ID: 1149893684

View in Genome Browser
Species Human (GRCh38)
Location 17:60412395-60412417
Sequence TAGTGGGGAATGGGGGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149893672_1149893684 -6 Left 1149893672 17:60412378-60412400 CCTGTAGTCCCAGCTACTAGTGG 0: 8
1: 238
2: 7007
3: 123755
4: 255704
Right 1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 372
1149893671_1149893684 12 Left 1149893671 17:60412360-60412382 CCGGGTATGTGATGTGAACCTGT 0: 1
1: 0
2: 0
3: 25
4: 233
Right 1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149893684 Original CRISPR TAGTGGGGAATGGGGGCGGT GGG Intronic
900037383 1:427476-427498 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
900059013 1:663217-663239 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
900095413 1:938165-938187 TGGTCTGGAATGGGTGCGGTCGG + Intronic
900117977 1:1036614-1036636 GAATGGGGAATGGTGGCTGTGGG + Intronic
900140151 1:1136441-1136463 GGGTGGGGACTGGGGACGGTGGG + Intergenic
901220376 1:7580298-7580320 TTGGGGGGAATGGGGGCAGGTGG + Intronic
901251421 1:7783410-7783432 TAGCGGAGGATGGGGGCGGTTGG + Intergenic
901615964 1:10539965-10539987 TAGTGGGGCCTGGGTGCTGTTGG + Intronic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
901778625 1:11577718-11577740 AAGTGGGGAGTGGGGCTGGTTGG - Intergenic
901817790 1:11804921-11804943 GAGTGAGGAACGGGGGCGGGGGG + Intronic
902551117 1:17220122-17220144 GAGTGGGGGATGGGGGAGGTGGG + Intronic
902710776 1:18238296-18238318 CAGTGGGGAATGGGGGTGAGAGG + Intronic
904842052 1:33379287-33379309 TGGGGGGGCAGGGGGGCGGTGGG - Intronic
905802520 1:40854314-40854336 TAGTGGGGGGCGGGGGCGGGGGG - Intergenic
905829127 1:41050134-41050156 CAGTGGGGAAGGGGTGCAGTGGG + Intronic
905910532 1:41650213-41650235 TGCTGGGGAATGGGAGGGGTGGG + Intronic
906083163 1:43107558-43107580 TGGTGGGGAATGGGGGGGTGTGG + Intergenic
906607920 1:47184290-47184312 CAGTGGGGGATGGGCTCGGTGGG - Intronic
908471838 1:64452214-64452236 TAGTTGGGCATGGTGGTGGTGGG - Intergenic
908501144 1:64745034-64745056 CCGCGGGGAAGGGGGGCGGTGGG - Intergenic
909530269 1:76674095-76674117 TAGTGGGCACTGGGCGCAGTGGG - Intergenic
911174309 1:94803966-94803988 TGGTGGGGCATGGGGGAGGGAGG - Intergenic
911995194 1:104758034-104758056 AAGAGGGGGATGGGGGAGGTGGG + Intergenic
912925439 1:113908653-113908675 GAGTTGGGAATGGGGATGGTGGG - Intronic
915124081 1:153651004-153651026 TAGCGGGGCATGGGGGCAGGGGG + Intergenic
915951396 1:160191996-160192018 GGGTGGGGAAGGGAGGCGGTTGG - Intronic
916025737 1:160831838-160831860 TAATGGGTAGTGGGGGAGGTTGG + Intronic
918413741 1:184286658-184286680 CAGTGAGGAATGGGAGCCGTAGG - Intergenic
919849898 1:201665587-201665609 TGGTGGGCAGTGGGGGGGGTGGG - Intronic
919910375 1:202107244-202107266 TAGTGGGGATAGGGGAAGGTTGG - Intergenic
920654929 1:207868153-207868175 TGGTGGGAGATGGGGGCTGTAGG - Intergenic
920728515 1:208460920-208460942 GAGTGGGGAATTGGGGCAGGGGG - Intergenic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
920938995 1:210463090-210463112 TAGTGGGGTAAGGAGGCAGTGGG - Intronic
921155222 1:212433481-212433503 TAGTGGGGAGTGGCGGGGGACGG + Intronic
921595651 1:217051188-217051210 GAGTGGATAATGGGGGCGGGGGG + Intronic
921871257 1:220142351-220142373 TAGTGGGGCATGGTGGTGGCGGG + Intronic
921906242 1:220498213-220498235 AAGTGGGGAATGGGGTGGGTGGG + Intergenic
922476260 1:225908745-225908767 TTGTGGGGACTGGGGAAGGTTGG + Intronic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062915777 10:1240543-1240565 CAGTGGGGGATGGTGGCTGTGGG - Intronic
