTGTCTGACTGCTGGTGGGGG + Intergenic
905317791 1:37094630-37094652 CAGCCTGTGGATGCTCTTGCAGG - Intergenic
905521176 1:38601645-38601667 CAGTGTGTGCTTGCTGTTGTAGG - Intergenic
907682700 1:56579058-56579080 GGGTGTGTGGCTGCTGTTGCGGG - Exonic
910212221 1:84804959-84804981 CAGTATATGGATGCTGTTTGAGG - Intergenic
910820350 1:91338559-91338581 CAGTGTGAGGAGGCTGTTGGTGG - Intronic
912487934 1:110043788-110043810 CAGTCTGTGGGTGCTGTAGCGGG - Exonic
912621155 1:111159428-111159450 CAGTCTTTGGATGCTATTGATGG + Exonic
913212163 1:116590664-116590686 CTGGGTCTGGATGCAGTTCCTGG - Intronic
913607320 1:120477962-120477984 CATTGTCTGGATGCTGTGATTGG + Intergenic
914209115 1:145562177-145562199 CATTGTCTGGATGCTGTGATTGG - Intergenic
914268035 1:146054543-146054565 CATTGTCTGGATGCTGTGATTGG - Intergenic
914369062 1:147006316-147006338 CATTGTCTGGATGCTGTGATTGG + Intergenic
914583873 1:149043876-149043898 CATTGTCTGGATGCTGTGATTGG - Intronic
917593547 1:176503148-176503170 CAGTGTCTGGATGGTGGAGTAGG - Intronic
919827587 1:201514442-201514464 CTGTGGCTGGAGGCTGATGCTGG + Intergenic
921449606 1:215289611-215289633 CAGTGTATGGTTGATGTTGACGG + Intergenic
922481790 1:225944505-225944527 CAGTCTCTGGAAGCTGTTCTGGG + Intergenic
922719917 1:227895116-227895138 CCGTGTCTCCATGCTGTTGATGG - Intergenic
923465592 1:234245697-234245719 CAATGTCTGGAAGTTGATGCTGG + Intronic
1064212503 10:13372090-13372112 CTGAGTCAGGATCCTGTTGCTGG + Intergenic
1064934798 10:20667789-20667811 CCGTGTCTGGCTGCTGTGTCTGG - Intergenic
1069720386 10:70545788-70545810 CAGTGGCTGGGGGCTGCTGCAGG + Intronic
1076303439 10:129446294-129446316 CAGAGTCTGGCTGCTGTTCTTGG - Intergenic
1078402886 11:11043997-11044019 CAGAGTCTGGATTATGTTCCAGG + Intergenic
1079772136 11:24475294-24475316 CAGTGTCTTGATGCTGTGTAGGG + Intergenic
1083305820 11:61761482-61761504 CAGTGTCTGGTTCCTGTTCCAGG + Intronic
1084142586 11:67242928-67242950 CAGAGTCTGGATGCTGTTCAGGG + Intronic
1084204917 11:67585564-67585586 CAGTTTCTGGATGGAGGTGCTGG + Intronic
1084231828 11:67759122-67759144 CAGAGTCTGAATGCAGTTGTTGG - Intergenic
1084520766 11:69661274-69661296 AAGTGTCTGGATGGTGTGGCCGG + Intronic
1085579447 11:77637645-77637667 CAGTGTCTGGCTGCTGCCGCAGG + Exonic
1086186419 11:84022300-84022322 CAGAGACTGAATTCTGTTGCTGG - Intronic
1089060617 11:115623235-115623257 CACTGTCAGGAAGCTGTTGGGGG - Intergenic
1089321418 11:117629234-117629256 CACTGTCTGGAGGCTGAAGCGGG + Intronic
1090828684 11:130405735-130405757 CAGCGGCTGGATGATGTTGGTGG + Exonic
1090833401 11:130436168-130436190 CAGTGTCTGTAGGCTGAGGCAGG - Intergenic
1090954060 11:131498948-131498970 CAGTGGCAGGAGGCTGGTGCTGG + Intronic
1091112675 11:132984748-132984770 TAGTGTCTTCAAGCTGTTGCTGG - Intronic
1093652765 12:21662969-21662991 CATTGTCTGGGTGCTGCTTCTGG + Intronic
1096007516 12:48184570-48184592 CAGTGACTGGAGGGTGTGGCGGG - Exonic
1096249406 12:50018951-50018973 CAGTGTCAGGAGGCTGAGGCCGG - Intronic
