ID: 1149881108

View in Genome Browser
Species Human (GRCh38)
Location 17:60291744-60291766
Sequence GTTGGTTTTATACCAACTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149881104_1149881108 -4 Left 1149881104 17:60291725-60291747 CCAATAGCCCATTTACAATGTTG 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1149881108 17:60291744-60291766 GTTGGTTTTATACCAACTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149881108 Original CRISPR GTTGGTTTTATACCAACTAG AGG Intronic
902006872 1:13239105-13239127 GTTGGTTTTATACAGTTTAGGGG + Intergenic
904817365 1:33214984-33215006 TTTGGATGTATACCTACTAGTGG - Intergenic
909568816 1:77085152-77085174 TTTGTTTTTACACAAACTAGTGG - Intergenic
910317872 1:85908393-85908415 ATTGATTGTATACCAAGTAGAGG + Intronic
910373829 1:86547950-86547972 CTTGGATATATACCCACTAGTGG + Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
917010873 1:170469512-170469534 TTTGGTTATATACCAAGTAATGG - Intergenic
923782079 1:237033676-237033698 GTTGGATTTAAACCAAGTAACGG - Intergenic
924304357 1:242671944-242671966 TTTGGGTATATACCAAGTAGTGG - Intergenic
1063191121 10:3695954-3695976 GTTGGTATTTTTCCAACTAAAGG - Intergenic
1065100196 10:22324158-22324180 GTTGGTTTTCTGCAAGCTAGAGG + Intronic
1066190982 10:33056093-33056115 GATGCTTTTATACCATCTTGAGG + Intergenic
1068315634 10:55338125-55338147 AATGGTTTTATCCCAACAAGAGG + Intronic
1068408162 10:56620082-56620104 GTTGGGTATATACCTACTAATGG + Intergenic
1068695246 10:59961217-59961239 TTTGGATATATACCAAGTAGTGG + Intergenic
1071594251 10:86907471-86907493 TTTGGATATATACCAAATAGTGG - Intronic
1072857675 10:98966595-98966617 GTTGCTCTTCTACCAACTAATGG + Intronic
1072900062 10:99399398-99399420 GATGCTTTTATACCATCTTGGGG - Intronic
1074681266 10:115910099-115910121 GTTGCTTTCTTACCACCTAGTGG - Intronic
1080351962 11:31395397-31395419 ATTGGTTTTATACCCAATAATGG + Intronic
1081210796 11:40331268-40331290 TTTGGATGTATACCAAGTAGTGG - Intronic
1085509079 11:77076867-77076889 TTTGGATTTATACCCAGTAGTGG + Intronic
1085931895 11:81093740-81093762 TTTGGATTTATACCCACTAACGG - Intergenic
1086085304 11:82947085-82947107 TTTGGCTATATACCAAGTAGTGG - Intronic
1088342461 11:108784154-108784176 TTTGGTTATATACCCAATAGTGG + Intronic
1089230954 11:116975707-116975729 CTTGGGTTTATACCTACCAGTGG + Intronic
1089270304 11:117297293-117297315 GATGATTTTATACCATCTTGAGG + Intronic
1091040233 11:132271399-132271421 CTTGGTTTTATACCTAGGAGTGG + Intronic
1095422091 12:42034910-42034932 TTTGGTTTTATACCCAGAAGTGG - Intergenic
1095643524 12:44513229-44513251 GTTGGCTTTACACCAGTTAGGGG - Intronic
1097367189 12:58729884-58729906 TTTGGTTATATACCCAGTAGTGG - Intronic
1098080165 12:66775717-66775739 TTTTATTTTATACCAAATAGAGG - Intronic
