ID: 1149877400

View in Genome Browser
Species Human (GRCh38)
Location 17:60249632-60249654
Sequence GAGGAAATGAAAGCTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149877396_1149877400 -1 Left 1149877396 17:60249610-60249632 CCCATGCAGACTTGCTGGATGGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1149877400 17:60249632-60249654 GAGGAAATGAAAGCTGCTCCTGG 0: 1
1: 0
2: 1
3: 29
4: 236
1149877393_1149877400 26 Left 1149877393 17:60249583-60249605 CCTTCAAATCATGAATCAGACTG 0: 1
1: 0
2: 0
3: 20
4: 153
Right 1149877400 17:60249632-60249654 GAGGAAATGAAAGCTGCTCCTGG 0: 1
1: 0
2: 1
3: 29
4: 236
1149877398_1149877400 -2 Left 1149877398 17:60249611-60249633 CCATGCAGACTTGCTGGATGGGA 0: 1
1: 1
2: 0
3: 18
4: 183
Right 1149877400 17:60249632-60249654 GAGGAAATGAAAGCTGCTCCTGG 0: 1
1: 0
2: 1
3: 29
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149877400 Original CRISPR GAGGAAATGAAAGCTGCTCC TGG Intronic
901576844 1:10208231-10208253 AAGGCAAAGAAGGCTGCTCCAGG - Intergenic
903136933 1:21315491-21315513 TAGGCATTAAAAGCTGCTCCTGG + Intronic
904269888 1:29343044-29343066 GAAGAAATGAAAGTGGCTCGAGG - Intergenic
904785669 1:32980752-32980774 GAGGAAGTGAGAGCTCATCCAGG + Intergenic
905786903 1:40765658-40765680 GAGGAAATGAAAGGGGTTCTGGG - Intronic
906310490 1:44750542-44750564 GAGGAACTGAAAACTGCTTGCGG - Exonic
907595557 1:55716400-55716422 GAGCAAATGGAAACTGCTCCTGG - Intergenic
907606719 1:55825627-55825649 AATGAAATGAAAGCTGCTCAAGG - Intergenic
907752107 1:57272601-57272623 GAGGATTTGGAACCTGCTCCAGG + Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
908658418 1:66412739-66412761 TATGGAATGAAAGCTGCTACAGG - Intergenic
909014239 1:70366023-70366045 GAGTAAAACCAAGCTGCTCCCGG + Intronic
909481508 1:76132321-76132343 GAGGGAAGGCAAGCTGCTGCTGG - Intronic
909713417 1:78678275-78678297 CAGAAAATGAAAGCAACTCCGGG + Intergenic
913031115 1:114903525-114903547 GATGAAGTGAAAGATGCTGCTGG + Intronic
918051534 1:180977078-180977100 AAGGAGATGAAAGCTACTGCTGG + Intronic
918667700 1:187172287-187172309 CAGGAAGTGACAGCTGCTGCAGG - Intergenic
920550225 1:206854537-206854559 GAGGAAAGTACAGCTGCTCTGGG - Intergenic
922274470 1:224064371-224064393 AAGGAAAAGAAAGCGGATCCAGG + Intergenic
922518482 1:226225473-226225495 GAGAAAATAAAAGCTGCTTTTGG - Exonic
924289682 1:242524584-242524606 GAGGGAAAGGAACCTGCTCCGGG + Intronic
1064723474 10:18253463-18253485 GAGGAAATCAAAATTGCTGCTGG + Intronic
1064866734 10:19889123-19889145 GAGGAAATGAATACTAGTCCTGG - Intronic
1066383171 10:34918762-34918784 GAGGACTTCACAGCTGCTCCGGG + Intergenic
1067383297 10:45795062-45795084 GAGCAAATGGAAGCTGCAGCAGG - Intergenic
1067891002 10:50135630-50135652 GAGCAAATGGAAGCTGCAGCAGG - Intergenic
1068468071 10:57421060-57421082 CAGAAAATGAAAGCTCCTCATGG - Intergenic
