ID: 1149872241

View in Genome Browser
Species Human (GRCh38)
Location 17:60193117-60193139
Sequence CTGTAAGCCCAGATAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 2, 1: 0, 2: 0, 3: 25, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149872241_1149872248 24 Left 1149872241 17:60193117-60193139 CCATCCTCTATCTGGGCTTACAG 0: 2
1: 0
2: 0
3: 25
4: 368
Right 1149872248 17:60193164-60193186 TGTCTCTAAGGGAGTCCATGTGG 0: 2
1: 0
2: 0
3: 10
4: 111
1149872241_1149872246 13 Left 1149872241 17:60193117-60193139 CCATCCTCTATCTGGGCTTACAG 0: 2
1: 0
2: 0
3: 25
4: 368
Right 1149872246 17:60193153-60193175 AGACTGCCAGATGTCTCTAAGGG 0: 2
1: 0
2: 2
3: 8
4: 112
1149872241_1149872245 12 Left 1149872241 17:60193117-60193139 CCATCCTCTATCTGGGCTTACAG 0: 2
1: 0
2: 0
3: 25
4: 368
Right 1149872245 17:60193152-60193174 AAGACTGCCAGATGTCTCTAAGG 0: 1
1: 1
2: 2
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149872241 Original CRISPR CTGTAAGCCCAGATAGAGGA TGG (reversed) Intronic
900895330 1:5479282-5479304 CTGCAAGCCCAGACAGATGACGG + Intergenic
901384070 1:8895516-8895538 CTGTAATCCCAGACCGAGGTGGG + Intergenic
901557342 1:10042055-10042077 CTGTAATCCCAGATACTCGAGGG - Intronic
901609258 1:10484148-10484170 CTGTAATCCCAGCTACTGGAAGG - Intronic
902459617 1:16563836-16563858 TTGGAAGCCCAGACATAGGATGG - Exonic
902459784 1:16565456-16565478 CTGGAAGCCCAGACATGGGATGG - Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
904784229 1:32973389-32973411 CTGGAAGCCCAGTGAGAGGCAGG - Intergenic
905248409 1:36630423-36630445 ATGAAAGCCCAGAAAGAGGTAGG - Intergenic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
905573532 1:39025477-39025499 CTGTAATCCCAGCTAGTGGGGGG - Intergenic
905575134 1:39038010-39038032 CTGTAATCCCAGCTACAGGGAGG - Intergenic
905589240 1:39147639-39147661 CTGTAGGCCCAGCTACATGAGGG - Intronic
905713882 1:40131633-40131655 CTGTAATCCCAGCTACAGGCTGG - Intergenic
907351257 1:53833280-53833302 CTGTAATCCCAGCTACTGGAAGG - Intronic
909192009 1:72565379-72565401 CTGTAATCCCAGCTACTGGAGGG - Intergenic
909698965 1:78499235-78499257 AAGATAGCCCAGATAGAGGAGGG - Intronic
912674463 1:111664578-111664600 CTTGAAGCCCAGGGAGAGGAAGG - Intronic
912835855 1:112995798-112995820 CTGTAATCCCAGCTACAGGGAGG + Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913605807 1:120464703-120464725 CTGGAAGCCCAGACAAGGGATGG + Intergenic
913605971 1:120466306-120466328 TTGGAAGCCCAGACATAGGATGG + Intergenic
913643225 1:120832315-120832337 CTGGAAGCCCAGACAAGGGATGG + Intronic
913643526 1:120834957-120834979 CTGGAAGCCCAGACAAGGGATGG + Intronic
913643992 1:120839072-120839094 CTGGAAGCCCAGACAAGGGATGG + Intronic
913644159 1:120840678-120840700 TTGGAAGCCCAGACATAGGATGG + Intronic
914082585 1:144422906-144422928 TTGGAAGCCCAGACATAGGATGG - Exonic
914082743 1:144424513-144424535 CTGGAAGCCCAGACAAGGGATGG - Intronic
914177485 1:145291419-145291441 TTGGAAGCCCAGACATAGGATGG - Exonic
914210455 1:145573858-145573880 TTGGAAGCCCAGACATAGGATGG - Intergenic
914210618 1:145575470-145575492 CTGGAAGCCCAGACATGGGATGG - Intergenic
914269381 1:146066211-146066233 TTGGAAGCCCAGACATAGGATGG - Exonic
914269905 1:146070970-146070992 CTGGAAGCCCAGACAAGGGATGG - Intronic
914270446 1:146075692-146075714 CTGGAAGCCCAGACAAGGGATGG - Intronic
914270982 1:146080428-146080450 CTGGAAGCCCAGACAAGGGATGG - Intronic
914271520 1:146085164-146085186 CTGGAAGCCCAGACAAGGGATGG - Intronic
914272055 1:146089885-146089907 CTGGAAGCCCAGACAAGGGATGG - Intronic