1064390759 10:14940157-14940179 GAGAGGGGAATGGGAGTGGTAGG - Intronic
1064878079 10:20017915-20017937 TAGTGGGGCATGGGGACCATGGG + Intronic
1066551840 10:36567554-36567576 TAGTGGGGTATGTGGGAGGAGGG - Intergenic
1067394662 10:45903608-45903630 TAGTGGGTCATGGTGGGGGTGGG - Intergenic
1067862985 10:49872739-49872761 TAGTGGGTCATGGTGGGGGTGGG - Intronic
1068197158 10:53731678-53731700 TGTTGGGGGATGGGGGCGGGGGG + Intergenic
1068679921 10:59808420-59808442 CAGAAAGGAATGGGGGCGGTGGG - Intronic
1069040111 10:63687147-63687169 CAGTGGGCAGTGGGGGCGGGGGG - Intergenic
1069621659 10:69841060-69841082 AAGTGGGGCAGGGGGGCAGTGGG - Intronic
1069795078 10:71046737-71046759 GGGTGGGGAATGGGTGCGGGGGG + Intergenic
1070970452 10:80562102-80562124 TACTAGGGGATGGGGGCTGTGGG - Intronic
1071514483 10:86288144-86288166 TTGTGGGGAATGTGGCAGGTGGG - Intronic
1071629213 10:87204385-87204407 GGGTGGGGATTGGGGGTGGTGGG + Intergenic
1072188014 10:93060667-93060689 GAGTGGTGATTGGAGGCGGTGGG - Intergenic
1074029972 10:109677308-109677330 TAGTGGGGAAGTGGGGGAGTTGG - Intergenic
1074601927 10:114923309-114923331 TAGTTGGGCATGGGGGCGCGTGG - Intergenic
1075510697 10:123070574-123070596 TAGAGGGGAATGGGGGCAATGGG - Intergenic
1075741444 10:124698753-124698775 GGGTGGGGAATGGGGGCCGAGGG - Intronic
1075857000 10:125638162-125638184 CAGTGGGGGATGGGGGCTGGGGG - Intronic
1076456325 10:130601157-130601179 TAGTGGGGCTTGGGGGCAGGTGG - Intergenic
1076964109 11:65399-65421 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1077544462 11:3163217-3163239 TAAATGGGAATGGGGGCGGGGGG + Intronic
1078059622 11:8034739-8034761 GAGAGGGGAATGGAGGGGGTGGG - Intronic
1080384024 11:31799952-31799974 GAGCGGGGGATGGGGGGGGTGGG - Intronic
1081401858 11:42653140-42653162 TGGTGGGGTGGGGGGGCGGTGGG - Intergenic
1082066467 11:47904754-47904776 TAGTCGGGCATGGTGGCGGGCGG + Intergenic
1082773200 11:57224886-57224908 GAATGTGGAATGGGGGTGGTAGG - Intergenic
1083653052 11:64214949-64214971 TAGCTGGGCATGGTGGCGGTGGG - Intronic
1084296190 11:68214343-68214365 TAGTGGGTGCTGGGGGCGGCGGG - Intergenic
1084824209 11:71717165-71717187 TAGTGGGGCATGGTGGCAGGTGG + Intergenic
1085251181 11:75144942-75144964 TGGTTGGGGATGGGGGTGGTGGG - Intronic
1088442633 11:109888708-109888730 TGGTAGGGAATGGGGGCACTGGG - Intergenic
1089534836 11:119154578-119154600 GAGTGGGGAAGGGAGGCAGTGGG + Intronic
1091586676 12:1820852-1820874 TGGTGGGGACAGGGGGTGGTCGG + Intronic
1092045815 12:5431421-5431443 TAGAGGGGCGTGGGGGCGGGTGG - Intergenic
1092075774 12:5672138-5672160 CTGTGGGGAATTGGTGCGGTGGG - Intronic
1092793104 12:12086414-12086436 GAGTGGGGAAGAGGGGAGGTGGG - Intronic
1094204924 12:27829924-27829946 TAGTGGGCATTGGGTGAGGTTGG + Intergenic
1095967566 12:47879205-47879227 TGGTGGGGGGTGGGGGCGGTGGG - Intronic
1096849921 12:54428814-54428836 TAGTGGGGGTTGTGGGTGGTGGG + Intergenic
1098414902 12:70222107-70222129 TAGTGGGGAAGGGTGGGGGCTGG - Intergenic
1099980727 12:89598884-89598906 AAGTGGGGGATGGGGGAGCTAGG + Intronic
1101461026 12:104893866-104893888 TAGGAGGGTATGGGGGAGGTAGG + Intronic
1102886841 12:116528588-116528610 GAGTGGGGGATGGGGGTGTTTGG - Intergenic
1103705166 12:122867399-122867421 GGGTAGGGAAGGGGGGCGGTAGG + Exonic
1103954552 12:124568857-124568879 GAGCGGGGAATGGCTGCGGTGGG + Intergenic
1104413254 12:128577092-128577114 TAGTGGTTGATGGGGGCTGTGGG - Intronic
