ID: 1149860186

View in Genome Browser
Species Human (GRCh38)
Location 17:60118037-60118059
Sequence TGACCTCTGTCCACAGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149860174_1149860186 12 Left 1149860174 17:60118002-60118024 CCCAGCCCTCTGTGGGGCTGCCC No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860171_1149860186 18 Left 1149860171 17:60117996-60118018 CCTCCACCCAGCCCTCTGTGGGG No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860176_1149860186 7 Left 1149860176 17:60118007-60118029 CCCTCTGTGGGGCTGCCCTCCCA No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860180_1149860186 -9 Left 1149860180 17:60118023-60118045 CCTCCCATGGAGTCTGACCTCTG No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860173_1149860186 15 Left 1149860173 17:60117999-60118021 CCACCCAGCCCTCTGTGGGGCTG No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860168_1149860186 24 Left 1149860168 17:60117990-60118012 CCAGTGCCTCCACCCAGCCCTCT No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860179_1149860186 -8 Left 1149860179 17:60118022-60118044 CCCTCCCATGGAGTCTGACCTCT No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860166_1149860186 28 Left 1149860166 17:60117986-60118008 CCCACCAGTGCCTCCACCCAGCC No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860167_1149860186 27 Left 1149860167 17:60117987-60118009 CCACCAGTGCCTCCACCCAGCCC No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860177_1149860186 6 Left 1149860177 17:60118008-60118030 CCTCTGTGGGGCTGCCCTCCCAT No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data
1149860175_1149860186 11 Left 1149860175 17:60118003-60118025 CCAGCCCTCTGTGGGGCTGCCCT No data
Right 1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149860186 Original CRISPR TGACCTCTGTCCACAGAAGG GGG Intergenic
No off target data available for this crispr