ID: 1149854524

View in Genome Browser
Species Human (GRCh38)
Location 17:60068838-60068860
Sequence GAATATTCACAGAGTACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149854524 Original CRISPR GAATATTCACAGAGTACTCT GGG (reversed) Intronic
905113973 1:35621258-35621280 CCATATACACAGGGTACTCTGGG - Intronic
907969240 1:59364687-59364709 GGATATTCATAGAGTACTATAGG + Intronic
910416494 1:87004708-87004730 AAATATTCACAGTGCACTCATGG + Intronic
910951715 1:92655112-92655134 GAAGATGCTCAGAGAACTCTAGG + Intronic
914703445 1:150153106-150153128 TGAAATTGACAGAGTACTCTGGG + Intronic
917425150 1:174905553-174905575 GAAAATACACAGAGAAGTCTGGG + Intronic
923456238 1:234167994-234168016 GAATTGTCACTGACTACTCTTGG - Intronic
923958509 1:239050483-239050505 GAATATTCACATACTAAGCTAGG + Intergenic
1063388165 10:5630007-5630029 CAATATTCACGGCGTCCTCTAGG + Intergenic
1063910603 10:10825753-10825775 GAATTTACTCAGAGTCCTCTAGG - Intergenic
1064517131 10:16163176-16163198 TTATATTCACAGATTACTTTGGG + Intergenic
1064569165 10:16674486-16674508 GAATATTCAGAGAGTCCACTAGG + Intronic
1065364951 10:24926274-24926296 TAATATTCACTGAGTACTTAGGG - Intronic
1066024406 10:31339840-31339862 GGATGTTCACAGAGAGCTCTGGG + Intronic
1068507956 10:57926838-57926860 AAATATTCACAGAGTTTGCTAGG + Intergenic
1072557049 10:96526763-96526785 GAAACTTCTCAGAGTATTCTTGG - Intronic
1072619262 10:97068770-97068792 GAATACTGACAGACTACACTGGG - Intronic
1074259494 10:111837799-111837821 AAAGATTGACAGAGTACACTGGG + Intergenic
1074840117 10:117342859-117342881 GAATATTCATAGTGTCTTCTGGG - Intronic
1082932784 11:58626053-58626075 CACTATTACCAGAGTACTCTGGG + Intergenic
1085047279 11:73360868-73360890 GAAGATCCACAGAGACCTCTGGG + Intronic
1085739432 11:79066181-79066203 GGAGATCCACAGAGTGCTCTGGG + Intronic
1088792224 11:113235979-113236001 GAGTGTTCACAGAGTTCCCTGGG + Intronic
1089906583 11:122046386-122046408 GAATATGCACAGTGTACTCTGGG + Intergenic
1092195991 12:6550061-6550083 GCATATTCACACAGTGCTGTGGG - Intronic
1092310298 12:7344651-7344673 GAACACTCACAGAGAACTCTAGG - Intergenic
1092376398 12:7959266-7959288 AAAGATTCACCGAGTTCTCTAGG + Intergenic
1093616939 12:21236638-21236660 AAATTTTCACAGGGTTCTCTGGG + Intronic
1095376059 12:41530599-41530621 GCATATTAATAGAGTTCTCTGGG + Intronic
1098076946 12:66741822-66741844 GAATATTCACAGATTAGTGATGG - Intronic
1102200320 12:111053475-111053497 GCAGATTCATAGAATACTCTTGG - Intronic
1103375257 12:120450722-120450744 GAATATTAATGGTGTACTCTTGG + Intronic
1104873004 12:132014192-132014214 TAAAATTCACAGAATTCTCTGGG - Intronic
1104951585 12:132443118-132443140 AAATATTCACAGTGCACTGTGGG - Intergenic
1106765072 13:32905523-32905545 AAATATTCACAGAGGATTTTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107019604 13:35737987-35738009 TAATATTCATTGAGTGCTCTAGG - Intergenic
1109149391 13:58825310-58825332 TAATATTCACTGAGAATTCTAGG + Intergenic
1109154525 13:58889871-58889893 CAATATTCACAGAGTGCTCTGGG + Intergenic
1111315695 13:86556039-86556061 AAATACTCATAGAGTAGTCTTGG + Intergenic
1113382208 13:109814144-109814166 GATTATTTACAGAATATTCTGGG - Intergenic
1114652938 14:24297939-24297961 AGATATGCACAGAATACTCTAGG - Intronic
1115094334 14:29616764-29616786 AAATATTCACATAGTATTTTTGG - Intronic
1123253224 15:17500749-17500771 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123253613 15:17507576-17507598 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123253806 15:17510990-17511012 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123254003 15:17514407-17514429 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123254196 15:17517822-17517844 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123254392 15:17521238-17521260 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123254590 15:17524653-17524675 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123254784 15:17528069-17528091 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123254978 15:17531486-17531508 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123255172 15:17534903-17534925 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123255369 15:17538320-17538342 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123255559 15:17541735-17541757 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123255756 15:17545150-17545172 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123256144 15:17551983-17552005 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123256340 15:17555399-17555421 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123256538 15:17558818-17558840 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123256729 15:17562234-17562256 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123256923 15:17565649-17565671 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123257118 