914272591 1:146094603-146094625 CTGGAAGCCCAGACAAGGGATGG - Intronic
914273129 1:146099325-146099347 CTGGAAGCCCAGACAAGGGATGG - Intronic
914273668 1:146104047-146104069 CTGGAAGCCCAGACAAGGGATGG - Intronic
914274206 1:146108765-146108787 CTGGAAGCCCAGACAAGGGATGG - Intronic
914274742 1:146113475-146113497 CTGGAAGCCCAGACAAGGGATGG - Intronic
914275275 1:146118193-146118215 CTGGAAGCCCAGACAAGGGATGG - Intronic
914275812 1:146122929-146122951 CTGGAAGCCCAGACAAGGGATGG - Intronic
914367014 1:146988281-146988303 CTGGAAGCCCAGACATGGGATGG + Intronic
914367550 1:146993039-146993061 CTGGAAGCCCAGACATGGGATGG + Intronic
914367714 1:146994660-146994682 TTGGAAGCCCAGACATAGGATGG + Exonic
914380500 1:147111714-147111736 TTGGAAGCCCAGACATAGGATGG - Intergenic
914380679 1:147113266-147113288 TTGGAAGCCCAGACATAGGATGG - Intergenic
914485265 1:148103562-148103584 TTGGAAGCCCAGACATAGGATGG - Exonic
914485433 1:148105183-148105205 CTGGAAGCCCAGACATGGGATGG - Intronic
914532214 1:148532898-148532920 TTGGAAGCCCAGACATAGGATGG - Exonic
914532743 1:148537657-148537679 CTGGAAGCCCAGACAAGGGATGG - Intronic
914533278 1:148542377-148542399 CTGGAAGCCCAGACAAGGGATGG - Intronic
914533813 1:148547091-148547113 CTGGAAGCCCAGACAAGGGATGG - Intronic
914534349 1:148551799-148551821 CTGGAAGCCCAGACAAGGGATGG - Intronic
914534885 1:148556513-148556535 CTGGAAGCCCAGACAAGGGATGG - Intronic
914535420 1:148561230-148561252 CTGGAAGCCCAGACAAGGGATGG - Intronic
914535957 1:148565966-148565988 CTGGAAGCCCAGACAAGGGATGG - Intronic
914536851 1:148573876-148573898 CTGGAAGCCCAGACAAGGGATGG - Intronic
914585229 1:149055549-149055571 TTGGAAGCCCAGACATAGGATGG - Exonic
914585397 1:149057158-149057180 CTGGAAGCCCAGACAAGGGATGG - Intronic
914585763 1:149060346-149060368 CTGGAAGCCCAGATGAGGGATGG - Intronic
914629068 1:149491466-149491488 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914629601 1:149496229-149496251 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914630136 1:149500984-149501006 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914630670 1:149505745-149505767 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914631201 1:149510506-149510528 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914631733 1:149515262-149515284 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914632269 1:149520015-149520037 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914632806 1:149524772-149524794 CTGGAAGCCCAGACATGGGATGG + Intergenic
914633340 1:149529501-149529523 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914633876 1:149534252-149534274 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914634412 1:149539003-149539025 CTGGAAGCCCAGACATGGGATGG + Intergenic
914634945 1:149543740-149543762 CTGGAAGCCCAGACATGGGATGG + Intergenic
914635480 1:149548477-149548499 CTGGAAGCCCAGACATGGGATGG + Intergenic
914636015 1:149553214-149553236 CTGGAAGCCCAGACATGGGATGG + Intergenic
914636180 1:149554823-149554845 TTGGAAGCCCAGACATAGGATGG + Intergenic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
916497484 1:165358218-165358240 CTGTCACCCCAGGTAGAGCAGGG + Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
919963639 1:202498607-202498629 CTGTAGGCCCATATAGATAATGG - Intronic
922889244 1:229047594-229047616 ATGATAGCCCAGATAGAGGAGGG + Intergenic
922895977 1:229100732-229100754 CTGTAATTCCAGCTACAGGAAGG - Intergenic
923891730 1:238223157-238223179 CTATAAGCCCAGCTATAGAAAGG - Intergenic
