ID: 1149854848

View in Genome Browser
Species Human (GRCh38)
Location 17:60073087-60073109
Sequence CACAGGGAACTACCTACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149854848 Original CRISPR CACAGGGAACTACCTACAAA GGG Intronic
900348136 1:2221075-2221097 CACAGGGAACCGTCTCCAAAAGG - Intergenic
905990070 1:42329135-42329157 CAAAGGTACCTAACTACAAAAGG + Intronic
907359422 1:53902771-53902793 CACAGGGACCTACACTCAAAAGG + Intronic
908337082 1:63137508-63137530 CACAGGGATCTATCTATACAAGG - Intergenic
912649824 1:111427758-111427780 CACAGGGAAGCTCCTATAAAGGG - Exonic
913571704 1:120126646-120126668 CACAGGTGAATACTTACAAATGG + Intergenic
913946434 1:125174170-125174192 CAAATGGAACCACCTCCAAATGG - Intergenic
914292624 1:146288268-146288290 CACAGGTGAATACTTACAAATGG + Intergenic
914553668 1:148739051-148739073 CACAGGTGAATACTTACAAATGG + Intergenic
915730056 1:158046960-158046982 CACAGGCATCTGCATACAAAGGG - Intronic
915940224 1:160114241-160114263 CAGAGGGAACTCCCTGCAGAGGG - Intergenic
919443193 1:197665965-197665987 CACAGTAGAATACCTACAAATGG + Intronic
922125825 1:222722240-222722262 TACAGGTAATTAACTACAAATGG - Intronic
922400954 1:225254979-225255001 CACAGGGAACTAACTGAAAGGGG + Intronic
923507366 1:234616469-234616491 CACAGAGAGCTCCCTACACAAGG + Intergenic
924221527 1:241880797-241880819 CACAGTGAACTACCGACAGAAGG - Intronic
1062799847 10:371011-371033 CACACGGAACTACCTAGATAGGG + Intronic
1066024055 10:31335117-31335139 CATAGGTAACCACCTACAGATGG - Intronic
1069052153 10:63806730-63806752 CAAAGGAAACTATCAACAAAGGG - Intergenic
1075891230 10:125953144-125953166 CACTGGGAACTGGCTAGAAATGG - Intronic
1081291220 11:41328041-41328063 CACAGGGAACTACCTGTGAGAGG - Intronic
1083106676 11:60365036-60365058 TACAGGGAAATAACTACAAAAGG + Intronic
1083969368 11:66064128-66064150 CACATTCAACTACCTAAAAATGG - Intronic
1084618987 11:70255548-70255570 CACAGGGGACTAACTACAGATGG - Intergenic
1085260880 11:75204015-75204037 CACAGGGGGCTTCCTAGAAAAGG + Intronic
1086571378 11:88288495-88288517 CAAAGGTAACAACCGACAAAGGG - Intergenic
1093499660 12:19797738-19797760 CAAAGGGAGCTACATACAGATGG - Intergenic
1094690187 12:32761160-32761182 CACACAGAACTTGCTACAAATGG - Intergenic
1096549131 12:52360716-52360738 CAGAGGGAAAGACCTACAGAGGG - Exonic
1098036151 12:66303739-66303761 CACAGGAAACTACTTATACAAGG - Intronic
1101424320 12:104575582-104575604 CCCAGGAAACTTCCTTCAAACGG - Intronic
1102617690 12:114168919-114168941 CATAGGAGACTACCTATAAAAGG + Intergenic
1104645006 12:130490993-130491015 CACAGATCACCACCTACAAATGG + Intronic
1106417224 13:29556089-29556111 CACAGGGATGTACCTAGAAAGGG - Intronic
1108497327 13:51038255-51038277 CACAAGGTACTAATTACAAAGGG + Intergenic
1116513572 14:45778674-45778696 CACATGGAACAACCTCCAGATGG - Intergenic
1116978038 14:51137753-51137775 CACAGGGAACAACCCACACCAGG + Intergenic
1120722566 14:87904658-87904680 CCCAGGGAACTTTCTAAAAATGG + Intronic