1069849254 10:71394505-71394527 GAGGACATGTAAGCTTCACCAGG + Intergenic
1070708711 10:78660996-78661018 GAGGAAATCAGAGTTGATCCAGG - Intergenic
1073140529 10:101244273-101244295 GAGGTTAGGTAAGCTGCTCCAGG + Intergenic
1075651667 10:124131539-124131561 GAGGAAATCAAAGCTGAAGCAGG - Intergenic
1075764464 10:124881737-124881759 GTTGAAATAAAAGCTGCTCCTGG - Intergenic
1078720463 11:13879342-13879364 GAGGAAATGTGTGCTGCTCAGGG + Intergenic
1081242099 11:40719550-40719572 GAGGAAAGCAAAGCTGCTTTTGG + Intronic
1083315661 11:61813663-61813685 AAGGGAATAAAAGCTGCTCCCGG + Intronic
1083379524 11:62253944-62253966 GAGGGAATCAATGCTTCTCCTGG - Intergenic
1085180392 11:74530608-74530630 GCAGAAATGAAAGTTGCTCTAGG - Intronic
1085231339 11:74973694-74973716 GAAGATATGAAAGATCCTCCAGG - Intronic
1085530224 11:77187981-77188003 GAGGAAAAGGCAGCTGCTGCAGG + Intronic
1085742628 11:79090076-79090098 GAGGAAATTAAGCCTGCACCAGG + Intronic
1085772820 11:79340125-79340147 TAGGACATGAAAGTTGGTCCAGG - Intronic
1088133918 11:106530311-106530333 GTAGAATTGAAAGATGCTCCTGG + Intergenic
1088990706 11:114950910-114950932 GAGGAAAAGAAATCTCCTTCTGG - Intergenic
1090650038 11:128798618-128798640 GAGCAAAGGAAACCTGATCCAGG + Intronic
1090670305 11:128941138-128941160 GAGGAAATGGGACTTGCTCCAGG + Intronic
1092743177 12:11649578-11649600 GGGGAAATAAAAGCTGCGCGGGG - Intergenic
1093767661 12:22982986-22983008 GAGGAGTTGAAAGCTGCAGCTGG + Intergenic
1094592708 12:31836644-31836666 GAGGAAATGAGAGTTGCCCTTGG + Intergenic
1094795409 12:33966129-33966151 GAGGATGTGAGAGCAGCTCCTGG - Intergenic
1095108049 12:38259233-38259255 GAGGATGTGAGAGCAGCTCCCGG - Intergenic
1096531387 12:52244746-52244768 GAGAAAGTGGCAGCTGCTCCAGG + Intronic
1098366238 12:69706181-69706203 GAGGAAATGAGAGCAGGTCATGG - Intergenic
1101899735 12:108782499-108782521 GAAGAAATGATAGTTCCTCCTGG - Intergenic
1102609343 12:114097702-114097724 AAGGAAATCCAACCTGCTCCAGG + Intergenic
1102652139 12:114449513-114449535 GAGGAATTGGAAGATGCGCCTGG + Intergenic
1102707895 12:114898042-114898064 GTTGGAAGGAAAGCTGCTCCTGG + Intergenic
1103910610 12:124350046-124350068 GTGGAGATGAAAGCTGCTAATGG - Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1106408573 13:29495409-29495431 GAGGAAAAGAAACCTACTCAGGG + Intronic
1108682904 13:52794543-52794565 GAGGAGGTGTAAGCTGCCCCAGG - Intergenic
1108879967 13:55100926-55100948 GTGGAAATGCAAGATGATCCAGG + Intergenic
1109304690 13:60625641-60625663 GAGGAAATTGAGGCTGCTCAAGG + Intergenic
1111395790 13:87668379-87668401 GAGAAAATGAAAGTTTCTCCTGG - Intergenic
1111775789 13:92659805-92659827 GAGGAAGTGATAGCTGATCTGGG + Intronic
1111895865 13:94140778-94140800 AAAGAAATGAAAGTTGCTCCTGG - Intronic
1113058448 13:106295649-106295671 AAGGAGATGATGGCTGCTCCCGG + Intergenic
1116478899 14:45373872-45373894 GCGGAAATGCAACCTGCTCTGGG - Intergenic
