ID: 1149869766

View in Genome Browser
Species Human (GRCh38)
Location 17:60170908-60170930
Sequence TAGGGTGGTAAAGAAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149869764_1149869766 -7 Left 1149869764 17:60170892-60170914 CCAGTTCAGGGGGAGGTAGGGTG 0: 1
1: 1
2: 0
3: 8
4: 133
Right 1149869766 17:60170908-60170930 TAGGGTGGTAAAGAAGCAGCTGG No data
1149869756_1149869766 24 Left 1149869756 17:60170861-60170883 CCAGGAGTTGCTAAGTGGTGGAT 0: 1
1: 1
2: 0
3: 8
4: 67
Right 1149869766 17:60170908-60170930 TAGGGTGGTAAAGAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149869766 Original CRISPR TAGGGTGGTAAAGAAGCAGC TGG Intergenic
No off target data available for this crispr