ID: 1149868891

View in Genome Browser
Species Human (GRCh38)
Location 17:60165598-60165620
Sequence ATCCCACGGCTCCTGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149868891_1149868899 18 Left 1149868891 17:60165598-60165620 CCCTTCCCCAGGAGCCGTGGGAT 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1149868899 17:60165639-60165661 TCTGCTTCTGGCTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 62
4: 551
1149868891_1149868897 6 Left 1149868891 17:60165598-60165620 CCCTTCCCCAGGAGCCGTGGGAT 0: 1
1: 0
2: 0
3: 23
4: 166
Right 1149868897 17:60165627-60165649 CATGTCCATCTCTCTGCTTCTGG 0: 1
1: 0
2: 2
3: 23
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149868891 Original CRISPR ATCCCACGGCTCCTGGGGAA GGG (reversed) Intronic
900804077 1:4755919-4755941 ATCAGACGTCACCTGGGGAAGGG + Intronic
901051768 1:6429010-6429032 ATCCCAAACCTCCTGGGGAGTGG + Intronic
902482555 1:16719351-16719373 ATCCCAAACCTCCTGGGGAGTGG - Intergenic
902637477 1:17743955-17743977 GACCCTCGGCTCCTGGGGACAGG + Intergenic
906743405 1:48204853-48204875 ATGCCAGGGCTTCTTGGGAATGG - Intergenic
908249270 1:62252329-62252351 ATAGCACTGCTCCTGGGGACTGG + Intronic
909899025 1:81109601-81109623 CCCAAACGGCTCCTGGGGAAGGG - Intergenic
909900345 1:81127011-81127033 ATCTCACAGCTTCTTGGGAATGG - Intergenic
915323541 1:155069259-155069281 ATCCCAGTCCTCCTGGGGGATGG - Exonic
915603493 1:156937047-156937069 TTCCTAAGGCCCCTGGGGAAGGG + Intronic
915629008 1:157137832-157137854 GCCCCAGGGCTCCTGGGAAAGGG - Intronic
917254059 1:173095637-173095659 TTCCTACGGCTCCTGGGATAGGG + Intergenic
924793410 1:247273486-247273508 ATGCCACAGCTGCTTGGGAATGG + Intergenic
1062903864 10:1166530-1166552 GTCCCACGGCCCCTGGAGAGAGG - Intergenic
1066174780 10:32892024-32892046 CTCCCCCCGCTCCTGGAGAAGGG + Intergenic
1066221029 10:33336134-33336156 GTCACACGCCTCCTGGGGATTGG + Intronic
1069729885 10:70603610-70603632 ATCACACGGCTTCTGGGGTGGGG + Intergenic
1073321650 10:102619594-102619616 TTCCCAGGGCTCCTTGGAAAGGG - Intronic
1073423053 10:103439915-103439937 CTCCCAGGGCTCCTGGAGAAAGG - Intronic
1074049274 10:109867575-109867597 ATTCCACAGCTCCTGTGGAAGGG + Intronic
1075415424 10:122258932-122258954 ATCCCAAAGCTGCTGGGGTACGG - Intergenic
1076592002 10:131589880-131589902 ATCGCACAGCTGCTGGGGGAGGG + Intergenic
1077093062 11:788277-788299 AGCCCAAGGGTCCTGGGGACGGG - Exonic
1077243605 11:1524965-1524987 ATCCCCAGCCTGCTGGGGAAGGG + Intergenic
1077996556 11:7457402-7457424 CTCCCACTGCTCCTTGAGAATGG + Intronic
1079783120 11:24635025-24635047 ATCCCACGCTTCCTGGTAAAAGG - Intronic
1081814231 11:45929631-45929653 GTCCAAAGGCTGCTGGGGAAGGG + Intronic
1082714811 11:56599208-56599230 ATCAAAGGGCTCCTGGGGAGGGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088944595 11:114496366-114496388 ATGCCACTGCTGCTGGGGAAGGG + Intergenic