1118012297 14:61622281-61622303 GAGGAAAATAATGCTCCTCCAGG + Intronic
1118708339 14:68500346-68500368 GAGGTAATGGAATCTGCTCAAGG + Intronic
1124353459 15:28977615-28977637 GAGGAACTGGAAGCAGCACCAGG - Intronic
1124969568 15:34473104-34473126 GAGGAAGTGAAAGCTGATCTGGG + Intergenic
1125409951 15:39395692-39395714 AAGGAAAGGAAAGCTGTTCCAGG + Intergenic
1126217876 15:46177371-46177393 GAGGAAAGGAAGGCTTCTCTAGG - Intergenic
1126222109 15:46226018-46226040 GAGGAAAAGGATGGTGCTCCTGG + Intergenic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1129599564 15:76990510-76990532 GAGGAATTGAAAGATGGTCCAGG + Intergenic
1130350678 15:83088996-83089018 AAGGAATTGAAAGAGGCTCCAGG - Intergenic
1131431419 15:92392357-92392379 GGGGAAAAGACATCTGCTCCTGG + Intergenic
1131629628 15:94162848-94162870 GAGGAAATCAAAGCTTTTCGTGG - Intergenic
1132189728 15:99842407-99842429 GAGGAAGTGATAGCTGATCTGGG - Intergenic
1132241050 15:100257200-100257222 GAGGAAAGGACAGTTTCTCCAGG + Intronic
1132352421 15:101148328-101148350 GAGGTCAAGAAACCTGCTCCAGG - Intergenic
1132710286 16:1263317-1263339 AAGGAAGAGAAAGCAGCTCCGGG - Intergenic
1132861466 16:2073761-2073783 TGGGAAATGGAAGCTGTTCCCGG + Intronic
1133088506 16:3384674-3384696 GAGGAAATGAATGCTCTTTCAGG - Exonic
1133585291 16:7188674-7188696 GAATAAATGAAACCTGCTGCAGG - Intronic
1136130356 16:28216510-28216532 GAGGAATTGAAAGCAACTCCAGG - Intergenic
1136577728 16:31134316-31134338 GAGGAAGCGAAAGCCCCTCCAGG - Intronic
1140820445 16:78658114-78658136 GAGGAAATAGAAGATGCTACTGG - Intronic
1140880855 16:79196911-79196933 AAGGAATTGAAAGATGCTCAGGG - Intronic
1141073640 16:80981636-80981658 GAAGAAATGAAAGCTTTTCTGGG - Intronic
1141661322 16:85443179-85443201 GAGGAAATGGGGGCTGCACCGGG - Intergenic
1141695500 16:85617237-85617259 GGGGAAGTGAGAGCTGCCCCCGG + Intronic
1142622241 17:1172447-1172469 TAAGAAATGCAAGCTACTCCTGG + Intronic
1143280694 17:5752084-5752106 GAGGCAATGAAGGCTGGGCCAGG + Intergenic
1143332829 17:6150068-6150090 GAGGAAGGTCAAGCTGCTCCAGG - Intergenic
1143768891 17:9155319-9155341 AAGAAAAAGAAAGCTGCTCCAGG - Intronic
1143768939 17:9155643-9155665 GAGGCTTAGAAAGCTGCTCCAGG - Intronic
1147474776 17:40700319-40700341 GTAGAAATGAATGCTGCGCCAGG - Exonic
1147486533 17:40820359-40820381 GTGGAAATGAATGCTGCCCCGGG - Exonic
1147608688 17:41788611-41788633 GATGACATGAATGCTGCTCGTGG + Intergenic
1148151469 17:45398817-45398839 GAGGATTTGAAAGCTGATCATGG + Intronic
1148244933 17:46024512-46024534 GAGGCTCTGAAAGCTGCTTCTGG + Exonic
1149641939 17:58208463-58208485 AAGGGAATGAGATCTGCTCCTGG - Intronic
1149877400 17:60249632-60249654 GAGGAAATGAAAGCTGCTCCTGG + Intronic
1149988142 17:61364003-61364025 GAGGACAGCAAAGGTGCTCCTGG - Intronic
1150277808 17:63910987-63911009 GAGAAAAAGAAAACAGCTCCTGG - Intronic