1105258203 13:18759292-18759314 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1105260860 13:18778592-18778614 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1105649445 13:22358833-22358855 GGGTGGGGAGTGGGGGAGGTGGG - Intergenic
1106342305 13:28842015-28842037 TAGAGGGGAATGGGGGAGAAGGG - Intronic
1107217172 13:37935053-37935075 GGTTGGGGAGTGGGGGCGGTGGG + Intergenic
1107873213 13:44765633-44765655 TAGCCGGGCATGGTGGCGGTGGG - Intergenic
1108569765 13:51737778-51737800 TTGTGGGGAATGTTGGTGGTCGG + Intronic
1108776510 13:53771835-53771857 GAGTGGGGGGTGGGGGGGGTGGG - Intergenic
1109131996 13:58598478-58598500 GAGTGGGGATTGGAGGCTGTGGG + Intergenic
1109426650 13:62172719-62172741 TAGTGGGGGATGGAGGGGGTGGG + Intergenic
1111634552 13:90887185-90887207 TACTGGGGAATGGAGGAGGAGGG + Intergenic
1112996514 13:105580877-105580899 TGGTGGTGAATGGTGGCTGTTGG - Intergenic
1113969107 13:114175203-114175225 TTGTGGGGGATGGGGCAGGTGGG - Intergenic
1114567389 14:23642852-23642874 AAATGGGGACTGGGGGCAGTGGG - Intronic
1115026901 14:28756851-28756873 GGGTGGGGAGTGGGGGCGCTGGG + Intergenic
1116913784 14:50500661-50500683 TGGTGGGGAATGGGAGGTGTGGG + Intronic
1117836981 14:59818018-59818040 GAGTGGGGAATGTGGGAGGAGGG - Intronic
1118231620 14:63956972-63956994 TACTGGGGCATGGGGGGGTTAGG - Intronic
1118838338 14:69492594-69492616 TAGCTGGGAATGGGGGAGCTAGG - Intronic
1118848324 14:69565182-69565204 TTGTGGGGGCTGGGGGAGGTAGG - Intergenic
1120017537 14:79490675-79490697 AAGTGGGGGTTGGGGGAGGTGGG + Intronic
1121128583 14:91425392-91425414 TACTGGGATATGGGGGAGGTGGG + Intergenic
1121678196 14:95771456-95771478 CAGTGGGGAAGGGGGCAGGTAGG + Intergenic
1122364815 14:101188350-101188372 TAGTGGGGCGTGGCGGGGGTGGG - Intergenic
1122816341 14:104316009-104316031 GAGTGGGGAGTGGGGCCGGGTGG + Intergenic
1123586396 15:21764367-21764389 CTGTGGGGAATTGGTGCGGTGGG + Intergenic
1123623035 15:22206947-22206969 CTGTGGGGAATTGGTGCGGTGGG + Intergenic
1123909854 15:24955756-24955778 CAGTGGGTATTGGCGGCGGTGGG + Intronic
1125108506 15:36003007-36003029 TAGTGGAGAATGGGGAAGGAGGG + Intergenic
1125137229 15:36357864-36357886 TAGGGGAGAATGGGGTGGGTTGG - Intergenic
1125335299 15:38620672-38620694 TACTGGGGGATAGGGGTGGTGGG - Intergenic
1125381460 15:39091627-39091649 CAGTGGGGGGTGGGGGGGGTGGG + Intergenic
1127736023 15:61840084-61840106 AAGTGTGGGATGGTGGCGGTGGG - Intergenic
1127905709 15:63374291-63374313 GAGTGGGGAGTGGGTGCTGTTGG - Intronic
1129488831 15:75903955-75903977 TGGTGAGGAATGGAGCCGGTAGG + Exonic
1130017567 15:80199678-80199700 TAGTGGGGATAGGGGTGGGTAGG + Intergenic
1130137611 15:81195232-81195254 TAGTGGAGGAGGGGGGCTGTGGG + Intronic
1132444442 15:101899784-101899806 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1132517962 16:374596-374618 TGGTGGGGAATGGGGGAGTGGGG + Intronic
1132712353 16:1274835-1274857 TATTGGTGGATGGGGGTGGTAGG - Intergenic
1133718149 16:8468912-8468934 TTGAGGTGAATGGGGGCGGGAGG + Intergenic
1134405713 16:13956769-13956791 TTGTGGGGGATGGGGGTGGAGGG + Intergenic
1135033389 16:19056743-19056765 CATTGGGAAATGGCGGCGGTCGG + Intronic
1135198376 16:20414040-20414062 TTGTGGGGAATGGGTGGGGGTGG + Intronic
1135469971 16:22721640-22721662 TGGAGAGGTATGGGGGCGGTGGG - Intergenic
1136225467 16:28857395-28857417 TAATGGGGAGTGGGGGCGGGGGG + Intronic
1137652922 16:50135854-50135876 TAGTGGGGGAGGTGGGAGGTAGG - Intergenic