1088979670 11:114850803-114850825 ATGCTATGGCTTCTGGGGAAGGG + Intergenic
1089126626 11:116180953-116180975 ATTCCATGGCTCATGGGGGAGGG + Intergenic
1089151304 11:116366526-116366548 ATCCCATGGCACCTGGGAGAGGG - Intergenic
1091357366 11:134947760-134947782 ATCCCACGGGGCCTGGGAACTGG - Intergenic
1095406963 12:41877372-41877394 ATTACAAGGCTCCTGGGGAGTGG + Intergenic
1095470986 12:42536528-42536550 AACCAAGGGCTCCTGGGGTATGG + Intronic
1096067866 12:48755457-48755479 ATGCCACAGCTACTGGGAAAGGG - Intergenic
1102453553 12:113057644-113057666 CTCCGACGGCTCCTGCCGAAGGG - Intronic
1103394285 12:120596124-120596146 TTCCCAGGGCTCCTGGGGCCTGG - Intergenic
1105435291 13:20372146-20372168 ATCCCACAGCCTCTGGGGACAGG - Intergenic
1105849752 13:24323291-24323313 AGCCCAAGGGTCCTGGGGACGGG + Intergenic
1108493762 13:51005169-51005191 AATCCAAGGCTGCTGGGGAAAGG + Intergenic
1108524717 13:51276943-51276965 CTGCCAGGGCTCCTGGGGGAGGG + Intronic
1109655407 13:65384413-65384435 AACCAGTGGCTCCTGGGGAAGGG - Intergenic
1112438068 13:99405713-99405735 ATCCCCTAGCTCCTGGGGAAAGG - Intergenic
1113896190 13:113766012-113766034 ATCCCAGGACCCCTGGGTAACGG + Intronic
1114550962 14:23532701-23532723 CTCCCAGGGATGCTGGGGAAGGG + Exonic
1115050446 14:29054533-29054555 AGCACTTGGCTCCTGGGGAAGGG - Intergenic
1116424874 14:44778777-44778799 ATCAAAAGGCTCATGGGGAAAGG + Intergenic
1116716461 14:48432155-48432177 TTCCAACGACTCCTGGGAAAGGG + Intergenic
1117199145 14:53370753-53370775 ATCCAATGAGTCCTGGGGAATGG + Intergenic
1119041766 14:71280923-71280945 ACCCCTCAGCTCCTTGGGAATGG + Intergenic
1119480320 14:74954575-74954597 CTCACCCGGCTCCTGGGAAAAGG + Intronic
1122778388 14:104133228-104133250 ATCCCACGGATCCTGGCTAAGGG - Intergenic
1122839713 14:104451262-104451284 AGCCCAAGGGTCCTGGGGACGGG + Intergenic
1123056241 14:105572032-105572054 AACCCAGGGCTCCTGGAGAAGGG + Intergenic
1123057692 14:105579775-105579797 AACCCAGGGCTCCTGGAGAAGGG - Intergenic
1123080670 14:105692160-105692182 AACCCAGGGCTCCTGGAGAAGGG + Intergenic
1123081971 14:105699708-105699730 AACCCAGGGCTCCTGGAGAAGGG - Intergenic
1124942878 15:34234740-34234762 ATCCCAGGACTCCTGGGATACGG - Intronic
1126344089 15:47674864-47674886 TTCCCACTTCTGCTGGGGAAGGG - Intronic
1128065023 15:64759166-64759188 AGCCCTGGGGTCCTGGGGAAGGG + Intronic
1128100013 15:64990722-64990744 AACCCAAGGCTCCTGGGCCAGGG - Intergenic
1129296674 15:74603743-74603765 CTCCCACAGCTCCTGGGGGATGG + Intronic
1130988324 15:88859148-88859170 CTCCCACGGCTTCTGGAGACAGG + Exonic
1132872553 16:2122296-2122318 GTCCCACAGCCCCTGGGGGAAGG - Intronic
1132987998 16:2777817-2777839 CGCCCAGGGCTCCTGGGGCAAGG - Intergenic
1134081719 16:11329290-11329312 GTCACACTGCTCCAGGGGAAAGG + Intronic
1134522029 16:14923191-14923213 CTCCCAAGGCCCCTGGTGAAGGG - Intronic