1151691581 17:75689456-75689478 TAGGAAAGGAAGGCTGCTCCTGG - Intronic
1151961778 17:77409431-77409453 GAGGAAAGGAGGGCTGGTCCGGG + Intronic
1153757453 18:8298765-8298787 GTGGTTATAAAAGCTGCTCCTGG - Intronic
1154148571 18:11887131-11887153 GTGGGATTGAAAGCTGCTCTGGG - Intronic
1155912294 18:31517891-31517913 GAGGAAAAGTAAGCAGGTCCTGG + Intronic
1156476067 18:37406190-37406212 GAGTAAAGGAAAGCTGTCCCTGG + Intronic
1158572281 18:58606755-58606777 GAGAAAATGAGAACTGCTCAGGG - Intronic
1159320483 18:66840825-66840847 GAGGAAATAAAATCTTTTCCAGG + Intergenic
1159659519 18:71076730-71076752 GAGCAAATCATAGCTGCTCTGGG - Intergenic
1160414759 18:78700808-78700830 GAGGAAAGCAAAGGTGGTCCTGG - Intergenic
1161312666 19:3603586-3603608 GAGGGACTGGAAGTTGCTCCAGG - Intronic
1162243982 19:9383508-9383530 GAGAAAAAGTAAGTTGCTCCTGG - Intergenic
1163324804 19:16596594-16596616 GAAGGAATGTAACCTGCTCCAGG - Intronic
1165301295 19:34971064-34971086 AAGGAATTGAAAGCAGCTTCAGG - Intergenic
1167654385 19:50754022-50754044 GAGGAAAGAAAAGGTGTTCCAGG + Intergenic
1167656077 19:50765169-50765191 GAGGAAAGAAAGGGTGCTCCAGG + Intergenic
925470006 2:4150709-4150731 GGGGAGATGAAAGCAGCCCCAGG + Intergenic
925785874 2:7431123-7431145 GAGGAAATGCAAGCTGCCCCGGG - Intergenic
926975991 2:18517268-18517290 GAGGACATGGTAGCTCCTCCAGG + Intergenic
927487363 2:23497653-23497675 GAGGCAGGGAAAGATGCTCCTGG - Intronic
927646185 2:24878491-24878513 GAGCAAGAGAAAGCTGCTCAGGG + Intronic
928186982 2:29119358-29119380 AAGGAAATGAAAGGTGCTCTGGG + Intronic
929186444 2:39100317-39100339 AAGGAAATGAAATCAGCACCTGG + Intronic
929961695 2:46501908-46501930 GAGGAAATGATAACTGCAACAGG + Intronic
931790776 2:65662117-65662139 GCCGTAATGAAAGCTGCTCTGGG - Intergenic
932758921 2:74426839-74426861 GAGAAAATGAAAGCGGTGCCAGG + Intronic
933541147 2:83644176-83644198 GAGGAAAAGAAGGATTCTCCTGG - Intergenic
933726696 2:85431116-85431138 GAGGAAATGGAGGCTGGTCGGGG + Intronic
934061328 2:88296920-88296942 GAGGACATGGAGGCTGCTGCTGG - Intergenic
934732564 2:96668832-96668854 GAAGAAATGAGAGCTGGGCCGGG + Intergenic
934779003 2:96957287-96957309 GAGGAAATGAAAGATGACCCAGG + Intronic
935064130 2:99633465-99633487 CAGGAAAGGAAAACAGCTCCAGG + Intronic
935283840 2:101545800-101545822 GGGGAAATGGAAGCAGCCCCAGG + Intergenic
935409858 2:102750476-102750498 GAGGAAATAAAAGATGATTCTGG - Intronic
937939051 2:127270969-127270991 GAGGAGCTGGAAGCTGCTTCTGG - Intronic
941088921 2:161151204-161151226 GTGGATATGAAATCTTCTCCAGG - Intronic
941621625 2:167785386-167785408 AAGGAGAATAAAGCTGCTCCTGG - Intergenic
943756292 2:191560684-191560706 GAGGACATGAAATGTCCTCCGGG - Intergenic
946248250 2:218399104-218399126 GAGGAAATGCCACCTTCTCCAGG - Intronic
946353838 2:219172657-219172679 GAGGAAGTGAAAGGAGCACCGGG + Exonic
