ID: 1149875302

View in Genome Browser
Species Human (GRCh38)
Location 17:60226727-60226749
Sequence GTGTATGTACATAGAGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149875302 Original CRISPR GTGTATGTACATAGAGTGAA GGG Intronic
902787832 1:18744738-18744760 ATGGGTGTAGATAGAGTGAATGG + Intronic
903234428 1:21940373-21940395 CTGTATGTACACAGAGTTCAGGG + Intergenic
907022075 1:51077621-51077643 GTTTATGTAAGCAGAGTGAAAGG + Intergenic
907622906 1:56000264-56000286 GTAAATGTACATGGAGTTAATGG + Intergenic
912029636 1:105223933-105223955 GTGTGAGTACATAGAGAGAAAGG - Intergenic
912179686 1:107204799-107204821 GGGTATGTACAGAGATTGCAGGG - Intronic
913250928 1:116911069-116911091 GTGTCTGTGTATGGAGTGAATGG - Intronic
914935983 1:151980672-151980694 GTGTATGTGTATTGAGGGAAAGG - Intergenic
916306650 1:163342676-163342698 ATGTATGTATATAGAGAGAGGGG + Intronic
917587606 1:176443720-176443742 GTGTGTGTTGATAGAGAGAAGGG + Intergenic
917822924 1:178783826-178783848 GTGGCTATACATAGAATGAAAGG - Intronic
918219380 1:182422248-182422270 GTGTATGTAGATATTGTAAATGG + Intergenic
919821255 1:201473651-201473673 GTGTATGTACATCTATGGAAGGG - Intergenic
921253269 1:213317156-213317178 GTGTATGTAAATTGAGATAATGG + Intergenic
924595121 1:245438524-245438546 TGGTATATACCTAGAGTGAAAGG - Intronic
1062936042 10:1390776-1390798 CTGCATCTACATAAAGTGAAGGG + Intronic
1065579756 10:27158896-27158918 GTATATGTACATAGAGAGACAGG + Intronic
1065860297 10:29867011-29867033 GTTTATTTCCCTAGAGTGAAGGG - Intergenic
1070423939 10:76266786-76266808 GTATATTTACATACATTGAATGG + Intronic
1070697639 10:78574671-78574693 CTGTATTTACATAGAGAGCAAGG + Intergenic
1071119847 10:82264576-82264598 GTATGTGTACATGGAGTAAAGGG + Intronic
1073994340 10:109298153-109298175 CTGCCTGTACAGAGAGTGAAAGG - Intergenic
1074970780 10:118534766-118534788 GTGTGTTTAAATAGAGTGAGTGG - Intergenic
1078669846 11:13355039-13355061 GTGTTTGTACATATATAGAAGGG - Intronic
1079427955 11:20362006-20362028 GTGTGTGTACATAAAATGAAGGG + Intergenic
1081228058 11:40549776-40549798 GTGAAAATACATACAGTGAAAGG + Intronic
1081400871 11:42641339-42641361 ATGTTTGTAGATAGAGGGAAGGG - Intergenic
1082144572 11:48651065-48651087 GTGTTTGTCCATTCAGTGAATGG + Intergenic
1082597043 11:55095284-55095306 GTTTTTGTAGAAAGAGTGAAGGG + Intergenic
1088488918 11:110368303-110368325 GTGAATGAACAGAGCGTGAACGG + Intergenic
1091924398 12:4333201-4333223 GAGTATACACAAAGAGTGAAAGG - Intronic
1093971208 12:25377611-25377633 GTGTATGCACATAATGTGAGTGG - Intergenic
1094297912 12:28928532-28928554 GTGTCTGTGGATACAGTGAAGGG + Intergenic
1098254640 12:68604708-68604730 ATGTATGTATATATAGTGTATGG - Intergenic
1099618064 12:84964390-84964412 GTGTATGTATATGGAGAGAGAGG - Intergenic
1100459749 12:94787695-94787717 TGGTATGTACATACAGTGGAAGG + Intergenic
1102663452 12:114549398-114549420 GTGTATGTAAAGTAAGTGAAGGG + Intergenic
1102671931 12:114627216-114627238 GTGTAGGTATATAGAGAGATAGG - Intergenic
1104182331 12:126394248-126394270 ATGTCCGTACATAGAATGAAAGG + Intergenic
1104185859 12:126430458-126430480 GTGTATATCAATAGAGTGATGGG - Intergenic
1104964276 12:132502020-132502042 CTGTTTGTACAGAGAGTGCATGG + Intronic
1106010017 13:25811448-25811470 GTGTATGTATATACAGTGTATGG + Intronic
1106053324 13:26212368-26212390 GTGCATTTACATGGAGTAAAAGG - Intronic