1139511791 16:67431970-67431992 CAGTGGGGGATGGGTGGGGTGGG - Intronic
1139564292 16:67763657-67763679 AAGTGGGTTATGGGGGTGGTAGG - Intronic
1140056052 16:71526680-71526702 TAGTGGGGCTTGGGGGCTGCTGG - Intronic
1140317588 16:73913943-73913965 AAGCAGGGAATGGGGGTGGTTGG + Intergenic
1141753424 16:85975203-85975225 GAGTGGGGAGAGGGGGCTGTGGG - Intergenic
1142002319 16:87670852-87670874 TATGGGGGAATGGGGACGGGAGG + Intronic
1142386853 16:89770792-89770814 GATTGGGGAATGGGGGCCCTGGG - Intronic
1142511951 17:401702-401724 TAGAGGGGAATGGCGGGGGATGG - Intergenic
1142977700 17:3655602-3655624 TAGTGGAGAATGGGCGGGGGAGG + Intronic
1143819098 17:9544844-9544866 TAGTCGGGCACGGTGGCGGTGGG + Intronic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1144390596 17:14790099-14790121 TAGTGGGGTCTGGGTGCGGCTGG - Intergenic
1144800005 17:17919635-17919657 AAGTGGGGCATGGGGGAGGAGGG + Intronic
1144965804 17:19076668-19076690 TGGTGGGGCAGTGGGGCGGTGGG + Intergenic
1144982164 17:19175514-19175536 TGGTGGGGCAGTGGGGCGGTGGG - Intergenic
1144986059 17:19202725-19202747 TGGTGGGGCAGTGGGGCGGTGGG + Intergenic
1146236271 17:31166692-31166714 TTGTGGGGAGTGGGGGCGGCAGG + Intronic
1146978642 17:37138850-37138872 TGGTGAGTAATGGGGGAGGTGGG + Intronic
1148765295 17:50035372-50035394 GGGTGGGGAATGGGTGGGGTGGG - Intergenic
1149510008 17:57232728-57232750 AAGTGGGGAGTGGGAGAGGTTGG + Intergenic
1149521075 17:57318641-57318663 TTGTGGGGGGTGGGGGCGGAGGG + Intronic
1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG + Intronic
1150272253 17:63874018-63874040 GAGAGTGGAATGGGGTCGGTAGG - Intronic
1150275800 17:63896915-63896937 GAGAGTGGAATGGGGTCGGTAGG - Intergenic
1150479793 17:65500145-65500167 TAGGGTGGTATGGGGGTGGTAGG + Intergenic
1150872592 17:68929968-68929990 TTCTGGGGGGTGGGGGCGGTGGG + Intronic
1151275226 17:73029230-73029252 TACTGGGGAGTAGGGGTGGTGGG - Intronic
1151700308 17:75739483-75739505 TAGAGGGGGATGGGGGCAGAGGG - Intronic
1152863472 17:82709256-82709278 GGGTGGGGCATGGGGGCAGTGGG - Intergenic
1153321050 18:3774593-3774615 TAGTGGGGGATAGTGGTGGTGGG + Intronic
1154432845 18:14321439-14321461 CAGTGGGGTGTGGGGGTGGTAGG + Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1157044189 18:44077961-44077983 TAGTGGGGGCTGGGGGATGTGGG + Intergenic
1157487817 18:48100938-48100960 TAGTGGGGAACGGGGAAGGCAGG + Intronic
1158330515 18:56357310-56357332 AATTGGGGCATGGGGGCGTTGGG - Intergenic
1159369796 18:67516276-67516298 GAGCGGAGAATGGGGGCGGCAGG - Intronic
1159532556 18:69672706-69672728 AAGGGGGGGGTGGGGGCGGTGGG + Intronic
1159872982 18:73779271-73779293 CAGTCGGGGATGGGGGAGGTCGG + Intergenic
1160640912 19:135031-135053 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1160818136 19:1045660-1045682 TGGTGGGGGAGGGGGGCGGGGGG - Intronic
1162070404 19:8149257-8149279 CAGTGGGGAGTGGGGGCGCGGGG - Intronic
1162495167 19:11019447-11019469 TAGTGGGGAAAGGGGCTGGCAGG - Intronic
1162846107 19:13393840-13393862 GCGTGGGCAATGGGGGCGGAGGG - Intronic
1162914783 19:13868732-13868754 TAGTGGGGAATGGGATGGGGGGG + Intronic
1163807777 19:19410336-19410358 GGGTGGGGGATGGGGGTGGTGGG + Intronic
1164053146 19:21599980-21600002 TGGGGGGGAATGGGGTGGGTAGG + Intergenic
1164240854 19:23387792-23387814 TAGTCGGGCATGGTGGTGGTGGG + Intronic
1165295224 19:34921299-34921321 CAGTAGGGAATGGAGGGGGTAGG - Intergenic
1165899740 19:39163498-39163520 TGGGGGAGAATGGGGGTGGTGGG + Intronic