1134551651 16:15141496-15141518 GTCCCACAGCCCCTGGGGGAAGG - Intergenic
1134709698 16:16321842-16321864 CTCCCAAGGCCCCTGGTGAAGGG - Intergenic
1134716911 16:16361872-16361894 CTCCCAAGGCCCCTGGTGAAGGG - Intergenic
1134949905 16:18346803-18346825 CTCCCAAGGCCCCTGGTGAAGGG + Intergenic
1134957840 16:18390287-18390309 CTCCCAAGGCCCCTGGTGAAGGG + Intergenic
1136294647 16:29294797-29294819 ATCCCACAGCTCATGGGGGCCGG - Intergenic
1137594373 16:49714107-49714129 ATGCTCCGGCTCCTGGGGATGGG - Intronic
1137899112 16:52245954-52245976 AGCAAAAGGCTCCTGGGGAAGGG + Intergenic
1138295442 16:55881298-55881320 ATCCCTTTTCTCCTGGGGAAGGG - Intronic
1140194947 16:72848126-72848148 CTCCCTCCGCTCCTGGGGATGGG + Intronic
1140470145 16:75209271-75209293 ACTCCACTGCTCCTGGGGAAGGG + Intergenic
1141155250 16:81592759-81592781 TTCCCAAGGATCCTGGGAAAGGG - Intronic
1142552493 17:749576-749598 ATCACACGGCTACAGGGTAATGG + Intronic
1142995546 17:3757819-3757841 AAGCCACGGCTCCAGGAGAAAGG - Exonic
1144338894 17:14297144-14297166 CTCCCACTGCTCCTTGGGAATGG - Intergenic
1146988447 17:37244561-37244583 GTATCACGTCTCCTGGGGAAGGG - Intronic
1147244623 17:39111785-39111807 ATGCCACGGCCCCTGGGGTGAGG + Intronic
1149868891 17:60165598-60165620 ATCCCACGGCTCCTGGGGAAGGG - Intronic
1151678663 17:75612974-75612996 ATGCTGCGGCTCCTGGGGGACGG + Intergenic
1152511844 17:80795313-80795335 ATCCCACGGTGGATGGGGAAGGG - Intronic
1152652730 17:81503145-81503167 GACCCAGGGATCCTGGGGAAGGG + Intergenic
1154400732 18:14034482-14034504 CTCCAACAACTCCTGGGGAAGGG + Intergenic
1157113421 18:44842250-44842272 GTCCCAGCCCTCCTGGGGAAAGG - Intronic
1160528301 18:79549726-79549748 CTCCCACGGCTCGCGGGGATGGG + Intergenic
1160575105 18:79848782-79848804 ATGCCGCGGCCTCTGGGGAACGG - Intergenic
1160747916 19:720336-720358 ATCCTGCGTGTCCTGGGGAAAGG + Intronic
1160747969 19:720455-720477 ATCCTGCGTGTCCTGGGGAAAGG + Intronic
1161318868 19:3631947-3631969 CTCTCAGGGGTCCTGGGGAAGGG + Exonic
1162405297 19:10469445-10469467 ACCCCCTGGCTCCTGGAGAAGGG - Exonic
1167561603 19:50229210-50229232 ACCCCAGGGCTTCTGGGAAATGG + Intronic
1168042078 19:53766568-53766590 TTCCCACGGCCCCTGCGCAAAGG - Intergenic
925212584 2:2062596-2062618 ATCCCACGCTTCCTATGGAAAGG + Intronic
929999950 2:46854563-46854585 ATCCCACACTGCCTGGGGAAAGG - Intronic
932493104 2:72133825-72133847 ATCCCAGGTCTCCAGGGGAGTGG - Intronic
932826361 2:74944621-74944643 ATGCCACGGATGCTGTGGAATGG + Intergenic
933165705 2:79072469-79072491 ATCTCATTGCTGCTGGGGAAGGG - Intergenic
933653131 2:84864994-84865016 ACCACAGGGCTCCTGGGGAGTGG + Intronic
934236579 2:90238191-90238213 ATCCCACAGCACCTGGAGACGGG + Intergenic
936847397 2:116853849-116853871 ATACAACCGCTCCAGGGGAATGG + Intergenic
941108713 2:161393402-161393424 CTCCCATGGCTCCAGGGGTAAGG - Intronic
945347188 2:208732184-208732206 CCTCCAGGGCTCCTGGGGAAGGG - Intronic