1106497435 13:30293362-30293384 GTGTATGTGCACAGTGTAAAAGG - Intronic
1106573338 13:30950709-30950731 GTGTATTTCTATAGAGTGAAGGG - Intronic
1107742721 13:43469639-43469661 GTGTATGTTCATATATTGGAAGG + Intronic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1111017765 13:82403419-82403441 GTGTATTCAAATAGAATGAAAGG + Intergenic
1111705878 13:91748936-91748958 GTGTGTGTGAATAGAGAGAAGGG + Intronic
1112899216 13:104338804-104338826 GTGCATGTGCATAGTGTGCATGG - Intergenic
1115939354 14:38591138-38591160 GTGTGTGTACATTGAGGGAAGGG - Intergenic
1119761041 14:77152058-77152080 GGGCATGTTCATAGAGTGGATGG + Intronic
1119887725 14:78157544-78157566 GTGTGTGTACATAAAGAAAACGG - Intergenic
1120694179 14:87625576-87625598 GTTTATGTATATATAGTGGAAGG - Intergenic
1123163742 14:106306005-106306027 GTGTATGTAAAGACAGAGAAGGG + Intergenic
1128121759 15:65153994-65154016 GTGTATGTACATGGAGCTAAGGG + Intronic
1140185096 16:72762435-72762457 GAGTTTCTACAAAGAGTGAAAGG - Intergenic
1143586664 17:7853898-7853920 GTGTATGTACATAGACGTTACGG + Exonic
1149024790 17:52015071-52015093 ATGTATGTACCAAGAGTAAAAGG + Intronic
1149875302 17:60226727-60226749 GTGTATGTACATAGAGTGAAGGG + Intronic
1154390555 18:13932914-13932936 GTGTATGCACAGTGAGGGAAAGG - Intergenic
1158795007 18:60835117-60835139 TTGTATGTAAATATAGTGCAAGG + Intergenic
1158798591 18:60878565-60878587 GTGTATATACATAGAGAAGATGG + Intergenic
1160542517 18:79632417-79632439 GTGTATGTACACAGGGAGACAGG + Intergenic
1167589455 19:50395689-50395711 GTGTACGTATACAGAGAGAAGGG - Intronic
925613986 2:5727924-5727946 GTGTATGCACATAGTTTAAAAGG + Intergenic
927574958 2:24193265-24193287 GTGTATATACATATATTCAAAGG - Intronic
927681114 2:25139794-25139816 ACGGATATACATAGAGTGAAAGG - Intronic
928675504 2:33647156-33647178 GTGTATTTGCATAGAGAGTATGG - Intergenic
929261195 2:39868541-39868563 GCGTATGTCCAAAGAGTAAAAGG + Intergenic
931028038 2:58135823-58135845 GTGTATGCACATAAAATGACAGG - Intronic
931638656 2:64362517-64362539 GTATATGTATAGGGAGTGAATGG - Intergenic
931733605 2:65175162-65175184 GTGTATGTATTTAGAGAGAGAGG - Intergenic
933932274 2:87165561-87165583 GTGAATGCACAAAGAGGGAAGGG - Intergenic
935127454 2:100237112-100237134 ATGTCTGTAGATAGAGTGCAGGG - Intergenic
936360839 2:111799874-111799896 GTGAATGCACAAAGAGGGAAGGG + Intronic
938990021 2:136618170-136618192 GTGTATGTACAGTGAGGAAAAGG - Intergenic
939287501 2:140152317-140152339 GTATATGTACATAGAAGGAGAGG - Intergenic
939886671 2:147688803-147688825 GTGTGTGTAGATAGACTGATAGG - Intergenic
940586694 2:155660944-155660966 GTGTATGGCCATATAGTGTATGG + Intergenic
941297158 2:163753781-163753803 TTTTATGTACATTGAGTGAGTGG + Intergenic
946283048 2:218680280-218680302 CTTTATGTACATTGACTGAAAGG + Intronic
946573713 2:221051563-221051585 GTGTAACTGCAGAGAGTGAAGGG - Intergenic
946816378 2:223582555-223582577 GTGACTGTACTTAGAGTAAAGGG - Intergenic
948116521 2:235497527-235497549 GTGTATGCACATACAGAGGAAGG - Intronic
1170906791 20:20523285-20523307 GTGTATGTGTGTAGAGGGAAGGG + Intronic
1175020660 20:55845345-55845367 ATGTATGTATATAGAGAGAAGGG - Intergenic
1176728940 21:10470196-10470218 GTGTATATACATAACGTGTAGGG - Intergenic
1177209981 21:18059173-18059195 GTGTGTGTACAGAGAGAGAGAGG - Intronic
1179629375 21:42667060-42667082 GTCTGTGTACAGGGAGTGAATGG - Intronic