1166105891 19:40597906-40597928 TTGTGGGGAGTGGGGTCGGGTGG + Intronic
1167263945 19:48474115-48474137 TCCTGGGGAATGGGGGCACTGGG + Intronic
1167454291 19:49590486-49590508 GAGTGGGGAATGGTGGGAGTAGG + Exonic
925129801 2:1486795-1486817 TAGTGGGGAGTGGGGAGGGCAGG + Intronic
925740202 2:6998889-6998911 TTGTGGGGGGTGGGGGCGGGGGG + Intronic
931221173 2:60289325-60289347 TAGTTGGGAGGGGGGGTGGTGGG - Intergenic
933206625 2:79513771-79513793 AAGAGGGGTATGGGGGCTGTTGG - Intronic
934492954 2:94774703-94774725 CAGTGGGGGGTGGGGGTGGTGGG - Intergenic
936041358 2:109152307-109152329 TTGTGGGGAATGTGGGTGGGTGG + Intronic
936250778 2:110866768-110866790 GAGTGGGGAGATGGGGCGGTGGG - Intronic
936697671 2:114969850-114969872 TAGTGGGGACTGGAGGTGGGGGG - Intronic
937032742 2:118753993-118754015 TAGTGGGGAAAGGAGGCTGCTGG - Intergenic
937221068 2:120343666-120343688 TATTGGGGAATCGGGGACGTCGG - Intergenic
937884427 2:126890190-126890212 TAGTGGGGAATGCAGGGAGTAGG + Intergenic
941177100 2:162211305-162211327 AAGTGGGGTATGGTGGGGGTTGG - Intronic
942745226 2:179224621-179224643 TAGTGGGGGTAGGGGGAGGTTGG - Intronic
943161134 2:184252651-184252673 TCGTGGGGCATGGGGGAGGGAGG + Intergenic
943311459 2:186330188-186330210 TACTGGGGTCTGGGGGAGGTAGG - Intergenic
945694575 2:213086775-213086797 TAGTGTGGAATGGGAGTGGAGGG + Intronic
947536327 2:230942430-230942452 GAGTGGGGAATGGAGGCTGGAGG - Intronic
947734828 2:232449075-232449097 TACTGGGGCCTGGGGGCGCTGGG - Intergenic
948863098 2:240762382-240762404 TGATGGGGAATGGGGCTGGTAGG - Intronic
949007553 2:241658305-241658327 TGGTGGGGCAGGGGGGCAGTGGG + Intronic
1169270818 20:4198180-4198202 TAGTGTGGAATGTGGGAGCTTGG - Intergenic
1169288327 20:4328135-4328157 GGGTGGGGAATGGAGGCGGCAGG - Intergenic
1169496250 20:6118377-6118399 TAGTGGTGACTGGGAGGGGTCGG + Intronic
1169673726 20:8132190-8132212 TGGCGGGGAAGGGGGGCGGGGGG + Intronic
1170554411 20:17504159-17504181 ATGTGGGGGATGGGGGCTGTGGG - Intronic
1170658221 20:18310610-18310632 TACTAGGGGATGGGGGTGGTTGG + Intronic
1170683506 20:18547724-18547746 CAGTGGGGAGTGGGGGTGGAGGG - Intronic
1171208955 20:23302433-23302455 TGGTAGGGAGTGGGGGCGGGGGG - Intergenic
1171955004 20:31454985-31455007 TAGCCGGGCATGGTGGCGGTGGG - Intergenic
1172008125 20:31831174-31831196 TGGTGGGGCATGGGGGCGAGCGG + Intronic
1173447710 20:43134976-43134998 CAGCTGGGAATGGTGGCGGTGGG - Intronic
1174303627 20:49600100-49600122 TTGTGGGGAATGGGGGACGAGGG - Intergenic
1174515611 20:51090168-51090190 CAGTGGGAAATTGGGGAGGTGGG - Intergenic
1174574303 20:51525920-51525942 AAGTGGGGAGTGGTGGGGGTGGG - Intronic
1176141145 20:63545598-63545620 TAGGGGGCAATGGGGGCAGCAGG + Intronic
1176844202 21:13864316-13864338 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1177738411 21:25121774-25121796 TAGTTGGAAATAGTGGCGGTAGG + Intergenic
1178444217 21:32623880-32623902 TATTGGGGAAGGGGGCCTGTGGG + Intergenic
1178495340 21:33081323-33081345 GAGGGGGGAATGGGGGGGTTGGG - Intergenic
1179386779 21:40950854-40950876 TATTAGGGAATGGGGGCCCTTGG + Intergenic
1179478043 21:41660279-41660301 TGGTGGGGAGTGGGGGCAGAGGG - Intergenic
1181262154 22:21606204-21606226 CAGTGGGGAACAGGGGAGGTTGG + Intronic
1183424654 22:37733042-37733064 AAGTGGGGAGTAGAGGCGGTTGG - Intronic
1184498818 22:44859837-44859859 GAGTGGGGAAGGGGGGAGCTTGG + Intronic
1184500006 22:44865769-44865791 GAGTGGGCAAGGGGGGCGCTTGG - Intergenic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