1125270121 15:37929551-37929573 CACAGGGAACTACATTCAAAAGG + Intronic
1129005915 15:72373392-72373414 CACAGGAAACTACATTCCAAAGG + Intronic
1131798658 15:96046842-96046864 CACAAGGAAATACCTCCAAAAGG + Intergenic
1141941753 16:87280920-87280942 CACAGGATACTAATTACAAAGGG - Intronic
1145037358 17:19550815-19550837 CACAGGGGACAACCTGCAGAGGG - Intronic
1145230099 17:21167535-21167557 CAGAGGGCACCACCTACACATGG - Intronic
1147399545 17:40171937-40171959 CAAAGGGAACAGCCTACAAAAGG - Exonic
1148564388 17:48624844-48624866 GACGGGAAACTACCCACAAAGGG + Intronic
1149629560 17:58111165-58111187 CACAGGTAAATAAATACAAATGG + Intergenic
1149854848 17:60073087-60073109 CACAGGGAACTACCTACAAAGGG + Intronic
1150148309 17:62789522-62789544 CACAAACAACTACCTACAATAGG - Intronic
1153142729 18:1993417-1993439 CACAAAGAACTCCCTTCAAATGG + Intergenic
1154076303 18:11205351-11205373 TACAGGGGACTATCTATAAAAGG + Intergenic
1154989048 18:21582669-21582691 TACAGGGAAACAACTACAAATGG + Intronic
1160109365 18:76011377-76011399 CACAGGGCACTTCCACCAAATGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1162519105 19:11168650-11168672 CACTGGGGACTACCTAGAACTGG + Intronic
926746378 2:16161796-16161818 CACGGGGAACTACAGACAGATGG - Intergenic
927345879 2:22038940-22038962 CACAGAGAAAAATCTACAAATGG + Intergenic
931345572 2:61442231-61442253 CACAGGCAACAAACAACAAATGG + Intronic
931483111 2:62662955-62662977 CACAGGGAAAAACTTAGAAATGG - Intergenic
932698659 2:73978062-73978084 CACTGTCAAGTACCTACAAATGG + Intergenic
932943403 2:76196824-76196846 CACAGAGCACTGCATACAAATGG - Intergenic
933700445 2:85251661-85251683 CACAGGGAACTATCAAAAAGCGG - Intronic
936975796 2:118221081-118221103 TAAAGGGATCTACCTACACAAGG - Intergenic
938752022 2:134341539-134341561 CACACTGAACCACATACAAAAGG - Intronic
940051891 2:149473709-149473731 CACAGGGAACTTCCTTCCAGAGG + Exonic
944476342 2:200110547-200110569 CACAGTCATCTACCCACAAATGG + Intergenic
946505279 2:220293755-220293777 CACAGGAAGCTACATAAAAAAGG - Intergenic
1169217644 20:3802720-3802742 CCCAGGGAACAACCTTCCAAGGG - Intronic
1171004041 20:21445575-21445597 CACAGAGAACTATCTACAAAAGG - Intergenic
1171009787 20:21502886-21502908 CACAGGGAACTACGTAGTGAGGG - Intergenic
1172301182 20:33851558-33851580 CACAGTGAAATACCTTCAACAGG - Intronic
1173111098 20:40191330-40191352 GACAGGGAACTACCTGAAGAGGG + Intergenic
1179073182 21:38092269-38092291 CACTGTGAACTACCAAGAAAAGG + Intronic
1179131933 21:38645258-38645280 CAAAGGGAATTACCCAGAAAAGG + Intronic
1179154025 21:38834090-38834112 CAAAGGAAACAATCTACAAAGGG - Intergenic
1179679380 21:43007609-43007631 CCCCGGGCACTACCTATAAATGG - Exonic
1181794527 22:25295474-25295496 CTCAGGTAAATACCTAAAAATGG + Intergenic
1183567326 22:38625008-38625030 CACAGGAACCTTCCTATAAATGG + Intronic
1185113375 22:48916944-48916966 CACAGGGATCTAGGTACACAGGG - Intergenic
951582844 3:24184309-24184331 CCCAGGGAAATACTTACACAGGG - Intronic