923899495 1:238310436-238310458 CTGTAATCCCAGATAGTCGGGGG - Intergenic
924440101 1:244078813-244078835 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063771287 10:9205003-9205025 CTGTAATCCCAGCTATAGGGAGG + Intergenic
1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG + Intronic
1067517393 10:46963419-46963441 ATGGAAGCCCAGAGATAGGAAGG + Intronic
1067644855 10:48088410-48088432 ATGGAAGCCCAGAGATAGGAAGG - Intergenic
1068534457 10:58225981-58226003 CTGTAAGCCCACAAAAAAGAAGG + Intronic
1068990019 10:63140534-63140556 CTGTAGTCCCAGCTACAGGAGGG - Intronic
1069449138 10:68502071-68502093 CTGTAATCCCAGCTACTGGAGGG + Intronic
1069918661 10:71802804-71802826 GAGTAAGCCTGGATAGAGGAAGG - Intronic
1070048552 10:72863736-72863758 CTGTAATCCCAGTTACAGGGAGG - Intronic
1070589862 10:77794173-77794195 CTGTTAGCCTGGACAGAGGAAGG - Intronic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1072816299 10:98512681-98512703 ATGAAAGGCCAGATAGAGAAAGG - Intronic
1074495639 10:113977936-113977958 CTATAAGCCCAGAGAAAGGATGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1079578413 11:22031429-22031451 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1079735179 11:23988456-23988478 CTCTAAACCCAGGTAGTGGAAGG + Intergenic
1080740491 11:35059434-35059456 ATGAATGCCCAGAGAGAGGATGG - Intergenic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083169740 11:60915968-60915990 CTGTAAGCCCAGAAGGCAGATGG + Intronic
1084403174 11:68956449-68956471 CTTTAAGCAGACATAGAGGAGGG - Intergenic
1085291945 11:75407258-75407280 CTGTAATCCCAGCTAGCGGGAGG - Intronic
1087783817 11:102331761-102331783 CTGTAATCCCAGCTAAGGGAAGG - Intronic
1088101029 11:106155852-106155874 CTGTAATCCCAGTTACTGGAGGG - Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089257504 11:117201640-117201662 CTGTCAGCCCTGAGAAAGGAAGG + Intronic
1090266825 11:125358701-125358723 CAGTTAGCCCAGGGAGAGGAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091983674 12:4888519-4888541 CTGTATCCTCACATAGAGGAGGG - Intergenic
1094336107 12:29356142-29356164 CTGTAATCCCAGATACTCGAGGG - Intronic
1095420002 12:42015617-42015639 CTGTAATCCCAGCTACAGGGGGG - Intergenic
1096296202 12:50386304-50386326 CTGTAATCCCAGCTATAGGGAGG + Intronic
1100309265 12:93378585-93378607 CTATCAGCCCAGAGAAAGGAAGG - Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101115327 12:101525810-101525832 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1102765316 12:115427888-115427910 CTTTAGGCCCAGATCAAGGAGGG + Intergenic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1102960848 12:117092464-117092486 CTGTGAGCCCCCAGAGAGGAGGG + Intronic
1104647294 12:130506213-130506235 CTGTACCCCCTGATAGAGCAAGG + Intronic
1106622291 13:31382470-31382492 CAGTAAGCCGAGACAAAGGAGGG - Intergenic
1106820276 13:33456739-33456761 CTGTATTCCCACATAGTGGAAGG - Intergenic
1108037816 13:46310024-46310046 GAGTAAGCCAAGAAAGAGGAAGG - Intergenic
1108320187 13:49281934-49281956 CTGTAATCCCAGATACTGGGGGG - Intronic
1108699903 13:52934758-52934780 CTGTAATCCCAGCTACTGGAAGG + Intergenic
1110176703 13:72565335-72565357 CTTTAACACCAGACAGAGGAAGG + Intergenic
1111040453 13:82740686-82740708 CTCTGAGCCCAGAGAGAGCAGGG - Intergenic
1112431301 13:99352736-99352758 CTCTAAGCTCAGGGAGAGGAGGG - Intronic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1117695527 14:58358343-58358365 CTGTAATCCCAGATATTGGGAGG + Intronic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1118658467 14:67980320-67980342 CTGTAATCCCAGTTATGGGAAGG + Intronic