950859718 3:16137363-16137385 CAGTGGGGTATGGGGGGGGAGGG - Intergenic
951016710 3:17740180-17740202 TAGTCGGGAGTGGTGGCGGGCGG + Intronic
952345297 3:32478262-32478284 GAGTGGGGACTGGGAGAGGTTGG + Intronic
953063354 3:39446642-39446664 TTTTGGGGAATGTGGGAGGTGGG + Intergenic
953405293 3:42656838-42656860 GCATGGGGAAGGGGGGCGGTAGG + Intronic
953629977 3:44605855-44605877 TAGTGGGGGGTGGGGGTAGTGGG + Intronic
953632035 3:44626290-44626312 TAGTGAGAAATGGTGGGGGTGGG - Intronic
954609806 3:51938292-51938314 TAGCAGGGAATAGGGGAGGTTGG - Intronic
955725843 3:61931715-61931737 TTGAGGGGAATGGAGGTGGTTGG - Intronic
956061619 3:65353745-65353767 AAGTGGGGGAGGGGGGCGGCGGG + Intronic
958586163 3:96091032-96091054 AAGTGGGGCATGGGGGCAGGGGG + Intergenic
958733921 3:97988620-97988642 TGGTGGTGAATGGTGGTGGTGGG + Intronic
959019162 3:101169401-101169423 GACTTGGGAATGGGGGTGGTAGG + Intergenic
959046758 3:101483463-101483485 TAGTGGGGAATAAAGGGGGTGGG + Intronic
959309932 3:104722562-104722584 TAATGGGGATGGGGGGCGGTAGG - Intergenic
960273152 3:115696572-115696594 TTGTGGGGGGGGGGGGCGGTGGG - Intronic
961211416 3:125128841-125128863 GAGGGGGGAATGGGGGAAGTAGG + Intronic
962758981 3:138491957-138491979 TGGTGGGGCAGGGTGGCGGTGGG - Intergenic
962951357 3:140222322-140222344 TAGTGAGGGATGGGGGTGGAAGG + Intronic
965527617 3:169738201-169738223 TAGTGGGGGCAGGGGGAGGTTGG + Intergenic
967319223 3:188179151-188179173 TAATAGGGAATGGGGGCCGGGGG - Intronic
968647817 4:1749042-1749064 TGGTGGGGAGGGGGTGCGGTGGG - Intergenic
968674065 4:1867733-1867755 TAGTGGGGAATGCGGATGATGGG - Intergenic
968731610 4:2271781-2271803 TAGTGGAGAAGGGGGGCCGTCGG + Intronic
968808319 4:2788822-2788844 GAGTGGGGATTGGGGGAGGTAGG + Intergenic
969990942 4:11261473-11261495 GGGAGGGGAATGGGGGTGGTAGG + Intergenic
970922819 4:21415090-21415112 TAGTGGGGACTGGGGGGGAATGG - Intronic
972763586 4:42131061-42131083 TATTGGGGAGGGGGGGCAGTGGG + Intronic
972859141 4:43145834-43145856 TAGTTGGGAATGGGGAAAGTGGG + Intergenic
973704991 4:53572286-53572308 TTCTGGGGAATGAGGGAGGTAGG + Intronic
975749216 4:77505782-77505804 TTGTGGGGAATGGGGATGGCTGG + Intergenic
976035885 4:80820530-80820552 TAGTGGGGCAGGGGAGGGGTAGG + Intronic
976133463 4:81909425-81909447 TCATGGGGAATGGGGGTGGGAGG + Intronic
978801829 4:112763107-112763129 GAGTGGGGGCTGGGCGCGGTGGG + Intergenic
980888846 4:138792876-138792898 TAGTTGTGCATGGGGGTGGTGGG - Intergenic
982642333 4:157978846-157978868 GAGTGGCTAATGGGGGCGGTGGG + Intergenic
984818504 4:183859482-183859504 CAGAGGGGACTGGGGGCAGTGGG + Intronic
985521367 5:375390-375412 CAGTGGGGAGTGAGGGTGGTGGG + Intronic
988475830 5:31584675-31584697 TACTGGTGAATGGTGGCAGTAGG - Intergenic
988528047 5:32003461-32003483 TAGTGTGGTGTGGGGGGGGTGGG - Intronic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
993014448 5:82519716-82519738 TTGTGGGGAATGTGGGCAGAGGG + Intergenic
993902263 5:93592660-93592682 TAGGGGGGGATGTGGGTGGTGGG - Intronic
994660921 5:102653437-102653459 TAATGGGGAATGGTGGGGATTGG - Intergenic
995262224 5:110117764-110117786 TAGTGGGGGCTTGGGGAGGTAGG - Intergenic
995729522 5:115223148-115223170 TGGTGGGGGATGGGGGCGGTAGG + Intronic
996284614 5:121774333-121774355 TCATGGGGAATGGGGGATGTAGG + Intergenic
997476744 5:134146875-134146897 CAGTGGGGGATGGGGGAGATGGG - Exonic
998910485 5:146954625-146954647 TATTGGGGAATGGTGGTGTTTGG - Intronic
