ID: 1149854727

View in Genome Browser
Species Human (GRCh38)
Location 17:60071252-60071274
Sequence CTGAGTCAAGAAATCAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149854727_1149854730 26 Left 1149854727 17:60071252-60071274 CCAAGATTGATTTCTTGACTCAG 0: 1
1: 0
2: 0
3: 25
4: 245
Right 1149854730 17:60071301-60071323 TAAGAAACACTTCCGACATTGGG 0: 1
1: 0
2: 1
3: 10
4: 95
1149854727_1149854729 25 Left 1149854727 17:60071252-60071274 CCAAGATTGATTTCTTGACTCAG 0: 1
1: 0
2: 0
3: 25
4: 245
Right 1149854729 17:60071300-60071322 TTAAGAAACACTTCCGACATTGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149854727 Original CRISPR CTGAGTCAAGAAATCAATCT TGG (reversed) Intronic
901020490 1:6252792-6252814 CTGAGTCCAGACTTCATTCTTGG + Intronic
902065925 1:13687465-13687487 TTGCATCATGAAATCAATCTAGG + Intergenic
902852158 1:19167854-19167876 CTAAGTTAAAAAATCATTCTAGG + Intronic
902881856 1:19376819-19376841 CTGAGTAAATAAATCGATGTTGG + Intronic
905628649 1:39506107-39506129 TTCTGTCAAGAATTCAATCTAGG - Intronic
907097587 1:51795784-51795806 CTGCTTCAAGAAAGAAATCTGGG + Intronic
908163974 1:61439229-61439251 CAGAGTCAATAAATTGATCTGGG - Intronic
909322419 1:74306288-74306310 CAAAGTCATGGAATCAATCTAGG - Intronic
910154150 1:84193990-84194012 GTAAGTCAATAAATGAATCTTGG - Intronic
911895254 1:103425515-103425537 GTGAGTTATGAAATCAATCTGGG - Intergenic
912077968 1:105901031-105901053 CTGTATCTAGAAACCAATCTTGG - Intergenic
912401260 1:109395772-109395794 CTGACTCAAGGAATAAATCCAGG + Intronic
913238747 1:116808882-116808904 ATGAGACAAGAAATCACTTTGGG + Intergenic
916386617 1:164280150-164280172 CAAAGTCATGAAATCAACCTAGG + Intergenic
916923565 1:169494268-169494290 CAGACTCTAGGAATCAATCTAGG + Intergenic
918062737 1:181076098-181076120 ATGACACAAGAACTCAATCTGGG - Intergenic
918525685 1:185462107-185462129 TTGAGTGAAGAAATGAATCTAGG + Intergenic
924083372 1:240422313-240422335 ATGAGTCAATAAATCAAGTTGGG + Intronic
1063034632 10:2274256-2274278 TTAAATCAATAAATCAATCTGGG - Intergenic
1064242346 10:13641941-13641963 CTGATTTAAAAAATCAATCTTGG + Intronic
1064828557 10:19434737-19434759 CTGAGGCAAAAGATAAATCTGGG + Intronic
1065663269 10:28028848-28028870 CAAAGTCATGGAATCAATCTAGG + Intergenic
1066093056 10:32044834-32044856 CAGAGCCTAGAATTCAATCTAGG + Intronic
1066300671 10:34092875-34092897 CTGAGTGAAAAGATCAATATGGG + Intergenic
1067049465 10:43004192-43004214 CTGAATAAATAAATCAATGTGGG - Intergenic
1067245636 10:44539947-44539969 CAAAGTCATGGAATCAATCTAGG - Intergenic
1068169647 10:53377124-53377146 AAGAATCAAGAAATCCATCTCGG + Intergenic
1072974708 10:100047496-100047518 CTGAGTGAAGAAATCTAGCAAGG - Intronic
1075229654 10:120664585-120664607 CCAAGTCAAGAAATCAAACTTGG - Intergenic
1075285588 10:121182945-121182967 CTGAGTCAGGGTTTCAATCTGGG - Intergenic