948149965 2:235737438-235737460 GAGGCAATGAAAGTTGGGCCTGG + Intronic
948242319 2:236447863-236447885 GAGCAAATGAAAGCTGGCCAGGG + Intronic
948477047 2:238227040-238227062 TAGGAAATTTTAGCTGCTCCTGG - Intronic
1169494642 20:6102941-6102963 AAGATACTGAAAGCTGCTCCTGG - Intronic
1169757743 20:9061601-9061623 AAGGAAAAGAAAACTGGTCCTGG - Intergenic
1172342978 20:34173367-34173389 GGGAAAATGTAAGCTGTTCCTGG - Intergenic
1173752722 20:45489554-45489576 AAGGACATGAAGGCTGTTCCTGG - Intergenic
1174170590 20:48615860-48615882 GAGTAAATGAAAGCTCACCCTGG - Intergenic
1174388035 20:50198397-50198419 GAGGGAATGAAATAGGCTCCTGG + Intergenic
1174717738 20:52777872-52777894 GAGGTAATGAAAACTGATCTGGG + Intergenic
1175162786 20:57021364-57021386 GAGGAATTGAGAGATGCTGCGGG + Intergenic
1178624084 21:34201253-34201275 GAGTGAATGAACGCTGTTCCCGG - Intergenic
1180053438 21:45344479-45344501 GAGCAAACTAAAGCTGCTCCTGG + Intergenic
1181859200 22:25805233-25805255 GAGGAAACTGAAGCTCCTCCAGG + Intronic
1182095167 22:27621085-27621107 GAGGGAAAGAATGGTGCTCCAGG - Intergenic
1183846103 22:40541519-40541541 CAGGAAATGGAAGCTGCCTCAGG - Intronic
1183984396 22:41561647-41561669 CAGGATAAGACAGCTGCTCCAGG - Intronic
1184551191 22:45205013-45205035 GAGGAAACGGAGGCTGCGCCGGG + Intronic
1184757401 22:46524835-46524857 GAGGAAACGAAAACGGCTCCTGG + Intronic
950610010 3:14120463-14120485 GAGGGAAGGGAAGGTGCTCCTGG - Intronic
950663135 3:14479322-14479344 GAGGGGAGGAAGGCTGCTCCAGG + Intronic
952257089 3:31705014-31705036 GAGGAAATTAAGGCTGGTGCAGG + Intronic
953778528 3:45844187-45844209 GAGGAATGGAAAGCTGATCATGG + Intronic
953966902 3:47315173-47315195 GAGGAACTGAAAGTGCCTCCCGG + Intronic
955967994 3:64408712-64408734 AAAGAAAAGAAAGCTGCTCGAGG + Intronic
961586160 3:127927481-127927503 TAGAAAATGAAGGCTACTCCTGG + Intronic
962739617 3:138353574-138353596 GAAGAAAGTAAAGCTGCTCATGG - Intronic
963276061 3:143331156-143331178 GAGTAAATGAAAAATGCTCAGGG - Intronic
966860793 3:184230095-184230117 GTGGAGATGGAAGATGCTCCGGG - Intronic
967897358 3:194408842-194408864 GAGAAAATAAAAGGTGCTACAGG + Intronic
969042055 4:4306845-4306867 GATCAGATGGAAGCTGCTCCAGG + Intronic
971501866 4:27326954-27326976 AAGGAAATGCTAGCTGCTGCAGG - Intergenic
973611810 4:52643152-52643174 GAGGAGATGGAGGGTGCTCCAGG - Intronic
974810780 4:66943267-66943289 AAGGAAATGAAACTTACTCCTGG + Intergenic
982120349 4:152137411-152137433 GAGGAAATGAAAGCTCTTTTGGG - Intergenic
983290142 4:165792027-165792049 CTTGAAATGAAATCTGCTCCTGG - Intergenic
985992233 5:3572854-3572876 GAGGAAAGGATACCTGCTGCTGG + Intergenic
986147170 5:5089210-5089232 GAAGAAAGGAGAGCAGCTCCAGG + Intergenic
987571788 5:19673116-19673138 GAGGAAATGAGAGATAATCCAGG + Intronic
992863054 5:80931554-80931576 GAGAAAATGAAACATACTCCAGG + Intergenic