1101133526 12:101714138-101714160 CAGTCACTGGATGCTATTGATGG + Exonic
1102444843 12:112994112-112994134 CATTGTCTGGATGCAGTGACTGG - Intronic
1102688523 12:114742480-114742502 CAGGGTCTGGAGGGTGATGCAGG + Intergenic
1103732604 12:123037813-123037835 CAGTGTCTGGGTGCTGGCTCAGG - Intronic
1105215409 13:18281286-18281308 CTGGGTCTGGATGCAGTTCCTGG - Intergenic
1105874266 13:24539630-24539652 CACTGCATGGAGGCTGTTGCCGG - Intergenic
1106351815 13:28937792-28937814 CAGTGACTGGCTCCTGTGGCTGG + Intronic
1106499328 13:30312003-30312025 CACTGTCTGGCTGCTGCTGCAGG - Intergenic
1108569761 13:51737762-51737784 CTGTGTTTGGTTGCTGTTGTGGG + Intronic
1109797223 13:67331635-67331657 CAGTGTCTGGAGGTTGTGGTGGG - Intergenic
1111104008 13:83622307-83622329 CCCTGCCTGGATGCTGCTGCGGG + Intergenic
1111926209 13:94465595-94465617 CAATCTCTGGATGCCATTGCAGG + Intronic
1113413309 13:110109030-110109052 CAGGGCCTGGATGCTGCAGCGGG + Intergenic
1113725131 13:112592786-112592808 CCGTGTCTGAAGGCTGTTGCGGG - Intergenic
1117764003 14:59061130-59061152 CAGTCTCTGGAGGGGGTTGCAGG + Intergenic
1118482346 14:66179861-66179883 CTGTGTCTGGATGACATTGCTGG - Intergenic
1118896325 14:69948879-69948901 CAGCATGTGGGTGCTGTTGCTGG + Intronic
1119633264 14:76252682-76252704 CAGTGGCTGGATTTGGTTGCAGG + Intronic
1119684576 14:76621280-76621302 CTTTGTCTGGATGCAGTTGAAGG + Intergenic
1121426328 14:93854737-93854759 CAGGGTGTGGATGCTGATGAGGG + Intergenic
1122646333 14:103196864-103196886 CACTGTCAGGACCCTGTTGCTGG + Intergenic
1123490502 15:20776061-20776083 CAGTGTCGGGCTGCTGCTGCGGG - Intergenic
1123547003 15:21345148-21345170 CAGTGTCGGGCTGCTGCTGCGGG - Intergenic
1125203421 15:37123064-37123086 CTTTCTCTGGATGCTGTTGTGGG + Intergenic
1127710732 15:61595235-61595257 CCGTGTCTGGTGGCTGATGCTGG + Intergenic
1128222866 15:65981400-65981422 CAGGGACTGGGTGCTGTTGAAGG + Intronic
1129458574 15:75688697-75688719 CACTGTGTGGATGCTGCGGCTGG - Exonic
1129692063 15:77719296-77719318 AAGTGTCTTGGTGCTGGTGCTGG - Intronic
1130135140 15:81176215-81176237 CAGGGCCTGGAAGATGTTGCAGG + Intronic
1130150607 15:81308698-81308720 CAGTGCCTTGATGATGTTCCAGG - Exonic
1130273267 15:82463381-82463403 CACTGTGTGGATGCTGCAGCTGG + Intergenic
1130455184 15:84098877-84098899 CTGTCCCTGAATGCTGTTGCAGG + Intergenic
1130465618 15:84190752-84190774 CACTGTGTGGATGCTGCAGCTGG + Intergenic
1130487073 15:84404068-84404090 CACTGTGTGGATGCTGCAGCTGG - Intergenic
1130498647 15:84482784-84482806 CACTGTGTGGATGCTGCAGCTGG - Intergenic
1130587908 15:85195347-85195369 CACTGTGTGGATGCTGCAGCTGG + Intergenic
1130957674 15:88638957-88638979 CAGGGTCGGGATGCCGATGCCGG + Exonic
1130964294 15:88685769-88685791 CTGTGGCTGGATGCTGATGTGGG + Intergenic
1131122856 15:89833896-89833918 CAGCCTCCTGATGCTGTTGCAGG - Exonic
1131132637 15:89909972-89909994 CAGTGTCTCCATGCTGATGTGGG - Intronic
1202955335 15_KI270727v1_random:72364-72386 CAGTGTCGGGCTGCTGCTGCGGG - Intergenic
