ID: 1149856753

View in Genome Browser
Species Human (GRCh38)
Location 17:60089242-60089264
Sequence TCGTCCTGCAGCTCTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149856747_1149856753 19 Left 1149856747 17:60089200-60089222 CCAAACTCAAGTTATGCATATTA No data
Right 1149856753 17:60089242-60089264 TCGTCCTGCAGCTCTGGGGTGGG No data
1149856746_1149856753 20 Left 1149856746 17:60089199-60089221 CCCAAACTCAAGTTATGCATATT No data
Right 1149856753 17:60089242-60089264 TCGTCCTGCAGCTCTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149856753 Original CRISPR TCGTCCTGCAGCTCTGGGGT GGG Intergenic