946819597 2:223616408-223616430 TTTCCATGGCTCCTGGGAAATGG - Intergenic
946982730 2:225235539-225235561 ATTTCCCGGCTCCTGGGGAAAGG + Intergenic
947199168 2:227599274-227599296 TTCCCACAGCTCCTGGGCAGGGG - Intergenic
947500084 2:230665219-230665241 AGCCCAGGGCTCCAGGGGGAAGG - Intergenic
948190652 2:236055656-236055678 AACCCACGGCTCCTCGGAGAAGG - Intronic
948565584 2:238884248-238884270 ATCCCAAGGCTCCTGGGCCTGGG + Intronic
948613788 2:239185387-239185409 GCCCCACGCCTCCTGGGGAGAGG + Intronic
1171168998 20:22998867-22998889 TTCCCACGGCTTCTCGGGAATGG - Intergenic
1171968653 20:31549594-31549616 ATCCCATGTCTCCTTGGCAAGGG + Intronic
1172022719 20:31925677-31925699 ATCCCCCTCCACCTGGGGAAAGG + Intronic
1175712894 20:61235247-61235269 AGCCCACGGCAGCAGGGGAAGGG + Intergenic
1176382054 21:6118490-6118512 GTCCCAGGCCTCGTGGGGAAGGG + Intronic
1179525890 21:41975613-41975635 ACCCCACGTCTCCTTGGGACAGG - Intergenic
1179577705 21:42318151-42318173 AGCCCAGGGCTCCTGGGGAGGGG - Intergenic
1179741418 21:43419749-43419771 GTCCCAGGCCTCGTGGGGAAGGG - Intronic
1179949881 21:44703573-44703595 ATGCCAGGGCTCCCGGGGAGAGG - Intronic
1181765388 22:25087866-25087888 AGCCCCCAGCACCTGGGGAATGG + Intronic
1182032368 22:27169375-27169397 ATCCCACAGCTGATGGGGGATGG - Intergenic
1182558335 22:31140902-31140924 TTCCCAAGGCTTCTGGGAAAGGG + Intergenic
1182738790 22:32551192-32551214 ATGCCAAGGCCACTGGGGAAAGG + Intronic
1183300355 22:37056128-37056150 ATCCCACACTTCCTGTGGAAGGG - Intronic
1183362510 22:37389996-37390018 AGCCCACGGGCCCTGGGGAGGGG + Intronic
1183385951 22:37514692-37514714 GGCCCAAGGCTCCTGGGGTAGGG + Intronic
1183738919 22:39659422-39659444 ATCCCAAGGATGCTGGGGAAAGG - Exonic
1183746191 22:39693460-39693482 ATCCCACTGCACCTGAAGAAGGG - Intergenic
952958956 3:38577827-38577849 ATCCCTCTGCTTCTAGGGAACGG + Intronic
953660880 3:44890742-44890764 ATCTCAGGTCTGCTGGGGAATGG + Intronic
972948568 4:44289564-44289586 CTAGAACGGCTCCTGGGGAAGGG + Intronic
977840328 4:101694966-101694988 ATCCATCAGCTCCTGGGAAAGGG - Intronic
983204777 4:164901163-164901185 TACCCAAGGCTCCTGGGGCAAGG - Intergenic
983583832 4:169335288-169335310 GTCCTACAGATCCTGGGGAAAGG + Intergenic
984150201 4:176120522-176120544 ATGCCACGGCTCCTTGGCAAAGG + Intronic
986385561 5:7230313-7230335 ACCACACGGTTTCTGGGGAAGGG + Intergenic
987645768 5:20671195-20671217 ACCACATGGCTGCTGGGGAATGG - Intergenic
988602572 5:32653681-32653703 ATCAGACAGCACCTGGGGAATGG - Intergenic
992222962 5:74590863-74590885 AGCGAAGGGCTCCTGGGGAAAGG + Intergenic
992575146 5:78100159-78100181 ATGCCATGGCTACTGGGGACAGG + Intronic
993417599 5:87654427-87654449 ATCCCACAGTTCCTGGAGGATGG + Intergenic
995778302 5:115748740-115748762 ACCACAAGGCTCCAGGGGAAAGG - Intergenic
997241461 5:132311451-132311473 ATCCCACAGACCCTAGGGAATGG + Intronic