15:17569063-17569085 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123257312 15:17572478-17572500 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123257506 15:17575892-17575914 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123257699 15:17579307-17579329 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123257893 15:17582724-17582746 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123258283 15:17589554-17589576 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123258474 15:17592968-17592990 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123258671 15:17596383-17596405 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123258863 15:17599797-17599819 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123259056 15:17603204-17603226 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123259251 15:17606619-17606641 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123259440 15:17610033-17610055 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123259634 15:17613448-17613470 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123259825 15:17616863-17616885 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123260020 15:17620278-17620300 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123260216 15:17623694-17623716 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123260408 15:17627109-17627131 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123260600 15:17630524-17630546 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123260796 15:17633939-17633961 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123260990 15:17637355-17637377 GAAGATTCACAGAGTACTTCTGG - Intergenic
1123261381 15:17644185-17644207 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123261578 15:17647600-17647622 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123261963 15:17654422-17654444 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123262159 15:17657837-17657859 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123262351 15:17661252-17661274 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123262548 15:17664668-17664690 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123262741 15:17668081-17668103 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123262935 15:17671496-17671518 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123263129 15:17674911-17674933 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123263327 15:17678326-17678348 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123263519 15:17681741-17681763 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123263716 15:17685157-17685179 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123263911 15:17688572-17688594 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123264097 15:17691816-17691838 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123264289 15:17695230-17695252 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123264486 15:17698644-17698666 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123264685 15:17702058-17702080 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123264877 15:17705476-17705498 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123265066 15:17708882-17708904 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123265265 15:17712296-17712318 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123265460 15:17715712-17715734 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123265654 15:17719127-17719149 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123265847 15:17722541-17722563 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123266039 15:17725957-17725979 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123266233 15:17729371-17729393 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123266426 15:17732785-17732807 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123266624 15:17736194-17736216 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123266817 15:17739609-17739631 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123267014 15:17743026-17743048 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123267207 15:17746434-17746456 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123267405 15:17749848-17749870 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123267614 15:17753459-17753481 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123267810 15:17756874-17756896 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123268003 15:17760289-17760311 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123268197 15:17763703-17763725 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123268685 15:17772241-17772263 