ID: 1149865214

View in Genome Browser
Species Human (GRCh38)
Location 17:60147835-60147857
Sequence CAGAGTAAGAGGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149865205_1149865214 30 Left 1149865205 17:60147782-60147804 CCGTGAGTCAGAAGAAGAGCAAA No data
Right 1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149865214 Original CRISPR CAGAGTAAGAGGAAGGAGGC TGG Intergenic
No off target data available for this crispr