1119702585 14:76765433-76765455 CTCAGAGCCCAGGTAGAGGAGGG - Intronic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120129457 14:80787879-80787901 CAGTAAGTCCAGAGACAGGATGG + Intronic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1125334532 15:38614459-38614481 CTGGAAGCCCATAGAGGGGAAGG - Intergenic
1126766461 15:52015932-52015954 CTGTAATCCCAGCTACTGGAAGG + Intronic
1128135159 15:65257506-65257528 CTGTAATCCCAGCTACAGGGAGG + Intronic
1129794294 15:78364261-78364283 CTGTAACTCCATATAGAAGATGG - Intergenic
1131588070 15:93717539-93717561 CTGGAAGCCCAGGGAGAAGAGGG + Intergenic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1132958286 16:2608210-2608232 CAGTGAGCCCAGATAGAGGCGGG - Intergenic
1133116776 16:3582080-3582102 CTGTGAGCACGGACAGAGGAAGG + Exonic
1133916327 16:10112821-10112843 ATGTCAGCCCAGATCGAGGGTGG + Intronic
1135459908 16:22633214-22633236 CTGTAGGCCCAGCTACAGGGAGG - Intergenic
1136132625 16:28233338-28233360 CTGTAATCCCAGCTACAGGGTGG + Intergenic
1137249871 16:46733566-46733588 TTGTGAGCCCAGATGGAGGTGGG + Intronic
1137430040 16:48411279-48411301 CTGTAATCCCAGCTACAGGGAGG + Intronic
1138241519 16:55431186-55431208 CTGTAATCCCAGCTATTGGAAGG - Intronic
1141566427 16:84905519-84905541 CTGTAATCCCAGCTAGTTGAAGG - Intronic
1141659975 16:85436543-85436565 CTGTTAGCCCCCACAGAGGAAGG - Intergenic
1142407082 16:89896216-89896238 CCTTAAGCCCAGAGAGAGGAAGG - Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143241622 17:5447853-5447875 CTGAAAGCCCAGCCACAGGAAGG + Intronic
1143858615 17:9871570-9871592 CTGTCATCTCAGAAAGAGGAAGG - Intronic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1150481918 17:65517325-65517347 CTGTAACCCCAGCCTGAGGAAGG - Intergenic
1151670570 17:75569679-75569701 CTGTAATCCCAGCTACTGGAAGG + Intronic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1154342230 18:13513255-13513277 CTGTAAGCCTGGAGACAGGAAGG - Intronic
1155208902 18:23584610-23584632 CTGTAATCCCCAAAAGAGGAGGG + Intronic
1155930139 18:31698507-31698529 CAGTAATCCCAGCTACAGGAAGG + Intergenic
1156853380 18:41754549-41754571 CTCTAAGTCTAGATAGATGAGGG + Intergenic
1159713880 18:71797625-71797647 CTCGAAGCCCAGGTAGAGAACGG + Intergenic
1159963071 18:74570676-74570698 CTTGAAGCTCAGGTAGAGGAAGG + Intronic
1160673724 19:377740-377762 CTGGGAGCCCAGAAAGGGGAGGG - Intergenic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161500520 19:4612177-4612199 CTATAATCCCAGTTAGAGGAAGG - Intergenic
1161812866 19:6480725-6480747 CTGTAATCCCAGCTACAGGGAGG - Intronic
1162473478 19:10886314-10886336 CTGTAATCCCAGCTACAGGCTGG - Intronic
1162984749 19:14262477-14262499 CTGTAATCCCAGATACTTGAGGG - Intergenic
1165003838 19:32788232-32788254 CTGTAATCCCAGACTGAGGCAGG - Intronic
1165458968 19:35933005-35933027 CTGTAATCCCAGGTTGAGGTGGG + Intergenic
1165695292 19:37896058-37896080 CTGTTAGCCCAGATTGACAAAGG - Intronic
1165913256 19:39242767-39242789 CTGTAATCCCAGTTCGGGGAGGG + Intergenic
1165917863 19:39271973-39271995 CTGTAATCCCAGTTCGGGGAGGG - Intergenic
1165943498 19:39427444-39427466 CTGCAATCCCAGCTAGAGGCAGG - Exonic
1166037655 19:40180808-40180830 CTGTAATCCCAGTTACAGGGAGG - Intergenic
1167255893 19:48428483-48428505 CTGTAATCTCAGCTACAGGAGGG - Intronic
1167291335 19:48626691-48626713 CTGTAATCCCAGCTACAGGAGGG + Intronic
1167472337 19:49682258-49682280 CGGTGAGCCCAGAAAGAGGATGG + Exonic