1078387112 11:10902265-10902287 CCGAGATATGAAATCAATCTAGG - Intergenic
1079368044 11:19826597-19826619 CTGACTTAAAAAATAAATCTAGG + Intronic
1079472887 11:20797050-20797072 GTGTGTCAAGAAATAAACCTGGG + Intronic
1080350479 11:31379542-31379564 ATGAGTCAACAAACCAATCTTGG - Intronic
1080908131 11:36567408-36567430 CTGAGTCAAGATTTAAATCCAGG + Intronic
1081082100 11:38755046-38755068 CTGTATCTAGAAACCAATCTTGG - Intergenic
1081281348 11:41212282-41212304 CTGTGTTAAGAAATTAATCAAGG + Intronic
1082753052 11:57043219-57043241 CAGAGCCCAGAAATAAATCTAGG + Intergenic
1084206699 11:67598696-67598718 CTTATTTAAGAAATCTATCTCGG - Intergenic
1086486424 11:87307346-87307368 CTGAGGCAGGAAATCAAATTTGG - Intronic
1086910147 11:92462674-92462696 ATGAGCAAAGAAATAAATCTTGG - Intronic
1089728163 11:120501265-120501287 ATGAGTCAAGAAATTAAACTTGG - Intergenic
1092191874 12:6527087-6527109 CTGAGGTATGAAATAAATCTGGG - Intronic
1092480990 12:8858825-8858847 CTGTGTCACCAAATCCATCTGGG + Intronic
1096495668 12:52037820-52037842 CTGAGTCAAGAAACCAAGGCTGG + Intronic
1099753258 12:86805627-86805649 CAGAGACATGAAATCAACCTAGG - Intronic
1100912494 12:99381424-99381446 ATGAGACAAGAATTCCATCTAGG + Intronic
1101571102 12:105954495-105954517 CTGAGTCAAGACGTCAAGGTTGG + Intergenic
1102451691 12:113046686-113046708 TAGAGTCAAGAAATCCAACTTGG + Intergenic
1103047647 12:117750917-117750939 CAAAGACATGAAATCAATCTAGG - Intronic
1103249617 12:119488389-119488411 CTGAGTCAAGACTTCCAGCTGGG + Intronic
1106765314 13:32907604-32907626 CTGAGTCAGGAAATTATTTTGGG - Intergenic
1106880193 13:34120829-34120851 ATGATTCCAGGAATCAATCTAGG + Intergenic
1107289220 13:38833493-38833515 CTTAGTCAAGAGAACAAACTTGG - Intronic
1107834064 13:44399283-44399305 CTGGGGAGAGAAATCAATCTTGG - Intergenic
1108495841 13:51024688-51024710 CTGGGTGAAGAAATCCATCAAGG + Intergenic
1109047529 13:57432844-57432866 CAAAGACAAAAAATCAATCTAGG + Intergenic
1109608764 13:64735202-64735224 CAAAGACAAGGAATCAATCTAGG - Intergenic
1110384848 13:74897657-74897679 CTGTCTCAAGAAATAATTCTGGG - Intergenic
1110815106 13:79852582-79852604 TTGAGTAAAGAAATAAATCAGGG + Intergenic
1112222864 13:97508873-97508895 CTAAGACAAGGAATCAACCTAGG - Intergenic
1116270811 14:42763373-42763395 TTGAGTCAGGAAATCAATTTGGG + Intergenic
1117935119 14:60895175-60895197 CTGATACAAGAACTCAATTTAGG - Intronic
1117962154 14:61173938-61173960 CTGAGTCAAGAAAATAGTTTAGG - Intergenic
1118112763 14:62740753-62740775 CAGTGTCAAGAAATCACTTTTGG + Intronic
1119230116 14:72972919-72972941 CGAAGTCAAGAGATCAGTCTTGG - Intronic
1120395985 14:83967619-83967641 CAAAGTCACGGAATCAATCTAGG + Intergenic
1124622872 15:31286989-31287011 TTGAGTCTAGAGATCAATCTGGG + Intergenic
1125207486 15:37170766-37170788 GTCAGTCAAGAAAACAATCCTGG + Intergenic
1125239251 15:37554218-37554240 CTGAATTAAGAAAACAATCAAGG + Intergenic