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123268880 15:17775655-17775677 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123269075 15:17779070-17779092 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123269270 15:17782487-17782509 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123269465 15:17785903-17785925 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123269658 15:17789318-17789340 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123269854 15:17792733-17792755 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123270047 15:17796149-17796171 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123270241 15:17799564-17799586 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123270434 15:17802980-17803002 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123270628 15:17806394-17806416 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123270826 15:17809810-17809832 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123271020 15:17813225-17813247 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123271215 15:17816640-17816662 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123271411 15:17820058-17820080 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123271604 15:17823474-17823496 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123271798 15:17826890-17826912 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123271991 15:17830306-17830328 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123272185 15:17833721-17833743 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123272381 15:17837133-17837155 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123272573 15:17840550-17840572 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123272770 15:17843965-17843987 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123272958 15:17847384-17847406 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123273156 15:17850799-17850821 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123273348 15:17854214-17854236 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123273545 15:17857629-17857651 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123273739 15:17861044-17861066 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123273932 15:17864457-17864479 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123274125 15:17867872-17867894 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123274322 15:17871287-17871309 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123274514 15:17874701-17874723 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123274709 15:17878116-17878138 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123274905 15:17881530-17881552 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123275099 15:17884945-17884967 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123275293 15:17888359-17888381 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123275487 15:17891775-17891797 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123275680 15:17895190-17895212 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123275875 15:17898604-17898626 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123276069 15:17902019-17902041 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123276260 15:17905434-17905456 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123276459 15:17908848-17908870 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123276656 15:17912264-17912286 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123276850 15:17915682-17915704 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123277043 15:17919099-17919121 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123277237 15:17922514-17922536 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123277433 15:17925930-17925952 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123277632 15:17929345-17929367 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123277821 15:17932760-17932782 GAAGTTTCACAGAGTACTCTGGG - Intergenic