1167514770 19:49916807-49916829 CTGTGATCCCAGATAGAGGTGGG + Intronic
1168358149 19:55715129-55715151 ATTTGAGCCCAGATCGAGGAGGG + Exonic
1168704064 19:58458288-58458310 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1202675861 1_KI270711v1_random:6020-6042 TTGGAAGCCCAGACATAGGATGG - Intergenic
1202676028 1_KI270711v1_random:7640-7662 CTGGAAGCCCAGACATGGGATGG - Intergenic
925993758 2:9275190-9275212 CTGTAATCCCAGGCTGAGGAGGG - Intronic
927778786 2:25922970-25922992 CTGTAATCCCAGCTACAGGCAGG - Intergenic
927952040 2:27177572-27177594 CTGTAGTCCCAGGTACAGGAGGG - Intergenic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
931987263 2:67754080-67754102 CTGTAACCTCACATAGTGGAAGG - Intergenic
936064309 2:109318997-109319019 CTGTAATCCCAGTTAGCAGAGGG - Intronic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937109652 2:119354400-119354422 CTGTAAGCCCAGCTACTGGGAGG + Intronic
937677537 2:124608429-124608451 CTGCATGCTCAGATAGAGGCAGG - Intronic
938100800 2:128496951-128496973 CTCCAAGCCCAGACAGTGGAGGG - Intergenic
938212144 2:129477350-129477372 CTGTAATCCCAGCTATAGGGAGG + Intergenic
938763923 2:134447924-134447946 TGGTAACCCCAGTTAGAGGAAGG - Intronic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
940669861 2:156654081-156654103 CTGGAAGGCAAGAAAGAGGAAGG - Intergenic
941741242 2:169037649-169037671 CTGTCAGACAAGATAGAGTAAGG - Intergenic
941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG + Intronic
942105800 2:172632143-172632165 CTGTAATCCCAGCTATAGGGAGG + Intergenic
943413363 2:187566776-187566798 CTAAAAGGCCAGATAGAGGAAGG + Intergenic
944531876 2:200675123-200675145 CTGGAATGCCAGCTAGAGGATGG + Intronic
945139864 2:206673378-206673400 CTGTAATCCCAGCTACTGGAGGG - Intronic
945271935 2:207949416-207949438 CTGTAATCCCAGCTACTGGAAGG + Intronic
945528790 2:210924462-210924484 CTGTAATCCCAGGCAGAGGCAGG - Intergenic
946337904 2:219050571-219050593 CTGTAAGGCCAGCTTGAGGAAGG + Intergenic
947024784 2:225724906-225724928 CTGAAAGCCTAGGGAGAGGAAGG - Intergenic
947262714 2:228242006-228242028 CTGTAACCCCAGCTATCGGATGG + Intergenic
947307891 2:228767308-228767330 CTGAAAAGCTAGATAGAGGAGGG - Intergenic
947561489 2:231157687-231157709 CTGTAGTCCCAGCTACAGGAGGG - Intronic
948141410 2:235674931-235674953 CTGTAATCCCAGACCGAGGGGGG - Intronic
948414933 2:237796259-237796281 CTGTAATCCCAGCTACTGGAAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169162207 20:3390485-3390507 CTGTAATCCCAGCTACAGGGAGG - Intronic
1170287340 20:14724788-14724810 CTGTAAGCCAAGAAAGGAGATGG + Intronic
1171059817 20:21945401-21945423 CTGAAAGCCTGGTTAGAGGACGG - Intergenic
1172545363 20:35756789-35756811 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1173480522 20:43395153-43395175 CTGTAATCCCAGATACTTGAGGG + Intergenic
1173899442 20:46576399-46576421 CAGTAAGCCAAGACTGAGGAAGG - Intronic
1174004028 20:47396020-47396042 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1174031526 20:47632298-47632320 CTATAAGCCCAGAGAGGGCATGG - Intronic
1174277280 20:49413252-49413274 CCGAGAGCCCAGATAGAGGGTGG - Intronic
1174661479 20:52216919-52216941 CTGTAGGCCAAGACAGAGTAGGG - Intergenic
1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG + Intronic
1176943993 21:14956538-14956560 CTGTAATCCCAGCTACTGGAGGG + Intergenic
1177687112 21:24451331-24451353 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1178681495 21:34675989-34676011 CTGTCAGCCCAGACAGAGACGGG - Intronic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1182351539 22:29702737-29702759 ATGGAAGCCCAGAGAGTGGAAGG - Intergenic