1002736438 5:181391390-181391412 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1002748259 6:83434-83456 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1003122437 6:3329158-3329180 TTGTGGGGGATGAGGGAGGTGGG - Intronic
1003176159 6:3753033-3753055 TATAGGGGAATAGGGGCCGTGGG + Intergenic
1003683305 6:8277043-8277065 TAGTGGGGGATGTGGGAGGCAGG - Intergenic
1006059066 6:31405696-31405718 TAGTGGGGAGTGGGGGAGCAGGG - Intronic
1006071552 6:31500580-31500602 TAGTGGGGAGTGGGGGAGTGCGG - Intronic
1006731772 6:36241539-36241561 TTGGGGGGAATGGCGGGGGTTGG + Intergenic
1008648594 6:53541603-53541625 TAGTAGGGTGGGGGGGCGGTGGG + Intronic
1008795299 6:55295320-55295342 TATTGGGGAATGGGGGCTAGGGG + Intergenic
1008904648 6:56662794-56662816 TAGTTGGGCATGGGGGCGGGGGG + Intronic
1010318210 6:74474623-74474645 TAGTGGGAAGTGGGAGAGGTGGG + Intergenic
1011313996 6:86011058-86011080 TAGCGGGGAATGTGGGTGGTGGG + Intergenic
1011314531 6:86016798-86016820 CAGGGAGGAAGGGGGGCGGTGGG + Intergenic
1011426325 6:87235408-87235430 TGGGGGGGATTGGGGGAGGTGGG + Intronic
1013257030 6:108397598-108397620 TAGTGGGGGATGGGGGAAGGTGG - Intronic
1016477901 6:144448385-144448407 GAGTGGGGAATGGGGAGTGTTGG + Intronic
1016982387 6:149864590-149864612 TTCGGGGGAATGGGGGCAGTGGG + Intergenic
1017056029 6:150436306-150436328 TGGTGCGGAAGGGGGGCCGTGGG - Intergenic
1017718615 6:157229294-157229316 CAGTGGGGAATGGGGATGGCTGG + Intergenic
1018033737 6:159864728-159864750 TGTTGGGGAATGGGGGGGCTAGG + Intergenic
1018324252 6:162648027-162648049 TAGTTGGGAATGGGTGATGTGGG - Intronic
1019105054 6:169660864-169660886 GAGTGGGGAGTGTGGGCGTTGGG + Intronic
1019241536 6:170666919-170666941 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1019294323 7:266006-266028 TGCTGGGGAATGCGGGTGGTGGG + Intergenic
1019500511 7:1362297-1362319 AAGTGGGGGAAGGGGGAGGTGGG - Intergenic
1019788043 7:2991920-2991942 TAGTGGGGAAAGGGTGGGATGGG - Intronic
1020035240 7:4959860-4959882 GAGTGGGAAATGGGGGTGTTGGG + Intergenic
1021376303 7:19911429-19911451 CAGTGGGGAGTGGGGATGGTAGG + Intergenic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1025609611 7:63066863-63066885 TAGTGAGGGATGGGGGAGGAAGG + Intergenic
1026110186 7:67453363-67453385 CAGTGGGGGTTGGGGGGGGTGGG + Intergenic
1026577292 7:71582933-71582955 TATTGGGGAACGGGGGTGTTTGG - Intronic
1027250561 7:76396152-76396174 GAGTGGGGAATGGGGCAGGAGGG + Intronic
1028664145 7:93320753-93320775 GAGAGGGGAATGGTGGTGGTGGG + Intronic
1028859678 7:95634770-95634792 TACTGGGGAATGGGGTTGCTGGG - Intergenic
1030998769 7:116390201-116390223 GAGTGGGGAAGGGGTGAGGTGGG + Intronic
1034847563 7:154460988-154461010 TAGTGGTGGATGGTGGGGGTGGG - Intronic
1035305562 7:157929234-157929256 TACTGGGGAAGAGGGGCTGTGGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035506580 8:141177-141199 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1035596738 8:864174-864196 TACTGGGGACTAGGGGAGGTGGG + Intergenic
1035679764 8:1479267-1479289 AGGCGGGGATTGGGGGCGGTGGG + Intergenic
1035709887 8:1705185-1705207 GAGTAGGGAGTGGGGGAGGTGGG + Exonic
1036213764 8:6863150-6863172 TGGTGGGGAGTGGGGGAGGCTGG + Intergenic
1037480844 8:19303801-19303823 TAGTGAGGAATGGGGAGGGAGGG - Intergenic
1037748906 8:21667318-21667340 GAGTGGCGAGTGGGGGCAGTGGG + Intergenic
1038231721 8:25706751-25706773 TGGTGGGGGGTGGGGGTGGTGGG - Intergenic
1038310979 8:26445999-26446021 TACTAGGCAATGGGGGCGGGGGG - Intronic
1038816382 8:30909398-30909420 GAGGGGGGAGTGGGGGCGGGGGG - Intergenic