1099125021 12:78743756-78743778 TTTGGCTATATACCAACTGGTGG + Intergenic
1099602994 12:84765068-84765090 TTTGGATAGATACCAACTAGTGG + Intergenic
1100449726 12:94694425-94694447 CTTGGTTGTATACCTAGTAGTGG + Intergenic
1100693108 12:97060504-97060526 ATTGTTTTTATTCCAACCAGAGG - Intergenic
1101143136 12:101816684-101816706 TTTGGGTTTATACCCAGTAGTGG - Intronic
1101428157 12:104604709-104604731 GTTTGGTTTCTAGCAACTAGAGG - Intronic
1103422743 12:120801389-120801411 GATGCTTTTATACCACCTTGAGG - Intronic
1106234162 13:27847725-27847747 GTTGTTATTTTACCATCTAGTGG + Intergenic
1107171991 13:37354029-37354051 TTAGATTTTATTCCAACTAGAGG - Intergenic
1109140952 13:58713823-58713845 GATGCTTTTATACCATCTTGAGG - Intergenic
1109511182 13:63376592-63376614 GTTGGTTGTATTCCTTCTAGAGG - Intergenic
1110192849 13:72751239-72751261 TTTGGATATATACCTACTAGTGG - Intronic
1111723935 13:91981104-91981126 GTTGGATATATACCTAGTAGTGG + Intronic
1112136950 13:96590188-96590210 TTTGGGTTTATACCTAGTAGTGG + Intronic
1113155160 13:107312062-107312084 TTTGGATTTATACCAAGTAATGG - Intronic
1114592919 14:23884663-23884685 GATGCTTTTATACCATCTTGAGG + Intergenic
1114939836 14:27594890-27594912 TTTGGCTTTATACCCAATAGTGG - Intergenic
1115084306 14:29494824-29494846 ATTGGTTGTCTTCCAACTAGAGG + Intergenic
1115916213 14:38318074-38318096 TTTGGCTCTATACCAAGTAGTGG + Intergenic
1118106155 14:62662180-62662202 TTTGGTTGTATACCCAGTAGTGG - Intergenic
1119816599 14:77574485-77574507 CTTGGGTTTATACTTACTAGTGG - Intronic
1120774138 14:88414127-88414149 GTAGGATTAATACCAACTATTGG + Intronic
1121065172 14:90956740-90956762 TTTGGGTTTATACCAACTTCTGG + Intronic
1121401688 14:93684274-93684296 GTTGGTTTTACTACCACTAGTGG - Intronic
1122018008 14:98813265-98813287 CTTTGTTTTGGACCAACTAGAGG + Intergenic
1122550654 14:102547528-102547550 GTTTGTTTTTTGCCAACTATTGG + Intergenic
1124665457 15:31588011-31588033 GTAGGGATTATACCAACAAGTGG - Intronic
1124704330 15:31949361-31949383 TTTGGTTATATACCCAGTAGTGG + Intergenic
1124957621 15:34369832-34369854 GTTGCTTTTATACCACCTTGAGG + Intergenic
1127575254 15:60285675-60285697 GTTGGTTTTATACAATTTAAGGG + Intergenic
1130293261 15:82623346-82623368 GTTTGTTTTAGAAGAACTAGTGG + Intronic
1135090600 16:19512069-19512091 TTTGGATAGATACCAACTAGTGG + Intronic
1140065729 16:71609709-71609731 GATGCTTTTATACCATCTTGAGG - Intergenic
1141247285 16:82319906-82319928 TTTGGTTGTATACCCAGTAGTGG + Intergenic
1149881108 17:60291744-60291766 GTTGGTTTTATACCAACTAGAGG + Intronic
1153495082 18:5689666-5689688 TTTGGGTATATACCAACTAATGG + Intergenic
1153686620 18:7552588-7552610 TTTGGTTATATACCTACTAATGG + Intergenic
1153722314 18:7918240-7918262 TTTGGATATATACCAAGTAGTGG + Intronic
1155964421 18:32022546-32022568 GATGCTTTTATACCATCTTGAGG + Intronic