1127219322 15:56861233-56861255 CCAAGACATGAAATCAATCTAGG + Intronic
1127313148 15:57770181-57770203 CTGAGTAAAGAAGGCATTCTGGG - Intronic
1130559721 15:84948454-84948476 CTGAGTCAGGCATTCAATCCTGG - Intergenic
1131711782 15:95063159-95063181 CTGAGTCTAGTCAGCAATCTTGG + Intergenic
1132311920 15:100863397-100863419 CTTAGCCAAGATATCACTCTTGG + Intergenic
1135813029 16:25607021-25607043 CAAAGACATGAAATCAATCTAGG - Intergenic
1138144113 16:54593821-54593843 CTGACCCAAGAAATCATTTTCGG + Intergenic
1138256845 16:55572359-55572381 CAGTGTCCAGAAATCATTCTTGG + Intronic
1138401426 16:56747983-56748005 CTGATGGCAGAAATCAATCTTGG + Intronic
1138844365 16:60547451-60547473 CAGAGCCAGGAAATTAATCTAGG - Intergenic
1138972634 16:62164152-62164174 CAAAGTCATGAAATCAAACTAGG - Intergenic
1140354006 16:74288676-74288698 CTGAGTCCAGAAAGCCATGTTGG - Intergenic
1140582338 16:76246421-76246443 TTGAGTCTATAAATCAATTTAGG - Intergenic
1143341153 17:6212206-6212228 CTGAGTCAAGAAAGAAAGCTTGG - Intergenic
1143692434 17:8580556-8580578 CTGAGTCAATGAATGAATGTAGG + Intronic
1148455703 17:47810236-47810258 CTGAGTCCTGAGATCAATTTAGG + Intronic
1149854727 17:60071252-60071274 CTGAGTCAAGAAATCAATCTTGG - Intronic
1150511364 17:65756107-65756129 CAGAGTCAAGAAATCAGGATAGG + Intronic
1150727445 17:67662945-67662967 CAAAGACATGAAATCAATCTAGG - Intronic
1155106329 18:22669759-22669781 CTGAGTCACTAAAACAATTTAGG + Intergenic
1155427911 18:25725251-25725273 CTGAAACAGGATATCAATCTGGG + Intergenic
1157209435 18:45728939-45728961 CCCAGTAAAGAAATCAATATGGG - Intronic
1158185948 18:54771529-54771551 CTGAGGCAAGAAATCAAAGTTGG + Intronic
1159198607 18:65151756-65151778 CTGTGTCTAGCAACCAATCTTGG - Intergenic
1159895051 18:73988498-73988520 CTGAGTGAAGAAAGCAATAAAGG + Intergenic
1163036520 19:14572237-14572259 CTGAGCCTGGAAATCCATCTGGG + Intergenic
1165178651 19:33948851-33948873 CTGAGCCAAAAAGTCCATCTGGG + Intergenic
1166421672 19:42640796-42640818 AAGAGTCATTAAATCAATCTAGG - Intronic
1166577951 19:43862034-43862056 CTAAGACATGAAATCAACCTGGG + Intergenic
1168388018 19:55982200-55982222 CAGAATTAAGAAATCAACCTGGG - Intronic
927399136 2:22690441-22690463 GGGAGTCAAGAAATCAATTGAGG + Intergenic
927835098 2:26389987-26390009 CTGAATCAAAAAATTAATTTTGG - Exonic
929874186 2:45782883-45782905 CTGAATCCAGAAAGCAAACTGGG + Intronic
930790720 2:55325132-55325154 TTGAATCAAGAGATCAATCTGGG + Intronic
932880874 2:75500801-75500823 GTGAGTCAAAAAATGACTCTGGG - Intronic
933273608 2:80260157-80260179 CTGAGTCAAGATTTCAATACTGG - Intronic
935962438 2:108439811-108439833 CTGTATCTAGAAACCAATCTTGG - Intergenic
936976761 2:118228582-118228604 CTGAGTCAGGATTTCAATCCTGG + Intergenic
938024130 2:127930723-127930745 CTGACTCAAGAAATGAATGCAGG + Intergenic
938593164 2:132759561-132759583 GTGAGTCATGAAATCGATTTGGG - Intronic