1132862444 16:2078248-2078270 CAGTGTCTGGGTGCAGGTGTGGG + Intronic
1134062894 16:11209725-11209747 CAGTGGATGGATGCTGCTTCAGG + Intergenic
1135055728 16:19230593-19230615 AAGTACCTGGATGCTGATGCTGG + Intronic
1135949715 16:26902743-26902765 CAGTGCCTGCATGCAGTGGCAGG - Intergenic
1135987630 16:27195645-27195667 CAAAGTCTGGATGCTCCTGCTGG - Intergenic
1140266914 16:73428922-73428944 CAGTGGCTGGAGTCTGTTGGAGG - Intergenic
1142148913 16:88504179-88504201 CAGGGTCTGGATGCCGCTGAGGG - Intronic
1145061935 17:19739095-19739117 CAGTGGCTGGGTCCTGGTGCAGG - Exonic
1146088883 17:29856347-29856369 CAGTATCTTGTTGCTGTAGCTGG - Intronic
1146498527 17:33344343-33344365 ATGTGCCTGGATGCTGCTGCAGG - Intronic
1149163878 17:53726754-53726776 GAGTGTCTGGAGGCTTTTCCAGG + Intergenic
1149852196 17:60044551-60044573 CAGTGTCTGGATGCTGTTGCAGG - Intronic
1151981166 17:77510085-77510107 CAGTTTCAGGATGTTGTTGATGG - Intergenic
1152505642 17:80747971-80747993 CAGTGTTTGGAGGCCGTGGCGGG + Intronic
1152736985 17:82001792-82001814 CAGAGTCTGGAGGCTGCTCCTGG - Intronic
1154448113 18:14450831-14450853 CAGTGACGGGCTGCTGCTGCGGG - Intergenic
1155488031 18:26368386-26368408 CTGTTTCTGGTTGCTGTTACAGG + Intronic
1155636614 18:27963485-27963507 CAGTGTCAGGCTGCTGCAGCTGG + Exonic
1157444515 18:47734779-47734801 CACTGTCTGAATTCTGTTACTGG - Intergenic
1158446420 18:57526215-57526237 CAGTGTTTGGATGTGGTTGATGG + Intergenic
1162088460 19:8262316-8262338 CAGCAGCTGGATGCTGTGGCTGG + Exonic
1164563734 19:29311435-29311457 CTGAGTCTGGATGCTGATGCCGG - Intergenic
1164706744 19:30325487-30325509 CAGTGTCTGGGGGCTGTTTTGGG + Intronic
1164840539 19:31389462-31389484 CGGTGACTTGATGATGTTGCTGG - Intergenic
1165453578 19:35898730-35898752 CAGCGTCGGGCTGCTGCTGCTGG + Exonic
1166678835 19:44755392-44755414 CAGTGACTGGATGCCATTGAAGG + Intronic
1166759769 19:45217503-45217525 CAGTGTCGGGACGCGGTTGGGGG - Intronic
1202709206 1_KI270714v1_random:7703-7725 CATTGTCTGGATGCTGTGATTGG + Intergenic
926805849 2:16710240-16710262 AAGTGTCTGGAGGCTGATACTGG - Intergenic
926822619 2:16869865-16869887 CAGAGTGTGAATGCTCTTGCTGG - Intergenic
927506601 2:23619110-23619132 CAATGGCTGGAGGCTGTAGCTGG - Intronic
927554054 2:24020246-24020268 CAGAGACTGGATGCTCTTGGTGG + Intronic
928090215 2:28369203-28369225 CAGTGTCTGGATTATATTCCTGG + Intergenic
931444310 2:62314052-62314074 CAGTGTGTGGGTGTGGTTGCAGG - Intergenic
931486542 2:62699199-62699221 CACTGGCTGGATGCTGTATCTGG + Intronic
932838765 2:75061620-75061642 CTATGTCTGGATGCAGTTGATGG - Intronic
934298920 2:91765441-91765463 CTGGGTCTGGATGCAGTTCCTGG + Intergenic
936268466 2:111029759-111029781 CAATATCTTGGTGCTGTTGCAGG - Intronic
937920121 2:127122834-127122856 CGCTGTCTGGTTGCTGTTGAGGG - Intergenic
938110821 2:128563689-128563711 CAGTGTCTGTCTGCTGGAGCAGG - Intergenic
940846487 2:158648252-158648274 CAGTGTCTGGAATCCATTGCTGG - Intronic