1123278015 15:17936175-17936197 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123278137 15:17938397-17938419 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123278335 15:17941811-17941833 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123278529 15:17945227-17945249 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123278721 15:17948642-17948664 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123278914 15:17952059-17952081 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123279210 15:17957185-17957207 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123279403 15:17960600-17960622 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123279599 15:17964015-17964037 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123279790 15:17967429-17967451 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123279986 15:17970844-17970866 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123280181 15:17974257-17974279 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123280372 15:17977672-17977694 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123280569 15:17981087-17981109 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123280663 15:17982795-17982817 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123280855 15:17986210-17986232 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123281055 15:17989626-17989648 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123281254 15:17993042-17993064 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123281445 15:17996456-17996478 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123281640 15:17999872-17999894 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123281833 15:18003287-18003309 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123282027 15:18006703-18006725 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123282221 15:18010117-18010139 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123282411 15:18013532-18013554 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123282605 15:18016947-18016969 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123282799 15:18020363-18020385 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123282995 15:18023779-18023801 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123283187 15:18027193-18027215 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123283380 15:18030608-18030630 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123283574 15:18034023-18034045 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123283771 15:18037438-18037460 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123283964 15:18040853-18040875 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123284156 15:18044269-18044291 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123284528 15:18050929-18050951 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123284724 15:18054343-18054365 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123284919 15:18057757-18057779 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123285114 15:18061173-18061195 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123285308 15:18064587-18064609 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123285503 15:18068003-18068025 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123285697 15:18071418-18071440 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123285889 15:18074831-18074853 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123286081 15:18078246-18078268 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123286275 15:18081660-18081682 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123286469 15:18085076-18085098 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123286664 15:18088491-18088513 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123286859 15:18091906-18091928 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123287053 15:18095323-18095345 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123287250 15:18098738-18098760 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123287446 15:18102154-18102176 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123287645 15:18105568-18105590 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123287842 15:18108983-18109005 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123288037 15:18112398-18112420 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123288230 15:18115812-18115834 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123288423 15:18119228-18119250 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123288619 15:18122642-18122664 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123288813 15:18126057-18126079 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123289009 15:18129472-18129494 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123289203 15:18132888-18132910 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123289400 15:18136302-18136324 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123289596 15:18139716-18139738 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123289789 15:18143133-18143155 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123289982 15:18146550-18146572 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123290175 15:18149966-18149988 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123290370 