938902960 2:135813947-135813969 CAGAGTCAAGATTTAAATCTAGG - Intronic
939359588 2:141151741-141151763 CTGAGTCTAGACATCAAGCTTGG - Intronic
939655036 2:144813886-144813908 CTGAGTTAAGAAATCATATTGGG + Intergenic
939762911 2:146206638-146206660 GTGTGTCAAGATTTCAATCTGGG + Intergenic
940053236 2:149486163-149486185 TGGAGTCATGAAATCAATATTGG - Intergenic
942483551 2:176415727-176415749 CAGAGACAAGAAGTCAAACTGGG - Intergenic
942565235 2:177259630-177259652 CTGGTACAAGAAATCCATCTAGG + Intronic
942832013 2:180248256-180248278 CTGATTCAAGAATGAAATCTTGG + Intergenic
943369205 2:186996220-186996242 CTAAGTCAAGGAATTAACCTAGG + Intergenic
943675186 2:190710064-190710086 CTGAGTGAAGACAAAAATCTTGG - Intergenic
943900119 2:193423140-193423162 CTGATTTAAGAAAACATTCTAGG + Intergenic
946115691 2:217460100-217460122 CTGAGTCAAGATGTAAATGTAGG + Intronic
946987894 2:225293659-225293681 ATGAGTCAAGAAAAAAATCTGGG + Intergenic
947576373 2:231278223-231278245 GTGAGTCATGTAACCAATCTGGG - Intronic
948766238 2:240222312-240222334 TCTAGTCAAGGAATCAATCTTGG + Intergenic
1168837058 20:884551-884573 CTGGGTCAAGAAAACAATTCTGG - Intronic
1170673137 20:18453510-18453532 GTGGGTCAAGAAATCTAACTTGG + Intronic
1171255667 20:23687538-23687560 CTAAGTGAAGTAATAAATCTAGG - Intronic
1172670051 20:36628856-36628878 GTGGGTCAAGAAATCAGTTTAGG - Intronic
1172717242 20:36973962-36973984 CTGTATCTAGAAACCAATCTTGG - Intergenic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1177517326 21:22172054-22172076 CACAATCAAGAAATCAATGTTGG + Intergenic
1178974933 21:37213386-37213408 CTGAGATATGAAATCAACCTGGG - Intergenic
1178996877 21:37410523-37410545 CTAAGTAAATAAATAAATCTTGG - Intronic
1179001396 21:37462817-37462839 CTGAAAAAAGAAATCACTCTTGG - Intronic
1181563438 22:23718941-23718963 CTGAGTCAAGAGGTCAAGCTGGG - Intergenic
1183812010 22:40265627-40265649 CTGGGTCAAAAAATGACTCTTGG + Exonic
1184780289 22:46645451-46645473 CTGAGTCAAGAATTAGAACTGGG - Intronic
949279266 3:2327287-2327309 ATTAGTCAAGAAATCAATCCTGG + Intronic
950339247 3:12228014-12228036 CTGAGTCAAGAAAATTCTCTTGG - Intergenic
952043964 3:29294902-29294924 CTGAGTTAAAAAACCCATCTGGG - Intronic
953802735 3:46039134-46039156 CTGTATCTAGAAACCAATCTTGG + Intergenic
955723799 3:61910902-61910924 CAGAGTCAAGAATTGAATCATGG - Intronic
955739382 3:62073925-62073947 CTCAGTCCAGAACTCAATCTAGG - Intronic
957524708 3:81365084-81365106 CTGAGTGAAAAAGCCAATCTCGG + Intergenic
958254142 3:91305241-91305263 CAAAGTCATGGAATCAATCTAGG - Intergenic
958486830 3:94723056-94723078 CTGAATCCAGAAATCTATCTTGG - Intergenic
958914178 3:100029826-100029848 CTGAGTCATGATAACATTCTAGG + Intronic
959237851 3:103747554-103747576 TTGACTCAACAAATCAATCCAGG + Intergenic
962450427 3:135510948-135510970 CTGAGTCGATAAATCTATTTGGG - Intergenic