1183513831 22:38251641-38251663 GTGCCTGTACAGAGTGTGAAAGG - Intronic
1184357909 22:43994870-43994892 TTGTTTGTACTTAGAGTGACAGG + Intronic
949187919 3:1216220-1216242 TTGTATGTACACAGATGGAAAGG - Intronic
949383641 3:3474062-3474084 GTGTAAGTAAATAGTGTAAAGGG - Intergenic
952060796 3:29507243-29507265 GTGTATGTACCTAAAGAGTATGG - Intronic
952862499 3:37825447-37825469 GCATGTATACATAGAGTGAACGG - Intergenic
958723988 3:97881362-97881384 ATTTATGCAAATAGAGTGAATGG + Intronic
958951650 3:100423617-100423639 GTGTATTCTCATAAAGTGAACGG - Intronic
961722612 3:128906729-128906751 GTGAATGAAGAGAGAGTGAAGGG + Intronic
962300520 3:134238361-134238383 GTGTATGTTCATACACAGAAAGG + Intronic
964217960 3:154309262-154309284 GAGTATGTAAATACACTGAATGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965788257 3:172359443-172359465 ATGTTTGTACCTAGAGTAAAGGG + Intronic
966448225 3:180027485-180027507 GTATATATACATAGAGAGAGAGG - Intronic
967358392 3:188600108-188600130 GTGTATGTACATACAAAAAAAGG - Intronic
969133013 4:5005504-5005526 GTATATGTCCATTGGGTGAATGG - Intergenic
970343381 4:15130055-15130077 GTGTATTTACTGAGAGAGAAAGG - Intergenic
970748134 4:19324884-19324906 ATGTATATAAAGAGAGTGAAAGG - Intergenic
971074978 4:23137694-23137716 GTGTGTGTACAGAGAGTGGAAGG + Intergenic
971680716 4:29696459-29696481 GTGTATATGCATAAAGTTAAGGG + Intergenic
972346971 4:38200420-38200442 GTGTAGTTACAAAGAATGAAGGG - Intergenic
972371418 4:38427178-38427200 GTGTATATAAGAAGAGTGAATGG - Intergenic
973305629 4:48645916-48645938 GTGTTTTTACGTAGAGTGCAAGG - Intronic
973756871 4:54083444-54083466 GAGACTGTAGATAGAGTGAATGG - Intronic
974747379 4:66093087-66093109 GTGTATATATATGGAGAGAAAGG + Intergenic
975070154 4:70125198-70125220 GAGTATATATATATAGTGAATGG - Intergenic
977476403 4:97515814-97515836 GTGTATATATATAGAGAGAGAGG + Intronic
978377631 4:108092525-108092547 GTGTGTGCACATAGTGTCAAGGG - Intronic
978445228 4:108773761-108773783 ATGTATGTACAGAAAGTAAAAGG - Intergenic
980901253 4:138907528-138907550 GTGACTGGCCATAGAGTGAATGG - Intergenic
982342623 4:154318723-154318745 ATGTATGTTCATAGAGTGAAAGG + Intronic
982633393 4:157862228-157862250 TTTTATGTAGATAGAGGGAAAGG + Intergenic
983477227 4:168229186-168229208 GTGAATGTCCAAAGTGTGAAAGG + Intronic
984049437 4:174845426-174845448 GTGTAGATAGATAGAGGGAATGG + Intronic
984340441 4:178450129-178450151 GTGAATTTTCAGAGAGTGAAGGG - Intergenic
984624431 4:181989645-181989667 GTCTATGCACATAAAATGAAAGG + Intergenic
985392964 4:189511366-189511388 GTGTATATATATAGAGAGAGAGG - Intergenic
986633787 5:9800597-9800619 GTGCCTGTGTATAGAGTGAAGGG + Intergenic
987504023 5:18746838-18746860 TTATATATACATATAGTGAAAGG - Intergenic
987915238 5:24204356-24204378 TTGTATTTATATATAGTGAAAGG - Intergenic
988126107 5:27039862-27039884 GTGATTGAACATGGAGTGAATGG + Intronic
988300570 5:29420241-29420263 GTGTATATATATAGAGAGAAGGG - Intergenic
990488683 5:56283233-56283255 GTAAATGTACTTACAGTGAAGGG + Intergenic
990503912 5:56425910-56425932 GAGAAAGTACATAGAGTGTATGG - Intergenic
990752770 5:59036368-59036390 GTGTATGTAAAAAGAATGGATGG + Intronic
993037872 5:82777054-82777076 GTATATGTACACAGACTGCATGG + Intergenic
994243220 5:97448316-97448338 GTGTGTGTATAAAGAGAGAAGGG + Intergenic
994658486 5:102624504-102624526 GTGTATATAAACCGAGTGAAGGG + Intergenic