1156715112 18:39998627-39998649 GTTGATTTTATACCATCTGTGGG + Intergenic
1156779383 18:40832977-40832999 TTTGGTTGTATACCTAGTAGTGG - Intergenic
1156962272 18:43046725-43046747 GCTGGTTTTATACAGACAAGTGG - Intronic
1159613359 18:70550800-70550822 TTTGGGTATATACCCACTAGGGG - Intergenic
1159714307 18:71802675-71802697 TTTGGGTATATACCAACAAGTGG + Intergenic
1159865962 18:73705585-73705607 TTTGGTTTTATCCTAACTAAAGG - Intergenic
1160486187 18:79295040-79295062 TTTGGTTTTATTCCAGCTATAGG + Intronic
1161019883 19:2004179-2004201 GTTGGTTTTATACATGTTAGGGG - Intronic
1161732205 19:5968099-5968121 GTTGGTGTCACACCACCTAGTGG - Intronic
1164894863 19:31865542-31865564 CTTGGATCTATACCAAGTAGTGG - Intergenic
1168625926 19:57917857-57917879 GTTGGTTTTATACATTTTAGGGG - Intergenic
1202653860 1_KI270707v1_random:31317-31339 TTTGGTTATATACCCACTAATGG - Intergenic
926473522 2:13292504-13292526 TTTGGTTTTATACCTAACAGTGG + Intergenic
927984592 2:27399869-27399891 CTTGGTTATATACCAAAGAGTGG - Intronic
928871394 2:35985310-35985332 CTTGGATATATACCTACTAGTGG - Intergenic
930839696 2:55832030-55832052 TTTGGTTATATACCAAGTAATGG + Intergenic
938106382 2:128533438-128533460 GATGCTTTTATACCATCTTGAGG - Intergenic
940542473 2:155038922-155038944 TTTGGATTTATACCTAATAGAGG - Intergenic
942913548 2:181275628-181275650 GTTGGTTTTTCACCAATAAGAGG + Intergenic
946303843 2:218844335-218844357 TTTGGTTTTATACCCAGTAATGG - Intergenic
1168907381 20:1417201-1417223 GTTGGTTTCTTACCACCAAGAGG - Intergenic
1170823856 20:19776882-19776904 CTTGGTTTTATACATTCTAGGGG - Intergenic
1174839534 20:53888463-53888485 TTTGGGTTTATACCTACAAGTGG + Intergenic
1176598276 21:8767947-8767969 TTTGGTTATATACCCACTAATGG + Intergenic
1178220798 21:30657455-30657477 TTTGGATATATACCCACTAGAGG + Intergenic
1179331456 21:40406290-40406312 TTTGGATAAATACCAACTAGTGG - Intronic
1180377330 22:12106326-12106348 TTTGGTTATATACCCACTAATGG + Intergenic
1180420172 22:12806950-12806972 TTTGGTTATATACCCACTAATGG - Intergenic
1182513188 22:30834351-30834373 CTTGGTTATATACCAAGGAGTGG + Intronic
1183870445 22:40737742-40737764 TTTGGATTTATACCCAGTAGTGG - Intergenic
949133405 3:533459-533481 GTTGGCTGTATACCAAGAAGTGG - Intergenic
951223797 3:20097271-20097293 GTTGGTTATAAACTAAATAGAGG - Intronic
951284917 3:20798672-20798694 GTTGGTTATATACCCAGTAGTGG + Intergenic
952463381 3:33553840-33553862 TTTGGGTATATACCCACTAGTGG - Intronic
955563126 3:60214654-60214676 TTTGGTTATATACCCAGTAGTGG - Intronic
956993914 3:74801505-74801527 TTTGGGTTTATACCAACTAATGG - Intergenic
956998795 3:74859497-74859519 GCTGGTTTTATACAAATCAGAGG - Intergenic
957083740 3:75660432-75660454 TTTGGGTATATACCAAGTAGTGG + Intergenic
957755775 3:84485190-84485212 TTTGGTTATATACCCAGTAGTGG + Intergenic