1182716457 22:32359691-32359713 CTCTAAGGCCAGGTGGAGGAGGG - Intronic
1183578489 22:38707468-38707490 CTGTAAGGCCATAATGAGGATGG + Intronic
1183771621 22:39931277-39931299 CTGGAAGTACAGAGAGAGGAAGG + Intronic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184393699 22:44220218-44220240 CTGTAATCCCAGCTAGTTGAAGG - Intergenic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184753235 22:46501153-46501175 CTGTAAGCCCAGTTACTGGGAGG - Intronic
949885465 3:8689732-8689754 CTCAAAGCCAAGATTGAGGACGG - Intronic
950108319 3:10402349-10402371 CTGAAAGACCAGATAGAAGCAGG + Intronic
950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG + Intronic
951216061 3:20026342-20026364 CTGTAATCCCAGCTACACGAGGG + Intergenic
951456971 3:22903714-22903736 CTGTAATCCCAGCTACAGGCCGG + Intergenic
952233810 3:31458456-31458478 CTGTAATCCCAGATACTGGCTGG + Intergenic
952781886 3:37108616-37108638 CTGTAAGTCTAAATAGGGGAAGG - Exonic
953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG + Intergenic
953477518 3:43218229-43218251 CAATAACCCCAGATAGAGCATGG - Intergenic
954938638 3:54350430-54350452 CTTCAAGCCCAGAGAGAGAAAGG - Intronic
955485010 3:59426402-59426424 CTGTAAGCCCAGGAAAAGGCAGG - Intergenic
957043521 3:75355892-75355914 CTCAAAGCCAAGATTGAGGATGG + Intergenic
957842080 3:85685004-85685026 CTGTAATCCCAGCAAGAGGAGGG + Intronic
957924273 3:86788607-86788629 CTGTAATCCCAGCTACTGGAGGG - Intergenic
959984605 3:112558859-112558881 CTGTAATCCCAGCTACAGGCAGG - Intronic
962235681 3:133705150-133705172 CTGTAATCCCAGCTACAGGGAGG + Intergenic
963024884 3:140909844-140909866 CTGTAATCCCAGATGGCTGAGGG - Intergenic
964065796 3:152577294-152577316 CTGTAATCCCAGCTACTGGAGGG + Intergenic
965191717 3:165538892-165538914 CTGTAATCCCAGAAATTGGAAGG - Intergenic
965710853 3:171555134-171555156 TTTTAAGCCCAAATAGAGGAAGG + Intergenic
965741856 3:171883957-171883979 CTTCAAGCCCAGCTAGAGGCAGG + Intronic
966151964 3:176875364-176875386 CTGGAAGCCCAGTTACAGGGAGG + Intergenic
967866148 3:194191670-194191692 CTGTAAGCAGAGCTATAGGATGG + Intergenic
969027073 4:4182248-4182270 CTCAAAGCCAAGATTGAGGACGG + Intergenic
969921811 4:10547193-10547215 AGGTAAGCCCAGATAGGTGATGG + Intronic
970577375 4:17440676-17440698 CTGTAATCCCAGCTACAGGGAGG + Intergenic
971319271 4:25592211-25592233 CTGTAATCCCAGGTAGAGATGGG + Intergenic
972545901 4:40080457-40080479 CTGTAGTCCCAGACAGAGGCAGG - Intronic
974610630 4:64210771-64210793 CTGTAATCCCAGCTAGTGGGAGG - Intergenic
975573328 4:75839465-75839487 CTGAAAGCCAAGATAGCTGAAGG + Intergenic
975672762 4:76798326-76798348 CTGTAAGCCTTGAAAGAGCAGGG - Intergenic
976073584 4:81271362-81271384 CTGTAATCCCAGCTAGTTGAGGG + Intergenic
976089026 4:81435899-81435921 CTGTAGTCCCAGGTATAGGAGGG - Intronic
976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG + Intergenic
976812247 4:89110326-89110348 CTGTCATGCCAGATAGTGGAAGG + Intronic
977183438 4:93905887-93905909 CTGTAATCCCAGATATTGGTAGG - Intergenic
980573252 4:134651165-134651187 CTGTAATCCCAGCTATAGGGAGG - Intergenic
981267417 4:142803045-142803067 CTGTAATCCCAGCTACAGGGCGG + Intronic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
982823701 4:159976472-159976494 CTGGAAGCCCAGATATTGAAGGG + Intergenic
984339387 4:178435866-178435888 CTGTAAGTACAGATATGGGAAGG + Intergenic
985558215 5:568495-568517 CTGAAACCCTAGAGAGAGGAGGG - Intergenic