998900700 5:146850506-146850528 GTGTGTGTTCAAAAAGTGAAAGG - Intronic
998924051 5:147102966-147102988 GTATCTGTACATACACTGAATGG + Intergenic
1008188717 6:48427393-48427415 GTTTATGTAAATAGAGTCGATGG - Intergenic
1008351510 6:50497054-50497076 ATGTAGGTACATATAGGGAAAGG - Intergenic
1008866057 6:56211237-56211259 GTATATGTATATATAATGAAAGG + Intronic
1014271617 6:119342871-119342893 CTGTATATACAAAGGGTGAAAGG - Intronic
1016216773 6:141613708-141613730 GTCTATAAACAGAGAGTGAAGGG - Intergenic
1016517778 6:144914798-144914820 ATGTATGTACATACATTTAATGG + Intergenic
1019739043 7:2663740-2663762 GTGAATGGACATAGCGTGAGAGG + Exonic
1020696895 7:11423694-11423716 GTGTATTTAAAAAGAGTGATGGG + Intronic
1024211320 7:47208117-47208139 GTGTGTGTGCATAGAGAGAGAGG + Intergenic
1030239247 7:107302807-107302829 GTGCATGTACAGAGATTGCATGG - Intronic
1030794080 7:113765836-113765858 GTGTATATATATAGAGAGAGAGG - Intergenic
1031213553 7:118861116-118861138 GTGTCTTTACATAGCGTAAAGGG + Intergenic
1031961984 7:127998450-127998472 GACTATGTTCAGAGAGTGAAGGG - Intronic
1032478465 7:132228000-132228022 ATGCATGTACAGAGAGAGAAAGG - Intronic
1032836989 7:135683719-135683741 GTGTATGAACCTAGGGTGAAAGG - Intronic
1033117891 7:138641869-138641891 GTGTATGTATATATAGTCAATGG + Intronic
1033195808 7:139326306-139326328 GTGTGTGTACATATGCTGAATGG - Intergenic
1042230637 8:66550939-66550961 GGATAGGAACATAGAGTGAATGG - Intergenic
1042714507 8:71757960-71757982 GTGTATATATATATAGAGAAAGG - Intergenic
1043268962 8:78304569-78304591 GTGTGTGTAGAGGGAGTGAAGGG + Intergenic
1044060794 8:87632260-87632282 TTGAATATACATAGAGAGAAAGG + Intergenic
1045089356 8:98724458-98724480 GTGTTTGAACATAGTGTGTATGG + Intronic
1046086982 8:109449973-109449995 GTTAATGTACATAAAGTGGATGG + Intronic
1046711634 8:117517598-117517620 GTGTATGTATCTGGAGTGAGGGG + Intergenic
1046989831 8:120440167-120440189 GTAAAGGTATATAGAGTGAAAGG + Intronic
1047951755 8:129940576-129940598 ATTTATGTTCAAAGAGTGAAAGG - Intronic
1048277784 8:133080302-133080324 GTCTAGATACATAGAGTGAGTGG - Intronic
1048712461 8:137227384-137227406 GTATATGTAAATTGGGTGAAGGG + Intergenic
1048923007 8:139247578-139247600 GTGTCTGTACAGAGGGAGAAAGG + Intergenic
1051303310 9:15677655-15677677 CTGTATGAACATATAATGAAAGG - Intronic
1051722082 9:20047665-20047687 GTAAATGTACATAGAGGAAATGG + Intergenic
1052733822 9:32319688-32319710 GTGTATGTACAGTGAGTGAATGG - Intergenic
1054739754 9:68793110-68793132 GTGTATACACATATAGTGTAAGG + Intronic
1054954062 9:70887775-70887797 ATTTATGTACATAGAGGTAAAGG - Intronic
1056771485 9:89480976-89480998 GTGTATGTACTGATAGTGAGAGG - Intronic
1058197371 9:101994793-101994815 GAGTATGCAGATAGAGAGAAAGG - Intergenic
1058279524 9:103096333-103096355 GTGTATATATATAGAGAGAGGGG - Intergenic
1060163185 9:121385849-121385871 CTAAATGTACATAGACTGAAAGG + Intergenic
1062013611 9:134280292-134280314 GTGTCTGTACCTAGGGAGAAAGG - Intergenic
1189115459 X:38337717-38337739 GTGTATGGGAATAGAGTGTAAGG - Intronic
1190391589 X:49937084-49937106 GTAGATGTACATATAGTGACAGG + Intronic
1190770717 X:53511709-53511731 GTGAATCTTCAGAGAGTGAAGGG + Intergenic
1191265420 X:58385997-58386019 GTTTTTGTACATTGTGTGAATGG - Intergenic
1192193388 X:69012226-69012248 GTATATGTACTAAGAGTGTATGG - Intergenic
1196293798 X:113976663-113976685 GTGAATCTTCAGAGAGTGAAGGG + Intergenic