958488462 3:94742568-94742590 CTTGGTTTTATACTCAGTAGTGG - Intergenic
958493294 3:94806447-94806469 TTTCCTTTTATACCAATTAGAGG + Intergenic
959260386 3:104071932-104071954 TTTGGGTTTATACCCAGTAGTGG - Intergenic
960036023 3:113104000-113104022 GTTGAATTCAAACCAACTAGTGG - Intergenic
960754592 3:120997292-120997314 CTTGGGTATATACCCACTAGTGG + Intronic
960766827 3:121140376-121140398 TTTAGTTATATACCAAGTAGTGG - Intronic
963033711 3:141005560-141005582 TTTGGTTAAATACCAAGTAGTGG + Intergenic
963228505 3:142887526-142887548 GTTGGATTTACCCCAACTATTGG - Intronic
964370324 3:155993674-155993696 ATTGGTTTTATGCCAGCGAGTGG + Intergenic
967715321 3:192755958-192755980 CTTGGGTATATACCCACTAGTGG - Intronic
971310008 4:25517428-25517450 GTTGGTTATATACCTAGGAGTGG + Intergenic
972950986 4:44322102-44322124 TTTGGTTATATACCAAGCAGTGG + Intronic
973156243 4:46956819-46956841 GTTGGTTATGAACCAACTATAGG - Intronic
973361600 4:49170316-49170338 TTTGGTTATATACCCACTAATGG + Intergenic
973399489 4:49626544-49626566 TTTGGTTATATACCCACTAATGG - Intergenic
974992170 4:69106602-69106624 GTTGGTTATATACCCAGTAATGG + Intronic
975107148 4:70580510-70580532 TTTGGGTTTATACCTAGTAGTGG - Intergenic
975661664 4:76695025-76695047 GATTGTTTTATACCAATAAGTGG + Intronic
975927939 4:79482197-79482219 TTTGGATATATACCCACTAGTGG + Intergenic
975930597 4:79517736-79517758 TTTGGTTATATACCCAGTAGTGG + Intergenic
976008591 4:80460009-80460031 GATGTTTTTATACCATCTTGAGG + Intronic
977374245 4:96180933-96180955 TTTGGTTATATACCCAGTAGTGG + Intergenic
977734511 4:100397439-100397461 GTTGATTTTCTACAAACTAGAGG + Exonic
977740180 4:100470529-100470551 TTTGGTTATATACCAAGTAATGG - Intronic
978288683 4:107110681-107110703 TTTGGATATATACCAAGTAGTGG + Intronic
979506759 4:121506801-121506823 TTTGGATATATACCCACTAGTGG + Intergenic
980096638 4:128498223-128498245 TTTGGATATATACCCACTAGTGG + Intergenic
981773157 4:148333687-148333709 CTTGATTTTATATCAGCTAGGGG - Intronic
982507226 4:156234769-156234791 TTTGGATTTATACCCAGTAGTGG + Intergenic
983458248 4:167992502-167992524 TTTGGGTATATACCTACTAGTGG + Intergenic
984311396 4:178065030-178065052 TTTGGTTTTATATGAGCTAGAGG - Intergenic
985185834 4:187314684-187314706 TTTGGATATATACCCACTAGTGG - Intergenic
985319931 4:188699661-188699683 GATGCTTTTATACCATCTGGAGG + Intergenic
1202758937 4_GL000008v2_random:91785-91807 TTTGGTTATATACCCACTAATGG + Intergenic
989753982 5:44929302-44929324 TTTGGATATATACCAAATAGTGG + Intergenic
989788332 5:45359027-45359049 GATGCTTTTATACCATCTTGGGG - Intronic
992922586 5:81542397-81542419 TTTGGTTTTATGCCAAGTAATGG - Intronic
994711935 5:103276227-103276249 TCTGGTTTTATACAAACGAGAGG - Exonic
999156509 5:149461678-149461700 TTTGGTTGTATACCCAGTAGTGG + Intergenic