15:18153380-18153402 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123290561 15:18156794-18156816 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123290755 15:18160208-18160230 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123290954 15:18163621-18163643 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123291151 15:18167035-18167057 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123291346 15:18170449-18170471 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123291540 15:18173866-18173888 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123291735 15:18177281-18177303 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123291931 15:18180696-18180718 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123292124 15:18184112-18184134 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123292318 15:18187527-18187549 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123292510 15:18190939-18190961 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123292704 15:18194356-18194378 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123292896 15:18197771-18197793 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123293091 15:18201186-18201208 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123293285 15:18204600-18204622 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123293482 15:18208015-18208037 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123293676 15:18211430-18211452 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123293872 15:18214847-18214869 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123294070 15:18218263-18218285 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123294264 15:18221679-18221701 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123294459 15:18225094-18225116 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123294652 15:18228507-18228529 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123294852 15:18231921-18231943 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123295046 15:18235335-18235357 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123295240 15:18238751-18238773 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123295433 15:18242165-18242187 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123295629 15:18245581-18245603 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123295823 15:18248996-18249018 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123296015 15:18252412-18252434 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123296210 15:18255829-18255851 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123296403 15:18259243-18259265 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123296599 15:18262659-18262681 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123296792 15:18266074-18266096 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123296987 15:18269489-18269511 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123297187 15:18272904-18272926 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123297387 15:18276320-18276342 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123297584 15:18279738-18279760 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123297778 15:18283152-18283174 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123297972 15:18286569-18286591 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123298168 15:18289987-18290009 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123298365 15:18293402-18293424 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123298414 15:18294256-18294278 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123298561 15:18296818-18296840 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123298757 15:18300229-18300251 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123298953 15:18303644-18303666 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123299146 15:18307058-18307080 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123299332 15:18310301-18310323 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123299529 15:18313717-18313739 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123299722 15:18317131-18317153 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123300113 15:18323960-18323982 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123300311 15:18327375-18327397 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123300504 15:18330790-18330812 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123300973 15:18339152-18339174 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123301372 15:18346293-18346315 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123301564 15:18349708-18349730 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1123301754 15:18353123-18353145 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1125717143 15:41825806-41825828 GAGCATACACAGGGTACTCTGGG + Exonic