999070605 5:148739772-148739794 ATCCCAGGGCTCCCTGGGATGGG + Intergenic
1001106229 5:168856956-168856978 GTGCGACGGCTCCTGGGGAAGGG + Intronic
1003424980 6:5992984-5993006 TTGCCACTGCTCCTGGGGAGGGG + Intergenic
1003706975 6:8543289-8543311 ATCCCCCAAATCCTGGGGAAGGG - Intergenic
1006075562 6:31529983-31530005 ATCCCAAGGCTCCTGGTGGGTGG - Exonic
1006576286 6:35048865-35048887 AGCCCCCGGCTCCTGGGAAGGGG + Intronic
1006917430 6:37603460-37603482 TTCCCATGGGTCCTTGGGAAGGG - Intergenic
1007593550 6:43037890-43037912 ATCCTACACCTCCTGGGCAAGGG - Exonic
1008001185 6:46361373-46361395 ATGCCACAACTCCAGGGGAAAGG + Intronic
1009274421 6:61657004-61657026 ATCACAAGGCACCTGGAGAAAGG + Intergenic
1012578503 6:100833283-100833305 TTCCCAAGGCTACAGGGGAAGGG + Intronic
1012884541 6:104830957-104830979 AACCCACAACTCCTGGGCAAAGG + Intronic
1018989606 6:168663467-168663489 ATCCCCCGCCTTCTGGGGAAAGG + Intronic
1019310404 7:357651-357673 CTCCCAGGGCTCCTGGGGTCAGG - Intergenic
1024411986 7:49054222-49054244 ATCACACAGAGCCTGGGGAAAGG - Intergenic
1025603742 7:63023952-63023974 ATTCCATGCCTCCTGGGGAATGG + Intergenic
1027173459 7:75888826-75888848 ATCCCACCGCTTCTGGGGAGAGG - Exonic
1027221098 7:76214363-76214385 AACCCACGGCTCCTGAGGGATGG - Intronic
1034939842 7:155223363-155223385 ACCCCAAGGGTCCTGGGGAAAGG + Intergenic
1037887869 8:22604638-22604660 ATCCCGCGGCAACTGGGGAGCGG - Exonic
1038612760 8:29070391-29070413 ATCGCCCTGCCCCTGGGGAAGGG + Exonic
1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG + Intronic
1040978025 8:53215390-53215412 CTCCAGTGGCTCCTGGGGAAGGG - Intergenic
1042162509 8:65911766-65911788 ATGCCACTGCTGCTGGGGCATGG - Intergenic
1043305335 8:78786886-78786908 ATCCCCCAGCTTCTGGGGAGAGG + Intronic
1044784253 8:95778135-95778157 AGGCCATGGCTCCGGGGGAAGGG + Intergenic
1048968611 8:139631333-139631355 AACCCACTGGTTCTGGGGAAGGG + Intronic
1049644934 8:143731957-143731979 ATCCCACTGCTCCTCGGGTTGGG + Intronic
1053239767 9:36486887-36486909 CTCCCTCGGCTCCTGGGGGCCGG + Intronic
1058869871 9:109192311-109192333 ATCACCCGGCTCCAGGGTAAAGG + Exonic
1060213774 9:121726144-121726166 ACCCCACAGCCCCTGGGGCAGGG + Intronic
1060281113 9:122216331-122216353 CTTCCACGGATCCTGGGGACAGG - Intronic
1060389921 9:123268656-123268678 GCCCCGCGGCTGCTGGGGAACGG + Intergenic
1061234825 9:129336319-129336341 ATCACACAGCTCTTGGGGAGTGG + Intergenic
1062084752 9:134642724-134642746 ATCCCGGGACTCCTGGGGATGGG + Intronic
1062159736 9:135073724-135073746 ATGCCACGGCCCCTGAGGCAGGG - Intergenic
1189929801 X:45996733-45996755 ACACCACTGCTGCTGGGGAATGG + Intergenic
1193884057 X:86963242-86963264 CCCCCATGCCTCCTGGGGAAGGG + Intergenic
1196194214 X:112822966-112822988 TTCCCACTGCCACTGGGGAAAGG + Exonic
1197093826 X:122571306-122571328 CCCCAACGACTCCTGGGGAAGGG + Intergenic