987188549 5:15450289-15450311 CTCTAAGCCCAGAGATGGGAGGG + Intergenic
987210134 5:15673067-15673089 CTGTAATCCCAGGCCGAGGAAGG + Intronic
992016863 5:72584048-72584070 CTGTAAAGCCATATAGATGAAGG + Intergenic
992603075 5:78424606-78424628 CTGTAATCCCAGCTCGAGGCAGG + Intronic
993516264 5:88839094-88839116 CTGTAGGCTCTGATAGAGCAAGG - Intronic
994921245 5:106046801-106046823 CTGTAAGCCAAGAAACAGCAAGG + Intergenic
998800420 5:145863742-145863764 TTGTAATCCCAGGCAGAGGAGGG - Intronic
999291032 5:150426529-150426551 CTGTAATCCCAGCTACAGGCTGG - Intergenic
1000992171 5:167922555-167922577 GTGCAAGCACAGAGAGAGGAAGG - Intronic
1002472025 5:179440997-179441019 CTGTAACCCCAGGTTGAGGTGGG + Intergenic
1002977590 6:2098179-2098201 CTGTAATCCCAGCTACAGGGAGG - Intronic
1003136167 6:3436121-3436143 CTGGAAGTCCAGAGACAGGACGG - Intronic
1004036454 6:11929032-11929054 CTGTACTCCCAGCTACAGGAGGG - Intergenic
1004415276 6:15417619-15417641 CTGTAGTCCCAGTTACAGGAGGG + Intronic
1005373264 6:25156599-25156621 TTGAATGACCAGATAGAGGAAGG - Intergenic
1006291871 6:33144102-33144124 CTGTAATCCCAGATACTCGAGGG + Intergenic
1006354487 6:33546676-33546698 CTGTAGTCCCAGATACAGGCAGG - Intergenic
1006612912 6:35305693-35305715 CTGTAATCCCAGTTACAGGGAGG - Intronic
1006741537 6:36312561-36312583 CTGTGAGCCGAGAGAGAGAACGG + Intergenic
1008611426 6:53187849-53187871 CTGTAATCCCAGCTACAGGCAGG + Intergenic
1010724468 6:79317573-79317595 CTGTAATCCCAGATACTTGAGGG - Intergenic
1010737032 6:79454783-79454805 CTGTAATCCCAGTTACAGGGAGG - Intergenic
1012723498 6:102779826-102779848 GTGTTATCCCAGATTGAGGAAGG + Intergenic
1015156853 6:130106355-130106377 TTGAAACCCCAGAGAGAGGATGG - Intronic
1017602097 6:156094801-156094823 CTAGAAGCCCAGAGAGTGGAGGG - Intergenic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1017888629 6:158621454-158621476 CTGAAAACCCAGGAAGAGGATGG - Intronic
1017899341 6:158705787-158705809 CTGTAAGGCCACATAGGGCAGGG + Intronic
1018289168 6:162272873-162272895 CTGTAATCCCAGCTACAGGCTGG + Intronic
1020844148 7:13261525-13261547 CTGTAATCCCAGCTACAGGCTGG - Intergenic
1021955096 7:25816297-25816319 CTGTAAGCCCAGCTACTTGAAGG + Intergenic
1022687554 7:32610666-32610688 CTGTAATCCCAGCTAGAGGCAGG + Intergenic
1022993247 7:35728905-35728927 TACAAAGCCCAGATAGAGGATGG + Intergenic
1023507716 7:40917989-40918011 CTGAAGGCCTAGATATAGGAGGG + Intergenic
1023633421 7:42185144-42185166 CAGTCAGTCCAGGTAGAGGAGGG - Intronic
1023751325 7:43375768-43375790 CTGTAATCCCAGCTACTGGAGGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1026145424 7:67742441-67742463 GTGTAAGCCCTGGTACAGGATGG + Intergenic
1026768946 7:73181158-73181180 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1027009815 7:74734542-74734564 CTGTAATCCCAGCTACAGGGAGG - Intronic
1027078227 7:75211496-75211518 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1027149919 7:75725941-75725963 CTGTAATCCCAGCTACAGGGAGG - Intronic
1027195438 7:76026936-76026958 CTGTAATCCCAGCTACAGGCTGG + Intronic
1027373549 7:77532096-77532118 CTGTAAGCCCAGCTACTGGGAGG + Intergenic
1029053772 7:97718115-97718137 CTGTAATCCCAGCTAAAGGGAGG + Intergenic
1029602717 7:101578557-101578579 CTGTAGTCCCAGATACTGGAAGG + Intergenic
1029972431 7:104802369-104802391 CTGTAATCCCAGATACTGGTGGG + Intronic
1030190769 7:106808116-106808138 CTGTAATCCCAGATACTTGAGGG - Intergenic
1030574498 7:111268854-111268876 CTGTAATCCCAGGTATTGGAAGG - Intronic
1032675485 7:134126405-134126427 CTGTAAGGCCAGAAGGATGAGGG + Intergenic