1039831729 8:41220895-41220917 TAGGGGGAAATGGGTGAGGTTGG - Intergenic
1041599873 8:59704321-59704343 TTATGGGGGATGGGGGTGGTGGG + Intergenic
1042542236 8:69918922-69918944 TTGTGGGGGTTTGGGGCGGTGGG + Intergenic
1042611980 8:70609230-70609252 TAGTGGGGAAGCGGGGTGATAGG - Intronic
1044653554 8:94524143-94524165 TAGTGGGGCATGGTGGCGCATGG - Intronic
1045244290 8:100429450-100429472 TAGGGGGGAAGGGGTGAGGTGGG - Intergenic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1045661785 8:104445627-104445649 TAGTGGGGAGGGATGGCGGTGGG + Intronic
1047255892 8:123213246-123213268 TGGTGGGGAATGGGGCTGGCAGG - Intergenic
1048822633 8:138393958-138393980 AAGTGGGGTTTGGGGGCAGTTGG + Intronic
1049222443 8:141434224-141434246 GGCTGGGGAATGGGGGTGGTGGG - Intergenic
1049237333 8:141518786-141518808 CGGCGGGGAAGGGGGGCGGTGGG + Intergenic
1049367475 8:142247517-142247539 TAGTGGGGGGTGGGGGCAATTGG + Intronic
1049414013 8:142487274-142487296 CAGCGGGGAATGGGGGCAGACGG - Intronic
1049424003 8:142529407-142529429 CAAGGGGGTATGGGGGCGGTTGG - Intronic
1052801198 9:32969775-32969797 TAGTTGGGGGTGGGGGCAGTGGG + Intergenic
1053071414 9:35104295-35104317 GAGTGGGGAATGGGGTAGTTTGG + Exonic
1056742260 9:89267622-89267644 TTGTGGGGGGTGGGGGGGGTTGG + Intergenic
1057245562 9:93451789-93451811 TAGGGGGGACTGGGGCGGGTCGG - Exonic
1058177970 9:101760167-101760189 TAGTGGTGAATGGGGTAGGGAGG - Intergenic
1058419659 9:104821604-104821626 TAGAAAGGAATGGGGGCGGTGGG - Intronic
1059394352 9:114024728-114024750 TAATGGGGGATGGGGGTGGGGGG - Intronic
1059480562 9:114586262-114586284 TAGTGGGGGATGGAGGCGGTGGG - Intergenic
1059660371 9:116394179-116394201 AAGTGTGGAAGGTGGGCGGTGGG + Intronic
1059686380 9:116640959-116640981 TTGTGGGGAATGGGTGCAGGTGG + Intronic
1059865790 9:118512630-118512652 TAGTGGGTGATGGGGGCTGCTGG - Intergenic
1059887892 9:118767526-118767548 TAGTGGGTAATGGAGGTGGGGGG - Intergenic
1060145317 9:121247873-121247895 TGGTGGGCACTGGGGGTGGTGGG - Intronic
1061246002 9:129401569-129401591 TAGTGGGGCAAGGGGGTGGGAGG + Intergenic
1061337858 9:129953815-129953837 AGGAGGGGAATGGGGGTGGTGGG + Intronic
1061539136 9:131268269-131268291 CAGTGTGGAATGGGGGCTCTTGG - Intronic
1061623510 9:131826715-131826737 TAGGGAGGGATGGGGGAGGTGGG - Intergenic
1061761875 9:132857129-132857151 AGGTGGGGGAAGGGGGCGGTAGG - Intronic
1061876387 9:133546236-133546258 TGGTGGGGAGTGGGGGCTGCAGG + Intronic
1062349245 9:136131145-136131167 TAGTAGGGAATGGGGCAGGTGGG + Intergenic
1203601728 Un_KI270748v1:16153-16175 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1186682360 X:11889207-11889229 TAGTGGGGAATGTGAGAAGTTGG - Intergenic
1186998867 X:15154492-15154514 TGGTGGGGAATGGAGGAGTTTGG + Intergenic
1189834458 X:45005966-45005988 TGGTGGGGGGTGGGGGGGGTGGG - Intronic
1190328057 X:49218774-49218796 TGGTGGGGGTTGGGGGAGGTGGG + Intronic
1192034469 X:67547002-67547024 TAGTGAGAATTTGGGGCGGTTGG - Intronic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1194857318 X:98949421-98949443 TAGTGAAGAATGGGGGTAGTGGG + Intergenic
1195808080 X:108798051-108798073 TAGTGGGGATTGAGGGAGCTTGG - Intergenic
1198170366 X:134099428-134099450 TGGTGGGGGGTGGGGGCGGAAGG - Intergenic
1198518698 X:137431397-137431419 TAGTTGGGAATGGGGCTGGATGG - Intergenic
1199201645 X:145096962-145096984 TAGTGGGGAATATGGGTTGTAGG + Intergenic
1200165022 X:154029907-154029929 TGGTTGGGAGTGGGGGAGGTGGG + Intronic