941837644 2:170043290-170043312 CAGTGTCTGAGAGCTGTAGCTGG + Intronic
945451028 2:209995457-209995479 CAGTGTCTCCATGCTGTAGGAGG - Exonic
946201736 2:218074480-218074502 CAGTGCCTGGAAGCTGGTGGGGG - Intronic
946518867 2:220444365-220444387 CAGTGTCTGGAGACTTTTTCTGG - Intergenic
948553026 2:238787353-238787375 GCGTGTATGAATGCTGTTGCTGG - Intergenic
948787933 2:240362766-240362788 GAGTGTCTGGGTGCTCTTCCTGG + Intergenic
1169917559 20:10698709-10698731 GAGTGGCTGGATGCTGGGGCTGG + Intergenic
1172270125 20:33650320-33650342 GAGTGTCTGGAAGCTGTTGTTGG - Intergenic
1174743288 20:53037766-53037788 CAGTGCCTGGGTGCTGGGGCAGG + Intronic
1175801057 20:61801197-61801219 CAGTGTCTGCAGGCTGCAGCGGG + Intronic
1176221799 20:63972877-63972899 CAGTGTCAGGGTGCTGGTGAGGG + Intronic
1178086639 21:29118959-29118981 CACTGTCTAGATGATGGTGCTGG + Intronic
1180418807 22:12795194-12795216 AAGTGTCTTGATGCTCTTCCAGG - Intergenic
1181327086 22:22058157-22058179 CAGTATCTGGGAGCTGTTGTCGG - Intergenic
1184372130 22:44089378-44089400 CAGTGTCTGGAGGGTGTGGAGGG - Intronic
1184693020 22:46125918-46125940 CAGAGGCTGGAGGCTCTTGCGGG - Intergenic
1185082232 22:48715800-48715822 GTGAGTCTGGATGCTGTTGATGG + Intronic
950454466 3:13084359-13084381 CTGTGTCCGGATGCTCTTTCTGG + Intergenic
950739838 3:15041422-15041444 GAGTGAATGGATGCTGGTGCTGG + Intronic
951847241 3:27097713-27097735 CACTGTGAGGATGCTGTTGGGGG - Intergenic
951865694 3:27304823-27304845 CATTGTCTGGATTCTGGTACAGG - Exonic
952482008 3:33771255-33771277 CAAAGTCTGGATGGGGTTGCAGG + Intergenic
952566959 3:34670105-34670127 CATTTTCTGGATGATGTTGATGG - Intergenic
952886889 3:38017634-38017656 CAGAGCCTGGATCCTGCTGCTGG - Intronic
953114376 3:39977354-39977376 CAGTTTCTGGAAGCTGATTCAGG - Intronic
954441968 3:50526939-50526961 AAGGGCCTGGAGGCTGTTGCTGG - Intergenic
954633753 3:52060432-52060454 CAGTCTCTGGTGCCTGTTGCTGG + Intergenic
955877303 3:63505659-63505681 CAATGTAAGCATGCTGTTGCAGG - Intronic
955926132 3:64006861-64006883 CAGTGAGTTGATGGTGTTGCTGG + Intergenic
957348846 3:78997003-78997025 CAATGTCTGGATATTTTTGCTGG + Intronic
958172291 3:89953335-89953357 CATTAGCTGGATGCTGTGGCTGG - Intergenic
959919744 3:111857612-111857634 CAGTGTATGTATGCTTCTGCAGG + Intronic
959995759 3:112678510-112678532 CAGAGTCAGGATGCAGTTGCAGG + Intergenic
962796535 3:138854361-138854383 CAATATCAGGATGCTGTTGCAGG - Intergenic
963787902 3:149553755-149553777 GAGTGTCTGGGTGCAGCTGCGGG + Intronic
967627983 3:191708438-191708460 CCCTGCCTGGATGCTGCTGCAGG + Intergenic
968722326 4:2216811-2216833 CAGTGTTTGGTCTCTGTTGCTGG + Intronic
968730465 4:2267132-2267154 CAGTGGCTGGGTGCTGGTGGAGG + Intergenic
969196761 4:5569302-5569324 CTGTGTCTTGATGGTGCTGCTGG + Intronic
969911873 4:10454988-10455010 AAGTGTTTGGCTTCTGTTGCAGG - Exonic
972388095 4:38587208-38587230 CTGTGTCTAGATACTGTTGATGG + Intergenic
973167114 4:47091789-47091811 GAGTGCCAGGAGGCTGTTGCAGG - Intronic