955666568 3:61355582-61355604 TACAGGGAACTAGTTACAAAAGG + Intergenic
957021106 3:75127547-75127569 TATAGGGAACTTACTACAAATGG - Intergenic
957873311 3:86114311-86114333 CTCAGGGAACTACTTTCACAGGG - Intergenic
959252230 3:103963768-103963790 CACAGGGAGCTGCCTAGAGATGG + Intergenic
965542324 3:169882471-169882493 CACAGGGGACTAACTATTAACGG + Intergenic
966203656 3:177383543-177383565 CAGAGGGCACTACTAACAAAAGG - Intergenic
966252080 3:177877505-177877527 CACAGGGGACTAGCTAAATAAGG - Intergenic
970621761 4:17828798-17828820 CTATGGGAATTACCTACAAAGGG - Intronic
972746650 4:41939775-41939797 CCCAGTGAACTAGATACAAATGG + Intronic
973037293 4:45421760-45421782 AACAGGAAATTAACTACAAAAGG - Intergenic
975400667 4:73934724-73934746 CACAGAGGACCAACTACAAATGG + Intergenic
975896901 4:79104213-79104235 CAAAGGGAATCACTTACAAAGGG - Intergenic
982586256 4:157244139-157244161 TAGAGGGAACTAAATACAAAGGG + Intronic
994702778 5:103158008-103158030 CAGAAGCAACTGCCTACAAACGG + Intronic
998062150 5:139127159-139127181 AACAGGGAGCTACAGACAAAAGG + Intronic
1003828738 6:9981420-9981442 CACAGTGATCTGCCTACTAAAGG - Intronic
1005898890 6:30200396-30200418 CCCAGGGAAATACTCACAAAGGG - Intronic
1009839020 6:69042784-69042806 CAGAGGGAACAACTTACAAATGG - Intronic
1014017235 6:116547259-116547281 CCCAGAGAATAACCTACAAAGGG + Intronic
1015126126 6:129756787-129756809 CAATGGGATCTACCTCCAAATGG - Intergenic
1016743862 6:147557554-147557576 CACAGGGACATACCAACAAGAGG - Intronic
1018167785 6:161115838-161115860 CACCAGGATCTACCTACACAGGG - Intronic
1019205900 6:170361575-170361597 CTCAGAGACCTAACTACAAAGGG - Intronic
1027346631 7:77266949-77266971 TACAGGGAGCTACCCCCAAATGG - Intronic
1028742187 7:94288211-94288233 CATATGAAAATACCTACAAATGG + Intergenic
1036237917 8:7057469-7057491 CACAAGGAACAACATTCAAAAGG + Intergenic
1045408396 8:101891040-101891062 AACAGCCAACTACATACAAATGG + Intronic
1050541430 9:6673805-6673827 GAGAGGGAAATGCCTACAAAAGG - Intergenic
1057877011 9:98765375-98765397 CACACAGAACTACATACAGAGGG - Intronic
1059734210 9:117085567-117085589 CCCAGGGCACCACCAACAAAGGG - Intronic
1059851569 9:118346912-118346934 CACAGGAAAGCACCTAGAAAAGG + Intergenic
1060236695 9:121868723-121868745 AACAGGGAACCATCTACGAATGG - Intronic
1187213153 X:17249439-17249461 TACAGGAAACTTCCTACAAAGGG - Intergenic
1188823992 X:34807736-34807758 AACAGGGAACGACATGCAAATGG + Intergenic
1188915574 X:35905536-35905558 CAAAGGGAACAATCCACAAAGGG - Intergenic
1190040478 X:47067399-47067421 CAAAGGGAACAATCAACAAAGGG - Intergenic
1191895292 X:65986382-65986404 CAAAGGGAACAACCCACAACTGG - Intergenic
1194094041 X:89614612-89614634 CACAGGGCCCTACCTACTTAAGG + Intergenic
1195136896 X:101917157-101917179 CACAGGCAACAACATAAAAACGG + Intronic
1197905721 X:131423472-131423494 CCCAATGAACTCCCTACAAATGG + Intergenic
1201282151 Y:12351508-12351530 CATAGAGAACTAGTTACAAAGGG + Intergenic