1126820496 15:52498850-52498872 GAGTATTCACATAATAATCTTGG - Intronic
1129263373 15:74381300-74381322 GACTATTCACAGGCAACTCTAGG - Intergenic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1139324835 16:66144532-66144554 GAAAATTCACAAAGTGCTCCTGG - Intergenic
1142580355 17:938134-938156 GCATATTCACAGGGTTCTCCTGG - Intronic
1145523161 17:24296598-24296620 AAGTATTCACAGAAAACTCTTGG + Intergenic
1145547365 17:24648904-24648926 AAACATTCACAGAAAACTCTTGG + Intergenic
1145678622 17:26557635-26557657 GAGCATTCACAGAAAACTCTTGG + Intergenic
1146039579 17:29438219-29438241 GAATATTCAAATAGTAATATTGG - Intronic
1146960535 17:36972093-36972115 AAATATTCCCAGAGTTATCTGGG - Intronic
1147512087 17:41079205-41079227 GAATATTCACAGGGTCATGTAGG - Intergenic
1149804659 17:59604509-59604531 GAATATATACAAAGTACTATAGG + Intronic
1149854524 17:60068838-60068860 GAATATTCACAGAGTACTCTGGG - Intronic
1150880693 17:69023338-69023360 GAAAATTAAAATAGTACTCTAGG - Intronic
1153667541 18:7379657-7379679 GAATACTTACACAGTACTCCTGG + Intergenic
1154266804 18:12885456-12885478 GAACATTCACAGGATATTCTGGG - Intronic
1157212500 18:45755775-45755797 GAATATTCCCAGAGTATTTTGGG + Intergenic
1158386937 18:57004970-57004992 TCATATTTAAAGAGTACTCTTGG + Intronic
1163164887 19:15489067-15489089 GAATATTTACAGAGCACACACGG + Intronic
1163838009 19:19587880-19587902 GATTCTTCACAGAGCACTCTGGG - Intronic
927943732 2:27122210-27122232 GAATAATTCCAGAGTGCTCTGGG + Intergenic
928050896 2:27994190-27994212 GTATATGTACAGAGTACTGTGGG + Intronic
928785485 2:34880799-34880821 GAATCTTAACAGAGTATTGTTGG + Intergenic
933358240 2:81242591-81242613 GCATATTCTCAGAGTCCTTTAGG - Intergenic
933366848 2:81363588-81363610 TAAAATTCAGAGAGTACTTTAGG + Intergenic
933970646 2:87467301-87467323 GAAAAGTCCCAGAGTAATCTGGG + Intergenic
933970647 2:87467308-87467330 GATTACTCCCAGATTACTCTGGG - Intergenic
936135290 2:109887746-109887768 GTATATTAACACAGTATTCTAGG + Intergenic
936209407 2:110483739-110483761 GTATATTAACACAGTATTCTAGG - Intergenic
936323081 2:111482874-111482896 GATTACTCCCAGATTACTCTGGG + Intergenic
936323082 2:111482881-111482903 GAAAAGTCCCAGAGTAATCTGGG - Intergenic
936428592 2:112438980-112439002 GTATATTAACACAGTATTCTAGG - Intergenic
936501910 2:113073325-113073347 GAAAAATCAAAGAGGACTCTGGG + Intronic
937674192 2:124571467-124571489 GACTATTCACAGAGATGTCTAGG + Intronic
939028500 2:137042891-137042913 GAATTCTCACAAAGCACTCTGGG + Intronic
939561743 2:143740467-143740489 AAATTTTCACAGAGAACTCTAGG + Intronic
940472698 2:154119002-154119024 CAACATTTTCAGAGTACTCTAGG - Intronic
941257892 2:163256648-163256670 GAATCTTAAAAGAGTACTTTGGG - Intergenic
941740377 2:169029074-169029096 GAATATTCACAGTGTGATGTGGG - Intronic
942967670 2:181916334-181916356 GAGGATTCACAGAGCACACTCGG - Exonic
944911514 2:204315002-204315024 AAATATTCACAGTGTAAACTAGG + Intergenic
945740319 2:213651951-213651973 GACTAATCAGAGAGTAGTCTGGG - Intronic
946712799 2:222523424-222523446 GCATATTCACAGACTTCTCTGGG - Intronic
946776828 2:223151550-223151572 GAATATTCACAGAAAGTTCTAGG - Intronic
947908588 2:233785677-233785699 GAATATTCTCAGTGGACTCTGGG + Intronic
948367551 2:237467337-237467359 GAAGATTCACAGAGCACCTTGGG - Intergenic
948525577 2:238568869-238568891 TAATTTTCACAAAGTAGTCTAGG + Intergenic
1172934925 20:38613319-38613341 GAATTCTCACATAGCACTCTGGG - Intronic
1176741340 21:10606254-10606276 AAATATTCTTAGAGTAATCTAGG + Intergenic
1181336919 22:22142815-22142837 GAATATTCACAAATTACTTTGGG - Intergenic
1181838825 22:25636480-25636502 AACTATTTACAGTGTACTCTAGG - Intronic
1182207212 22:28640747-28640769 GAATATTCATACATTACTCATGG + Intronic
1183736054 22:39645577-39645599 GGATTTTCCCAGAGTCCTCTGGG + Intronic
1184304195 22:43584343-43584365 GAATACTCACATGGTAATCTTGG + Intronic
952918490 3:38267553-38267575 GATTGCTCACAGACTACTCTAGG + Intronic
953443661 3:42942963-42942985 GAATATTCACAGAGTTGTGCAGG + Intronic
956844712 3:73171944-73171966 GAATGTTCAAGAAGTACTCTTGG - Intergenic
960887164 3:122407711-122407733 GCATATTTCCAGAGTGCTCTTGG + Intronic
964072938 3:152656996-152657018 GAATTTTCACAAAATAGTCTAGG - Intergenic
964844648 3:161032297-161032319 GAGTATTCACAAATTATTCTGGG - Intronic
965450439 3:168831876-168831898 GAGTAATCACAGATTACTGTAGG - Intergenic
965679327 3:171234249-171234271 GAATGTTCACAGAGCATACTTGG + Intronic
966325475 3:178748475-178748497 GAATTTTTACAGATTATTCTGGG - Intronic
967595816 3:191325949-191325971 GAATATTCATACAGTCTTCTTGG + Intronic
967655708 3:192045451-192045473 GAATGTTAACATAGTTCTCTAGG - Intergenic