973362982 4:49182083-49182105 AAGTGTCTTGATGCTCTTCCAGG + Intergenic
973398117 4:49614773-49614795 AAGTGTCTTGATGCTCTTCCAGG - Intergenic
973771241 4:54208962-54208984 CAGAGTCTTAATGCTATTGCTGG - Intronic
975668850 4:76760006-76760028 CAGTGTCGGGGTCCTGGTGCTGG - Intronic
977537871 4:98277215-98277237 TAGTGTCTGGATTCTGTTAGTGG - Intronic
978202120 4:106034445-106034467 CAGTGAGTTAATGCTGTTGCAGG - Intergenic
978230017 4:106386364-106386386 TAGTCCCTGGATACTGTTGCAGG - Intergenic
979866850 4:125766682-125766704 GACTGTCTGGATTCTGTTGCTGG + Intergenic
980486454 4:133463117-133463139 CAATGTCTGGATGCAATTGTAGG - Intergenic
980900210 4:138897760-138897782 AAGTATCCTGATGCTGTTGCTGG - Intergenic
985793711 5:1946867-1946889 CAGTGTCTGGAGGGTGAGGCTGG - Intergenic
990828873 5:59934093-59934115 CAGTGCCTGGAGGCTGGGGCAGG - Intronic
993587311 5:89746904-89746926 GAGCCTCTGGATGGTGTTGCTGG + Intergenic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
995638107 5:114219127-114219149 CCCTGCCTGGATGCTGCTGCAGG - Intergenic
996325384 5:122267341-122267363 AACTGTCTGGGTGCTGTAGCAGG + Intergenic
996646237 5:125821585-125821607 CAGTGTTTGGATATTGCTGCTGG - Intergenic
1000950074 5:167470808-167470830 CAGTTTCTGGATGCTATTGCAGG - Intronic
1001261026 5:170228834-170228856 CATTGCCTGGATGCTGATGAGGG + Intergenic
1002098019 5:176843500-176843522 CTGTGTCTTGATGCTGGTGGTGG + Intronic
1006502783 6:34468828-34468850 CAGAGTCTGTGTGCTGTTTCCGG + Intronic
1006668717 6:35716415-35716437 CAGTGTCTGTATGCTCTGGGAGG + Intronic
1006796031 6:36732891-36732913 CAGTCTCTGGATGCATTTGAGGG + Exonic
1007361086 6:41356345-41356367 CTGTGTCTGGATTGTGTTGATGG + Intergenic
1007740885 6:44008869-44008891 CCGAGTCTGGATTCTGCTGCTGG - Intergenic
1008617891 6:53243745-53243767 GAATGACTTGATGCTGTTGCTGG + Intergenic
1008731312 6:54485796-54485818 TGGTGTCTGGCTGCTGCTGCAGG + Intergenic
1010073271 6:71769601-71769623 AAGTCTCTGGATGCTGGTGCAGG - Intergenic
1010617502 6:78030495-78030517 CAGTGTCTGGCTGCTCTGGTGGG + Intergenic
1011456202 6:87552471-87552493 GAGTGTCTGAATGCTGGTGAAGG - Intronic
1011665324 6:89627648-89627670 CTGTGTCTGAGTGCTGTTGCAGG - Exonic
1014282353 6:119455824-119455846 CAGTCCCTTGAGGCTGTTGCTGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017413719 6:154197062-154197084 CAGTCTCAGGATGCATTTGCTGG - Intronic
1017647052 6:156548819-156548841 CTGTGTCTAGATGCTACTGCAGG + Intergenic
1018288786 6:162269110-162269132 CAGACTCCGGATGCTGGTGCTGG + Intronic
1018829581 6:167433042-167433064 CAGTGTGTGGATGGTGGTGGTGG + Intergenic
1018829647 6:167433316-167433338 CAGTGTGTGGATGGTGGTGGTGG + Intergenic
1019149807 6:169997735-169997757 CAATGTTGGGATGATGTTGCTGG - Intergenic
1020731983 7:11892255-11892277 CAGTGTCTTGAGGCTGTTCAGGG - Intergenic
1020957909 7:14765647-14765669 TAGTGTCTGGATAGGGTTGCTGG - Intronic
1022712594 7:32865597-32865619 CAGTGTCTGGAGGCTGTGTTGGG + Intergenic