993181429 5:84558532-84558554 GAGGAAATGAAGGTTGGTCACGG - Intergenic
993680969 5:90877311-90877333 GAGGAAAGGAGAGCTACTCCTGG + Intronic
995454017 5:112333208-112333230 CAAGAAATGAAACCTGCTCAGGG - Intronic
996713303 5:126565031-126565053 GAGAAGATGAAATCTGCTCGTGG + Intronic
997398123 5:133580835-133580857 TAGTAAATGGAAGCTGCTACTGG - Intronic
997638849 5:135435397-135435419 GAGGAAATGAAGGCTGAACTGGG + Intergenic
997791724 5:136768028-136768050 GAAGAAATCAAGGCTGCTGCTGG + Intergenic
998430626 5:142066669-142066691 GTGAAAATGAAAGATGCTCTTGG - Intergenic
998892651 5:146763230-146763252 GAGGAAATGGAAATAGCTCCAGG + Intronic
999291269 5:150428027-150428049 GAGGAAAGGAAAGTTGTTTCTGG + Intergenic
1000936473 5:167307968-167307990 AAGGAGCTGAAAGCTGCACCAGG - Intronic
1001175753 5:169467536-169467558 AAGGAAGTGAAGGCAGCTCCAGG + Intergenic
1001545427 5:172568001-172568023 GAGGAGATGCAAGCTGGACCAGG + Intergenic
1002021759 5:176368151-176368173 GAGGAAAAGAAAGGTGATCCAGG + Intronic
1002285938 5:178162756-178162778 CAGGATCTGAACGCTGCTCCCGG + Intergenic
1002616947 5:180461825-180461847 GTGGAAATGAAGGATGCTCCAGG + Intergenic
1002663331 5:180805329-180805351 AAGGAAGTGAAAACTGTTCCAGG + Intronic
1003096815 6:3148633-3148655 GAGGAGCTGAAAGCAGCACCTGG - Intronic
1003668711 6:8135502-8135524 GATGAAAACACAGCTGCTCCTGG - Intergenic
1004444144 6:15682479-15682501 GAGAAAATGTAAGGTTCTCCAGG - Intergenic
1005135339 6:22563238-22563260 TTGGAAATGAAAGCTGCTCTAGG + Intergenic
1006502713 6:34468556-34468578 GAGGAACTGAAAGTAGCTCAGGG - Intronic
1008871521 6:56277976-56277998 CAGCAAATGAAAGATGTTCCAGG - Intronic
1010325433 6:74557391-74557413 GAGCAAATGAATGCATCTCCTGG - Intergenic
1011471304 6:87710442-87710464 GGGGTTAGGAAAGCTGCTCCTGG - Intergenic
1011981032 6:93378292-93378314 GAGGAAAAGAAAGCTACTGAAGG + Intronic
1012419319 6:99045692-99045714 GTTGAAATAAAAGCTGCTCCTGG + Intergenic
1013782155 6:113740959-113740981 GAAGAAATGAATGCTGCCCCTGG - Intergenic
1014100963 6:117511202-117511224 GAAGAAATGGAAACTTCTCCAGG + Intronic
1015135921 6:129870423-129870445 GAGGGAAAAGAAGCTGCTCCAGG + Intergenic
1015344342 6:132138282-132138304 GATGAAATGAAACCTGTTTCAGG - Intergenic
1015731006 6:136348301-136348323 GGGGAAATGAAATCTGATACTGG - Intronic
1016376208 6:143423127-143423149 GAGAAAATGTTAGCTGCCCCTGG - Intronic
1017738277 6:157382132-157382154 GAGGAAATGGGAGGTGTTCCCGG + Exonic
1017865478 6:158439490-158439512 GAGGAAGTGAGAGCTGCTCTGGG - Intronic
1017879725 6:158552551-158552573 GAGGAAAAGATTGCTGCTTCAGG + Intronic
1019193766 6:170269205-170269227 GTGGGAATGAAAGCTGCTTAGGG - Intergenic
1020225582 7:6277178-6277200 GGGGAGATGAGAGCTGCTCCAGG - Intergenic
1021340391 7:19457196-19457218 GGGGCAGTGAAAGCTGCTCTGGG - Intergenic
1023611515 7:41976587-41976609 GATGAAATGACAGCCACTCCAGG + Intronic