999226364 5:150028066-150028088 TTTGGTTTTATACATTCTAGGGG + Intronic
999346546 5:150826769-150826791 TTTGGATGTATACCAAGTAGTGG - Intergenic
1005428416 6:25728030-25728052 GTAGCTTTTATACAAACTAGGGG - Intergenic
1008298920 6:49810375-49810397 TTTGGGTATATACCAAGTAGTGG - Intergenic
1009240320 6:61178250-61178272 GATGTTTTTATACCATCTTGAGG - Intergenic
1010243056 6:73634857-73634879 GTTGGTTTTCTAACAACTAATGG + Intronic
1010843931 6:80681471-80681493 ATTGGTTTTAGACATACTAGTGG - Intergenic
1011402374 6:86977534-86977556 TTTGGTTTTATACCTAATAATGG + Intronic
1012432021 6:99173894-99173916 GTTGGGTTTATACCTAAGAGGGG + Intergenic
1013433097 6:110073491-110073513 TTTGGTTATATACCCACTAATGG - Intergenic
1013502427 6:110766087-110766109 TTTGGGTATATACCAAGTAGTGG - Intronic
1015394164 6:132716664-132716686 CTTGTTTTTATGCCAACTAATGG + Intergenic
1015608408 6:134986152-134986174 GTAGGTTTTATTCCTACAAGTGG - Exonic
1017297125 6:152811030-152811052 CTTGGTTTTATACCATCTATGGG + Intergenic
1017302382 6:152876942-152876964 GTTAGATTTATTCCAACTATTGG - Intergenic
1017509102 6:155096852-155096874 TTTGGATCTATACCCACTAGTGG + Intronic
1022899712 7:34793709-34793731 TTTGGGTTTATACCCATTAGTGG - Intronic
1025901134 7:65745750-65745772 ATTGTTTTTATACCAAGCAGTGG + Intergenic
1026240442 7:68569722-68569744 TTTGGTTATATACCCAATAGTGG - Intergenic
1027337617 7:77170477-77170499 TTTGGTTTTATACCCAGTAATGG + Intronic
1028745997 7:94327430-94327452 TTTGGGTATATACCAAGTAGTGG - Intergenic
1029778125 7:102700325-102700347 TTTGGTTTTATACCCAGTAATGG - Intergenic
1029793418 7:102868981-102869003 TTTGGATATATACCAAGTAGTGG + Intronic
1030919938 7:115370653-115370675 TTTGGATATATACCCACTAGAGG + Intergenic
1033993587 7:147318059-147318081 GTTGGTTTTATACCTACAAATGG - Intronic
1034358526 7:150473608-150473630 TTTGATTTTATACCACCAAGGGG + Intronic
1034496357 7:151425320-151425342 GTTCGTTTTTTCCCAATTAGAGG - Intergenic
1036194384 8:6701216-6701238 GATGCTTTTATACCATCTTGAGG - Intergenic
1036730838 8:11262837-11262859 CTTGGGTGTATACCTACTAGTGG + Intergenic
1037169949 8:15879013-15879035 TTTGGGTATATACCAAGTAGTGG - Intergenic
1037919553 8:22795820-22795842 GTTATTTTTATACTAACAAGTGG - Intronic
1043307354 8:78812396-78812418 TTTGGATGTATACCAAGTAGTGG + Intergenic
1043942184 8:86208396-86208418 TTTGGGTATATACCAAATAGTGG - Intergenic
1045783203 8:105892003-105892025 ATTGGATATATACCCACTAGTGG - Intergenic
1047359656 8:124156520-124156542 TTTGGGTTTATACCCAGTAGTGG + Intergenic
1048105823 8:131408173-131408195 TTTGGGTTTATACCCAGTAGTGG + Intergenic
1048690497 8:136956803-136956825 GATGCTTTTACACCAACTTGAGG - Intergenic
1049975384 9:856739-856761 CTTGGGTATATACCAAGTAGTGG + Intronic
1051106259 9:13584326-13584348 TTTGGTTATATACCCACTAGTGG + Intergenic