1022910399 7:34895402-34895424 CAGTGTCTGGAGGCTGTGTTGGG - Intergenic
1023037814 7:36148404-36148426 CACTCTCGGGATGCTCTTGCAGG - Intergenic
1023330288 7:39108214-39108236 GAGTGTCTAGATGCAGTTGTTGG + Intronic
1024573965 7:50748687-50748709 CAGTGTTTAGCTGCTGTGGCGGG + Intronic
1026740816 7:72977146-72977168 CAGTTTCTGGACACTGTCGCAGG - Intergenic
1027102917 7:75387928-75387950 CAGTTTCTGGACACTGTCGCAGG + Intergenic
1029184939 7:98731669-98731691 CACAGGCTGGATGCTGCTGCTGG + Intergenic
1034400535 7:150858766-150858788 CAGTGTCTGGAAGCTGTTCTTGG - Exonic
1035043904 7:155951751-155951773 CAATGTTTTGATGATGTTGCAGG - Intergenic
1036849302 8:12190565-12190587 CAGGCTCTTCATGCTGTTGCTGG + Intronic
1036962627 8:13261659-13261681 CAGCGTCTAGATGCATTTGCAGG + Intronic
1037993751 8:23338626-23338648 CAGCCTGTGGCTGCTGTTGCTGG - Intronic
1038653430 8:29426851-29426873 GAGTGTGTGGGTGCTGCTGCAGG + Intergenic
1041933792 8:63314963-63314985 CAGGTTCAGGCTGCTGTTGCTGG + Intergenic
1042467166 8:69141012-69141034 AACTGTCTGGGGGCTGTTGCAGG - Intergenic
1045727104 8:105186482-105186504 CAGTCTGTGGATGCCATTGCTGG - Intronic
1046788248 8:118291561-118291583 CAGGGTCTGGCTGATGTTTCAGG + Intronic
1052205707 9:25837351-25837373 CAGTGTAAAGATGCTGTTCCTGG + Intergenic
1053064942 9:35061522-35061544 CAGTGTCTCTAGGCAGTTGCTGG - Intronic
1055683469 9:78743177-78743199 CATTGTATGGCTGCTGTGGCTGG + Intergenic
1055800415 9:80029862-80029884 CAATGTCTGGAAGCTGTAACTGG + Intergenic
1056169799 9:83973611-83973633 CAGTGTGGGTATGGTGTTGCAGG - Intronic
1057172975 9:92975011-92975033 CAGTGCATGGCTGCTGGTGCAGG + Intronic
1058930584 9:109715045-109715067 CTGACTTTGGATGCTGTTGCAGG - Intronic
1059366418 9:113789901-113789923 CAGTTTAGGGATGCTGTGGCAGG + Intergenic
1061139099 9:128753538-128753560 CAGTGTCTGCAGGCTCTTGGCGG + Exonic
1061675687 9:132214321-132214343 CAGTGCCTGGGAGCTGCTGCGGG - Intronic
1061985000 9:134125574-134125596 AACTGTCTGGATGCTGTGCCAGG + Intergenic
1062343525 9:136104225-136104247 CAGTGTTTGGCTGCACTTGCTGG - Intergenic
1189357193 X:40319052-40319074 TTGTGTCTGTCTGCTGTTGCAGG + Intergenic
1191714919 X:64187581-64187603 CAGGGTCTGGAGGCTGGTGATGG + Exonic
1191965286 X:66751011-66751033 AACGGTCTGGGTGCTGTTGCAGG - Intergenic
1192585318 X:72314377-72314399 CAGTTTCAGCCTGCTGTTGCAGG - Intergenic
1194656126 X:96575945-96575967 CACTGTCTGGATGGTGATTCGGG - Intergenic
1196601417 X:117605435-117605457 CAGTGTCTCAATGCTGTTCAGGG - Intergenic
1199384555 X:147208533-147208555 CAGTGTCTGGACACTGCTCCCGG + Intergenic
1200124963 X:153808883-153808905 CAGTGTCTGGAGGACGTTGTAGG - Intronic
1200181016 X:154150711-154150733 CAGTGTCTGGATGATCTTTGTGG + Exonic
1200186659 X:154187825-154187847 CAGTGTCTGGATGATCTTTGTGG + Intergenic
1200192311 X:154224963-154224985 CAGTGTCTGGATGATCTTTGTGG + Exonic
1200198066 X:154262767-154262789 CAGTGTCTGGATGATCTTTGTGG + Exonic