962822209 3:139060839-139060861 GTGAGTCCAAAAATAAATCTTGG - Intronic
964022730 3:152033746-152033768 CTAAGTCATGGAATCAACCTAGG + Intergenic
964411758 3:156405167-156405189 CTGAGCCATGCAATCAGTCTTGG + Intronic
964886921 3:161494076-161494098 CAAAGACATGAAATCAATCTAGG - Intergenic
965424596 3:168506376-168506398 CTGAGAGGTGAAATCAATCTGGG - Intergenic
966331518 3:178819679-178819701 ATGAGTCAAGAAACAAATTTTGG + Intronic
967472552 3:189879252-189879274 GTGATTCAAGAAGCCAATCTGGG + Intronic
968197927 3:196724888-196724910 CAGAGTCAAGACATTAATCCAGG - Intronic
968714997 4:2150403-2150425 TTGAATCGAGAACTCAATCTGGG - Intronic
970352134 4:15212680-15212702 GTGAGACATGAAATCAATTTAGG + Intergenic
970506971 4:16741639-16741661 CTAAGTAAAGAAATACATCTTGG - Intronic
971843584 4:31889083-31889105 CTGAAACAAGAAATCGATTTAGG + Intergenic
973309212 4:48689490-48689512 CCCAGTTAAGACATCAATCTGGG + Intronic
973766695 4:54169406-54169428 CTGAGTCATTAAAGCATTCTAGG - Intronic
976554471 4:86433850-86433872 ATGAGCCATGAAATCAATTTAGG + Intronic
977032086 4:91896233-91896255 CTGGGTCAAGAAATGATTTTTGG - Intergenic
978437913 4:108705671-108705693 TTGAGTCTATAAATCAATTTTGG - Intergenic
979182270 4:117745287-117745309 CAAAGACAAGAAATCAACCTAGG - Intergenic
980258526 4:130415483-130415505 CAAAGTCATGAAATCAACCTAGG + Intergenic
982092839 4:151895637-151895659 CTGATTCAAGACATCAGCCTGGG + Intergenic
982190183 4:152845923-152845945 CAGAGTCATACAATCAATCTAGG + Intronic
982357567 4:154487834-154487856 CAGAGTAAATAAATCAGTCTTGG + Intronic
983220043 4:165035295-165035317 CTGAGGCAAGAGATCAATTGAGG - Intronic
984323530 4:178224157-178224179 CTGGGTCAAGATCTCAAACTGGG + Intergenic
985207346 4:187553314-187553336 CTGCATCGAGAAACCAATCTTGG - Intergenic
986592613 5:9386938-9386960 CTGAGACAAGAAATGAGTCAAGG + Intronic
987439442 5:17938475-17938497 CAAAGACATGAAATCAATCTTGG + Intergenic
988363440 5:30265584-30265606 TGGAGGCAAGAAATCAATATTGG + Intergenic
989281141 5:39644866-39644888 CTGAGTGAAAAAATCTATCAAGG - Intergenic
989829614 5:45899103-45899125 CTGAATCTATAAATCAATCAGGG + Intergenic
991680866 5:69138077-69138099 CAAAGTCATGGAATCAATCTAGG - Intergenic
993683016 5:90903107-90903129 CTAAGTAAATAAATCATTCTTGG - Intronic
995590239 5:113692510-113692532 CTGGGTCTAGAAATAATTCTAGG - Intergenic
997233725 5:132260674-132260696 CTGAATCAAGATTTCAATCCAGG - Intronic
998814987 5:146004430-146004452 TTGAGTCAATAAGTCCATCTGGG + Intronic
1000041571 5:157488514-157488536 CTGAGACAAGAAATCACTCAGGG + Intronic
1000045632 5:157519801-157519823 CTCAGTGCAGAAATCAACCTGGG - Intronic
1000460171 5:161506310-161506332 CTGAGTTTATAGATCAATCTGGG - Intronic
1001308529 5:170594017-170594039 TTGAGTCAAGATATAATTCTTGG + Intronic
1001787145 5:174423624-174423646 CCGAGACAAGAAATCAGTGTTGG - Intergenic