1032714823 7:134498570-134498592 CACTAAGACCAGAAAGAGGATGG - Intergenic
1033105368 7:138516475-138516497 CTGTAATCCCAGTTACAGGCAGG - Intronic
1035819988 8:2580585-2580607 CTGTAAACCCACATAGGGGAAGG - Intergenic
1036048128 8:5166729-5166751 CTGCAGGCCCAAATAGAAGATGG - Intergenic
1038184189 8:25258092-25258114 CTGGAAGCTCAGTGAGAGGAAGG - Intronic
1038278634 8:26142816-26142838 CTGTAAGCACAGAGAGGTGAAGG + Intergenic
1038650895 8:29402283-29402305 CTGTGAGCCCCGACAGAGGTAGG - Intergenic
1038893657 8:31756115-31756137 GTGTAAGCCTACATAGGGGAGGG - Intronic
1038948642 8:32389880-32389902 CTGTAACCCCAGTTATTGGAAGG - Intronic
1038991956 8:32877837-32877859 ATGTAAGCTCAGTTAGAGCAGGG + Intergenic
1039473330 8:37826901-37826923 CCCTCAGCCCAGATGGAGGAGGG - Intronic
1040521549 8:48180593-48180615 CTGCAGGCTCAGGTAGAGGAAGG - Intergenic
1041862407 8:62529557-62529579 CTGTAAGCTCATATGGTGGAAGG - Intronic
1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG + Intronic
1042849891 8:73206161-73206183 CTGCAATCCCAGCAAGAGGAGGG - Intergenic
1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG + Intergenic
1045548346 8:103148305-103148327 CTGGAAGCTCAGAGAGAGGCAGG + Intronic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1045791103 8:105985655-105985677 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1047495054 8:125403373-125403395 ATCTAAGCCCGGATAGAGGCTGG + Intergenic
1047668503 8:127118994-127119016 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1047718071 8:127613966-127613988 CTGTAATCCCAGCTACAGGGTGG + Intergenic
1048745387 8:137609279-137609301 CTGTAATCCCAGCTACAGGCAGG - Intergenic
1048841687 8:138572348-138572370 CTGTAACCTCATATGGAGGAGGG + Intergenic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1052446161 9:28564443-28564465 CTGTAATCTAAGATAGAGGTAGG - Intronic
1053000914 9:34577004-34577026 CTGTCAGCCCACAGAGAGGTAGG + Intronic
1053482372 9:38424916-38424938 CTGGAAGCCGAGTTGGAGGATGG - Intergenic
1055368278 9:75569656-75569678 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1055589987 9:77802268-77802290 CTGTGAGCCCAGAGTGAGGGGGG - Intronic
1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG + Intergenic
1057210178 9:93196882-93196904 CTGCAGGCCCAGGCAGAGGAGGG - Intronic
1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG + Intergenic
1060427569 9:123519325-123519347 CTGTTAGGCTAGAGAGAGGAGGG - Intronic
1060642308 9:125249321-125249343 CTGTAATCCCAGCTACAGGTTGG - Intergenic
1061082680 9:128381571-128381593 CTGTAATCCCAGGTTGAGGCAGG + Intronic
1185870623 X:3662177-3662199 CTGTAAGACCAGGTAGAAGGTGG + Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1188317303 X:28690321-28690343 CTGAGAGGCCAAATAGAGGATGG - Intronic
1190087033 X:47404285-47404307 CTGTAATCCCAGCTACAGGGAGG - Intronic
1192081299 X:68050351-68050373 CTGGAAGCCCAGACATAGGGTGG + Intronic
1192543032 X:71991099-71991121 CACGAAGCCCAGAAAGAGGAAGG - Intergenic
1192796970 X:74431997-74432019 CTGAGAGCCCAGGGAGAGGAGGG + Intronic
1193212881 X:78828269-78828291 CTGAAAGCCAAGGTAGAGAAAGG - Intergenic
1194339001 X:92686297-92686319 CTGTAAGTCCAGAGAGAGCAAGG + Intergenic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1197928639 X:131672955-131672977 CTGTAATCCCAGCTAGTGGGGGG + Intergenic
1199543302 X:148981449-148981471 GAACAAGCCCAGATAGAGGAAGG - Intronic
1200647394 Y:5803080-5803102 CTGTAAGTCCAGAGAGAGCAAGG + Intergenic
1200794521 Y:7328615-7328637 CTGTAATCCCAGGCCGAGGAGGG - Intergenic