967739180 3:192986416-192986438 AAATATTTACTGAGCACTCTGGG + Intergenic
968096547 3:195935134-195935156 GAATATTGATATAGTTCTCTAGG - Intergenic
973889288 4:55353320-55353342 GCATTTTTACAGAGTACTATTGG - Intronic
975086740 4:70350443-70350465 GAATATTCACAGATTGGTCTAGG - Intergenic
978317027 4:107449784-107449806 GAATTTCCACAGACTATTCTGGG - Intergenic
978826247 4:113027423-113027445 AAATAATCACAGAACACTCTTGG - Intronic
980699698 4:136408928-136408950 GAATATACACAGAGAACTAAAGG + Intergenic
980710183 4:136556193-136556215 TAATATTTACAGAGGACCCTGGG - Intergenic
981408767 4:144403111-144403133 GAACAGTCAAATAGTACTCTTGG - Intergenic
984480146 4:180290106-180290128 GAATATTCATAAAGTCCTCCTGG - Intergenic
985743828 5:1635329-1635351 GAATATTCAGAGACAACCCTAGG - Intergenic
986749120 5:10770179-10770201 GAATATTTACAGGGTACTGGAGG + Intergenic
989302040 5:39906303-39906325 GTATCTTCACTGAGTACACTAGG - Intergenic
992599076 5:78378665-78378687 GAGTATTGACAGAGTAGCCTTGG + Intronic
992753047 5:79878839-79878861 CAATTTTCACTGGGTACTCTAGG + Intergenic
992760901 5:79950306-79950328 TAATATTTTCAGAGGACTCTGGG - Intergenic
999475773 5:151897676-151897698 GAAGATTCATAGGGTATTCTAGG + Intronic
1001149568 5:169215376-169215398 AAATAATGACAGAGGACTCTGGG - Intronic
1003575603 6:7291722-7291744 GAGGATTCAAAAAGTACTCTAGG + Intronic
1004306874 6:14509154-14509176 GAATATTCACAAACGTCTCTTGG - Intergenic
1005075042 6:21898700-21898722 GAACATTTACAGAGGACTGTGGG + Intergenic
1005442472 6:25885086-25885108 GAATCTTTTCAAAGTACTCTTGG + Intergenic
1005795474 6:29356484-29356506 CATTATTAACAGAGAACTCTAGG - Intronic
1005882871 6:30074100-30074122 GCAGATCCACAGAGTACTATGGG + Intronic
1006688175 6:35855490-35855512 TAATATTCACAGGCAACTCTGGG - Intronic
1008726855 6:54431987-54432009 TAATATTCACAGAGCAATATTGG + Intergenic
1010385163 6:75271344-75271366 TAATATTCAGTGATTACTCTTGG - Intronic
1011210862 6:84955229-84955251 GGATATTCAGAGTGTACTTTAGG + Intergenic
1011948138 6:92933417-92933439 GAATATTACCATAGTATTCTTGG - Intergenic
1013270189 6:108537946-108537968 AAATACTCACAGAGTGCTGTGGG - Intergenic
1015937188 6:138415812-138415834 GAATATTCAGGGAGTTTTCTAGG - Exonic
1016130237 6:140459216-140459238 GAATAATCACAAAGAAGTCTGGG - Intergenic
1016130906 6:140469015-140469037 GAATAATCACAAAGTACTAAAGG - Intergenic
1016539446 6:145147888-145147910 GAATATTCACTTAGTACTGTTGG - Intergenic
1017434026 6:154398779-154398801 CAATATTGAAAGAATACTCTAGG + Exonic
1022766143 7:33414477-33414499 GAATGTTCACAGGGAACTATGGG - Intronic
1025089477 7:56050754-56050776 GAAAATTCATAGAGTACCCAGGG + Intronic
1028552696 7:92088273-92088295 GAATATTCAGAGTCTACTCTTGG + Intronic
1037510298 8:19575617-19575639 GAATATTCACTGGGTATTCTAGG + Intronic
1039690900 8:39863520-39863542 CATTATTCACAGAGTAGGCTGGG + Intergenic
1040135437 8:43847936-43847958 GAATATTGAAAGAGTAATTTGGG + Intergenic
1041932897 8:63306640-63306662 GAAAAGTCACAGAGGACTCCCGG + Intergenic
1043171600 8:76972872-76972894 GCTTATTCACAGAGTACACAGGG - Intergenic
1045074857 8:98553269-98553291 GCATAAGCACAGAGTACTATGGG - Intronic
1046335610 8:112782558-112782580 GAATATTGACATATTTCTCTAGG - Intronic
1046862237 8:119106509-119106531 GGATAGACACAGAGTGCTCTAGG - Exonic
1047865551 8:129020109-129020131 GAATATTCAAAGAGTTATCCAGG - Intergenic
1048294501 8:133204548-133204570 GAATATTCAAAGAGGGATCTAGG + Intronic
1052688831 9:31789103-31789125 CAATATTCAAAGAGTTCTGTGGG + Intergenic
1055376329 9:75651726-75651748 AAATAGTCACACAGTTCTCTGGG + Intergenic
1055426719 9:76204243-76204265 GAAGATTCACAGAGTGCTTCTGG - Intronic
1055954262 9:81759556-81759578 GAATTCTCACAGAGAACTCAAGG - Intergenic
1057880329 9:98788206-98788228 GAATCTTCACGGAGTGCCCTCGG - Intronic
1061072693 9:128321303-128321325 GAATATTCATAAAGTTCTATTGG + Intronic
1203395517 Un_KI270519v1:2138-2160 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1203395706 Un_KI270519v1:5382-5404 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1203395901 Un_KI270519v1:8796-8818 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1203396095 Un_KI270519v1:12208-12230 GAAGTTTCACAGAGTACTTCTGG - Intergenic
1190367729 X:49712751-49712773 CCATAGTCACAGAGTGCTCTTGG + Intergenic
1190737637 X:53266403-53266425 TAATATTTACAGAGCACTATGGG + Intronic
1191886669 X:65895532-65895554 GAATATTAACAAACTACTATTGG + Intergenic
1195053870 X:101124006-101124028 GAATATTAACATAGTCATCTGGG - Intronic
1195988960 X:110663846-110663868 GTATATTCACAGAGTTGTGTGGG + Intergenic
1198400946 X:136267691-136267713 GATTATTCTCTGAGTATTCTAGG - Intergenic
1199509471 X:148605195-148605217 TAATATTCACAGAGTAGTTTTGG - Intronic
1200002681 X:153070154-153070176 GAATATGCACATAGTTCACTAGG - Intergenic
1200005042 X:153079855-153079877 GAATATGCACATAGTTCACTAGG + Intergenic
1202084508 Y:21122057-21122079 AAATATTCCCAGAACACTCTAGG - Intergenic