1051429031 9:16963281-16963303 TTTGGTTATATACCAAGTAATGG + Intergenic
1053617614 9:39784311-39784333 TTTGGCCATATACCAACTAGTGG + Intergenic
1053875794 9:42543671-42543693 TTTGGCCATATACCAACTAGTGG + Intergenic
1053896858 9:42750959-42750981 TTTGGCCATATACCAACTAGTGG - Intergenic
1054235905 9:62558054-62558076 TTTGGCCATATACCAACTAGTGG - Intergenic
1054266550 9:62923124-62923146 TTTGGCCATATACCAACTAGTGG - Intergenic
1055546795 9:77384378-77384400 ATTGAGTTTGTACCAACTAGTGG + Intronic
1055786694 9:79877548-79877570 TTGGGATTTATACAAACTAGTGG + Intergenic
1056734873 9:89201020-89201042 TTGGGTATAATACCAACTAGTGG - Intergenic
1057093614 9:92283685-92283707 GTTGGTTATATAACAAGTAGTGG - Intronic
1057732820 9:97625426-97625448 GTTGGTATTATACCCAGGAGTGG + Intronic
1057901128 9:98949386-98949408 GTTGGTTCTATACCTACGAGTGG + Intronic
1058845824 9:108958254-108958276 GTTGGTTTTGCCCCAACTTGTGG - Intronic
1059706678 9:116830463-116830485 TTTGGGTTTATACCCAATAGTGG - Intronic
1203690730 Un_GL000214v1:40002-40024 TTTGGTTATATACCCACTAATGG + Intergenic
1203539721 Un_KI270743v1:76684-76706 TTTGGTTATATACCCACTAATGG + Intergenic
1203554973 Un_KI270743v1:199162-199184 TTTGGTTATATACCCACTAATGG - Intergenic
1203645565 Un_KI270751v1:64189-64211 TTTGGTTATATACCCACTAATGG - Intergenic
1185837175 X:3355930-3355952 TTTGGTTTTATACCCAAAAGGGG + Intergenic
1186830265 X:13383209-13383231 GATGCTTTTATACCATCTTGAGG + Intergenic
1188014033 X:25088046-25088068 TTTGGGTGTATACCCACTAGAGG + Intergenic
1188306551 X:28566400-28566422 GTGGGTTATATACCAAGAAGTGG - Intergenic
1188402864 X:29769368-29769390 CTTGGTTATATACCTACAAGTGG + Intronic
1188902225 X:35747676-35747698 TTTAGATTTATACCAAGTAGTGG + Intergenic
1190650821 X:52566886-52566908 GTTGGTTTTCTCCCACCTCGTGG + Intergenic
1191791731 X:64978387-64978409 GTTCTTTAAATACCAACTAGTGG - Intronic
1192070054 X:67929044-67929066 TTTGGTTATATACCAAGCAGTGG - Intergenic
1192929811 X:75793948-75793970 TTTGGTTATATACCCAGTAGTGG + Intergenic
1193466005 X:81848574-81848596 TTTGGTTTTATTCCAACTTGAGG - Intergenic
1193782638 X:85722628-85722650 TTTGGATTTATACCCAGTAGTGG + Intergenic
1193820937 X:86163928-86163950 GTTGGTTATATACCCAGTACTGG + Intronic
1194462225 X:94185631-94185653 TTTGGGTTTATACCCAGTAGTGG + Intergenic
1194753503 X:97710197-97710219 TTTGGATTTATACCCAGTAGTGG + Intergenic
1195646208 X:107233382-107233404 GTTAATATTATACCAAGTAGTGG - Intronic
1196777369 X:119351728-119351750 GTTGGGTAGATACCAAGTAGTGG - Intergenic
1198874707 X:141211118-141211140 TTTGGTTTTATACCCAGTAATGG + Intergenic
1200374149 X:155761553-155761575 TTTGGTTATATACCCAATAGTGG + Intergenic
1201532364 Y:15005963-15005985 GTTGGATTTATACCCACCAAAGG - Intergenic
1202091585 Y:21196380-21196402 TTTGGTTATATACCAAATATTGG - Intergenic