1005013242 6:21355708-21355730 CTGAGCTAAGGAATCAATCTGGG - Intergenic
1006409483 6:33864033-33864055 ATTAGTCAAGAAAACAATCCAGG - Intergenic
1006655375 6:35587843-35587865 CAGAGTCAAGAGAACAATCTGGG + Intronic
1007159934 6:39781668-39781690 CTGAGTCTATAGATCAATCTGGG + Intergenic
1007641386 6:43342700-43342722 ATGAGTGAAGAAATCAAACATGG + Exonic
1009189683 6:60615242-60615264 CAAAGTCACGGAATCAATCTAGG + Intergenic
1010830484 6:80522328-80522350 CTGTCTGAAGAAATCAAGCTTGG + Intergenic
1012832178 6:104218026-104218048 CAAAGTCATGAAATCAAACTAGG - Intergenic
1013424785 6:110001301-110001323 ATGAGTCAAGAGATCAAAGTGGG - Intergenic
1017167323 6:151421452-151421474 GTGAGTTAAGACATTAATCTGGG - Intronic
1017479389 6:154835552-154835574 CTGTATCTAGAAACCAATCTTGG + Intronic
1018625516 6:165774724-165774746 TTGAGTAAAGAAAATAATCTTGG - Intronic
1020601561 7:10280733-10280755 CTGAGTCTACAAATCTATATTGG - Intergenic
1020788882 7:12601309-12601331 TTGAGTGAAGAAATGACTCTGGG + Intronic
1020820383 7:12959720-12959742 CTTATTCAATAAATCATTCTGGG - Intergenic
1021926846 7:25542131-25542153 CTGAGTAAAGAACACATTCTTGG - Intergenic
1022287251 7:28965322-28965344 CTCAGTAATGAAAACAATCTTGG + Intergenic
1024749713 7:52451273-52451295 CTCAGGCAAGAAATCACTCATGG - Intergenic
1025066018 7:55856733-55856755 CTGAGACATGGAATCAACCTAGG - Intronic
1025929797 7:65984370-65984392 CTGAGTCAAGAGGTCAAGCTGGG - Intergenic
1026207850 7:68273727-68273749 CTGAGTCAATAGGTCAATATAGG + Intergenic
1026346358 7:69477616-69477638 CTGAGTCAGGACTTGAATCTGGG + Intergenic
1026349133 7:69500410-69500432 CACATTCAAGAAATCTATCTAGG + Intergenic
1026436580 7:70404211-70404233 ATGAGTTAAGAGATCTATCTGGG + Intronic
1026610679 7:71857344-71857366 CAGAGTTAAGAATTCAATATAGG + Intronic
1027736466 7:81938631-81938653 CTGATTCAAAAAAACAATTTAGG + Intergenic
1030098148 7:105919912-105919934 CTGTGACATGACATCAATCTTGG + Intronic
1030406672 7:109123623-109123645 ATGAGCAAAGAAATCAGTCTGGG - Intergenic
1031031723 7:116742830-116742852 CTGAGTCCATAAATCCCTCTAGG + Intronic
1031673650 7:124582664-124582686 CTGAGGCTAGAAATTAATCCTGG - Intergenic
1034106729 7:148496773-148496795 CTGAGTCAGGGAAGAAATCTGGG - Intergenic
1034897763 7:154888388-154888410 CTCAGTCAAGAGCTCACTCTCGG - Intronic
1035288421 7:157821291-157821313 CTGAGTAAAGACATAACTCTAGG + Intronic
1038048938 8:23791040-23791062 CTAAGGCAGGAAATCATTCTGGG - Intergenic
1039090762 8:33827382-33827404 CAAAGTCATGAAATCAACCTAGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039679186 8:39710569-39710591 CTAAGGTAAGAAATCAGTCTAGG - Intronic
1039822874 8:41149230-41149252 ATGAGTCAGGAATTCAATCATGG + Intergenic
1040650222 8:49439968-49439990 CTGTATCTAGAAATCAATCTTGG - Intergenic
1040776550 8:51050331-51050353 CGAAGGCAAGAAATCAACCTGGG - Intergenic
1041780623 8:61574995-61575017 TTGAGGCAGGAAAACAATCTTGG - Intronic