1023743431 7:43301322-43301344 GAGGACATGGAAGCTGGACCTGG - Intronic
1024439432 7:49398799-49398821 AAGGAAAGGAAAGCTGCTTTGGG + Intergenic
1032447760 7:131999330-131999352 GAGGAAAGAGTAGCTGCTCCTGG + Intergenic
1033258895 7:139825313-139825335 GAAGAAATGAGAGATGCTCGGGG - Intronic
1033849029 7:145471862-145471884 GAAGAAATGACAGATGGTCCAGG - Intergenic
1034445548 7:151112247-151112269 GAGGAAGAGAAAGCTGTTCTGGG + Intronic
1038422745 8:27443820-27443842 GAGGAGATGAACGCTGAGCCAGG - Intronic
1038579154 8:28732203-28732225 GAGTAGATGAAGGCTACTCCAGG + Intronic
1039763265 8:40600763-40600785 GAGGAAATGAGTGCTTCTCCTGG - Intronic
1039949155 8:42153875-42153897 GAGGAATGGAAAGCTGCCCTTGG - Intronic
1041600151 8:59707362-59707384 GAGGAAGCAAAAGCTGCTCCAGG - Intergenic
1043219616 8:77643306-77643328 GAGGGACTGAAAGTTGCTCTGGG - Intergenic
1043603724 8:81973580-81973602 GTTGAAATGGAATCTGCTCCTGG + Intergenic
1043758040 8:84029350-84029372 GAGGACATCAAAGTTTCTCCTGG + Intergenic
1045163599 8:99577932-99577954 GAGTAAATGAAAGCTATACCAGG - Intronic
1045941875 8:107748549-107748571 TAGAAAAGGAAAGCTGATCCCGG - Intergenic
1047270869 8:123357214-123357236 ATGAAAATGAAAGCCGCTCCAGG + Intronic
1052086305 9:24270705-24270727 GAGGAAATGATAACTCCCCCAGG - Intergenic
1052368542 9:27640033-27640055 GAGCAAATGAACACTTCTCCTGG + Intergenic
1052515335 9:29472647-29472669 GCAGAAATGGAAGCTGCCCCAGG + Intergenic
1053362985 9:37502765-37502787 GAGGTAAAGAAAGTTGCTCACGG + Intronic
1053475672 9:38380519-38380541 GAGGCACTGAAAGATGATCCAGG - Intergenic
1056245511 9:84691252-84691274 AAGAAAATGAAAGCTACTTCTGG - Intronic
1056494647 9:87144029-87144051 GGGAAACTGAAAGATGCTCCAGG + Intergenic
1057205288 9:93168409-93168431 GAGGAAAAGAGAGCTGCCCAAGG - Intergenic
1057902840 9:98962978-98963000 GGAGAAATGAAAGCTTCTCATGG - Intronic
1058483569 9:105421241-105421263 CAGTAAATGATAGCTGTTCCAGG - Intronic
1060679242 9:125546724-125546746 CAGGAAAGGAAGGGTGCTCCTGG + Intronic
1061125966 9:128675892-128675914 GAGGAAAGGAAAGGTGGGCCAGG + Intergenic
1061934652 9:133850604-133850626 GAGGGAATGAAAGATCCTTCTGG + Intronic
1186334727 X:8574093-8574115 GATAAAATGAAAGGTGCTCTGGG - Intronic
1188610823 X:32095207-32095229 GAGGAAATGGAAGTAGCTCGAGG - Intronic
1189752705 X:44238686-44238708 GAGGAGAGGAAATGTGCTCCAGG - Intronic
1190520222 X:51271596-51271618 GTGGGAATGAAAACTGCTGCAGG + Intergenic
1191211911 X:57893087-57893109 GAGCAAATGTAAGCTGCTCTGGG + Intergenic
1192168406 X:68840154-68840176 GAAGAAATGCAAGCTGGGCCTGG + Intronic
1193451895 X:81680976-81680998 AAGTAAATGAAAACTGCTTCTGG - Intergenic
1197627906 X:128823725-128823747 GGGGATATGAAAGATGCTTCCGG + Intergenic
1201428765 Y:13884139-13884161 GATAAAATGAAAGGTGCTCTGGG + Intergenic
1202074184 Y:21021927-21021949 GAGGAAATCAATGTTTCTCCTGG + Intergenic