1041856760 8:62465556-62465578 CTGAATGAAGAAATTAATATAGG - Intronic
1042185638 8:66134101-66134123 ATGAGCCATGAAATCAATTTAGG - Intronic
1042780671 8:72487549-72487571 CAAAGTCAAGGAATCAATCTAGG + Intergenic
1043660014 8:82727508-82727530 CAAAGACAAGGAATCAATCTAGG + Intergenic
1044192303 8:89333493-89333515 ATGGGTCAAGAAATCAACATGGG + Intergenic
1046578063 8:116056857-116056879 CTGAGCCAAGATATGAATCCAGG + Intergenic
1047089605 8:121559050-121559072 CTGAGTCAAAAACTCAATTGTGG + Intergenic
1047331374 8:123891250-123891272 CTGTATCTAGAAACCAATCTTGG + Intronic
1047677560 8:127219899-127219921 CTGATTCACCAAATTAATCTTGG - Intergenic
1051742209 9:20262986-20263008 CTGAGAGAAGAAATAAATCAGGG + Intergenic
1053388327 9:37713744-37713766 ATTATTCAAGAAATCAAACTTGG + Intronic
1053645176 9:40115989-40116011 CTGAGGCCAGATGTCAATCTGGG - Intergenic
1054703401 9:68436888-68436910 ATGAGTCAGGAAATACATCTGGG - Intronic
1056184866 9:84124659-84124681 CTGAGCCAAAACATAAATCTTGG + Intergenic
1057781333 9:98053121-98053143 CTGAGCCAAGAATTGAACCTGGG + Intergenic
1059568778 9:115411683-115411705 TTGAGTCATGAAATCCATCATGG - Intergenic
1059649646 9:116303752-116303774 CTAAATCAAGAAAGCAATATTGG - Intronic
1061441210 9:130605091-130605113 CAGTGTCATGAAATCAATATAGG - Intronic
1185915145 X:4026790-4026812 CAGAGACAAGGAATCAACCTAGG + Intergenic
1185969633 X:4648157-4648179 CCGAGTCAAAAAGTCAAACTGGG - Intergenic
1186111319 X:6259400-6259422 CAAAGACATGAAATCAATCTAGG - Intergenic
1186148637 X:6650628-6650650 CAAAGTCATGGAATCAATCTAGG + Intergenic
1186572191 X:10726966-10726988 CTGAATCAAGAAAGTAGTCTTGG - Intronic
1186818856 X:13265663-13265685 CATAGGCAAGAAATAAATCTTGG + Intergenic
1188858549 X:35227963-35227985 CTGTATCTAGAAACCAATCTTGG + Intergenic
1189137859 X:38568061-38568083 CTGAGTGAAGAAACAGATCTTGG - Intronic
1194176319 X:90652749-90652771 CTGTATCTAGAAACCAATCTTGG + Intergenic
1194431065 X:93806201-93806223 CTGAGTAAAAAAATCAAGATAGG - Intergenic
1194675324 X:96787371-96787393 CTGAGTAAAGAAAAAAATCATGG + Intronic
1194805645 X:98324260-98324282 CAAAGACATGAAATCAATCTAGG + Intergenic
1195071871 X:101289303-101289325 CTAAGTTATGAAATCAATCTAGG - Intronic
1195080656 X:101366941-101366963 CTGAGTTAGGAAACCAAGCTCGG + Intronic
1196193624 X:112818571-112818593 TTCAGTGAAGAACTCAATCTGGG + Intronic
1199835302 X:151584169-151584191 CAGATTGAAGAAATCAATCAGGG + Intronic
1199865003 X:151838224-151838246 CTGAGTTTATAAATCAATTTGGG - Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1200359342 X:155586278-155586300 TTGAGTCAAGAAATAAATTAGGG + Intronic
1200522940 Y:4233669-4233691 CTGTATCTAGAAACCAATCTTGG + Intergenic
1200564434 Y:4747525-4747547 CTAAGACAAGGAATCAACCTAGG + Intergenic
1201453163 Y:14138289-14138311 CTGACTAAATAATTCAATCTAGG + Intergenic