ID: 1149894198

View in Genome Browser
Species Human (GRCh38)
Location 17:60416444-60416466
Sequence CTGGCAGGTGAGGGGGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 446}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149894198_1149894208 5 Left 1149894198 17:60416444-60416466 CCCACAACCCCCTCACCTGCCAG 0: 1
1: 0
2: 1
3: 35
4: 446
Right 1149894208 17:60416472-60416494 TAAAGTATATGGCACATATTTGG 0: 1
1: 0
2: 10
3: 83
4: 589
1149894198_1149894205 -6 Left 1149894198 17:60416444-60416466 CCCACAACCCCCTCACCTGCCAG 0: 1
1: 0
2: 1
3: 35
4: 446
Right 1149894205 17:60416461-60416483 TGCCAGATGCCTAAAGTATATGG 0: 1
1: 0
2: 1
3: 10
4: 87
1149894198_1149894212 28 Left 1149894198 17:60416444-60416466 CCCACAACCCCCTCACCTGCCAG 0: 1
1: 0
2: 1
3: 35
4: 446
Right 1149894212 17:60416495-60416517 ATTAAAAAAAATGTGGTGGAGGG 0: 1
1: 0
2: 15
3: 100
4: 944
1149894198_1149894210 24 Left 1149894198 17:60416444-60416466 CCCACAACCCCCTCACCTGCCAG 0: 1
1: 0
2: 1
3: 35
4: 446
Right 1149894210 17:60416491-60416513 TTGGATTAAAAAAAATGTGGTGG 0: 1
1: 0
2: 4
3: 73
4: 563
1149894198_1149894211 27 Left 1149894198 17:60416444-60416466 CCCACAACCCCCTCACCTGCCAG 0: 1
1: 0
2: 1
3: 35
4: 446
Right 1149894211 17:60416494-60416516 GATTAAAAAAAATGTGGTGGAGG 0: 1
1: 0
2: 10
3: 71
4: 688
1149894198_1149894209 21 Left 1149894198 17:60416444-60416466 CCCACAACCCCCTCACCTGCCAG 0: 1
1: 0
2: 1
3: 35
4: 446
Right 1149894209 17:60416488-60416510 TATTTGGATTAAAAAAAATGTGG 0: 1
1: 0
2: 8
3: 129
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149894198 Original CRISPR CTGGCAGGTGAGGGGGTTGT GGG (reversed) Intronic
900005018 1:39490-39512 ATGGCAGAGGTGGGGGTTGTGGG - Intergenic
900316092 1:2057148-2057170 CGGGCAGGTGAGGTGGCTGGTGG - Intronic
901011849 1:6206696-6206718 CGGGCAGGTGAGGCGGCCGTCGG - Exonic
901254279 1:7807815-7807837 CTGGCAGGTAAGGGGGAAGCAGG - Intronic
901266479 1:7914327-7914349 GTGGCGGGTGGGGGGGATGTGGG - Intergenic
901513604 1:9730745-9730767 ATGCCAGGTGACGGGGCTGTGGG - Intronic
901932448 1:12604155-12604177 GTGGCAACTGAGGGGGTTGCAGG - Intronic
902374066 1:16022057-16022079 CTGACAGGTGAGGGGTCTCTGGG + Exonic
902380910 1:16051814-16051836 CTGGCAGGTGAGTGGGTCAGGGG + Exonic
902568721 1:17332802-17332824 CAGGCTGGGGAGGGGGTGGTCGG + Intronic
903690190 1:25167795-25167817 CTGGCAGATGAGGAGGTAGATGG + Intergenic
903832606 1:26183891-26183913 AAGGCAGGTGTGGGGGTGGTGGG - Intronic
903884314 1:26532038-26532060 GAGGCAGGTGAGGGGCTGGTGGG + Intronic
904913670 1:33954141-33954163 CTCTCAGGGGAGGGGGTTGAAGG - Intronic
904986113 1:34550024-34550046 CTGGCAGGAGCGGGGCTGGTGGG - Intergenic
905177832 1:36149163-36149185 CAGGCAGGTGAGGGGACCGTCGG - Intronic
905230807 1:36514014-36514036 TTGGGAGGAGTGGGGGTTGTGGG + Intergenic
905279663 1:36841142-36841164 CAGGCAGGTGAGGGGGTGGGGGG - Intronic
905441474 1:37999056-37999078 CTGGCAGGTGAAGGGTTCATCGG + Exonic
905526239 1:38642064-38642086 ATGGCAGGTGAGGGTGGTCTTGG + Intergenic
905818104 1:40967692-40967714 CTGGCAGGGTAGGGGTTTGGGGG - Intergenic
906851135 1:49251410-49251432 CTGGCAGGGGTGGGGCTTGCTGG - Intronic
907370873 1:54002654-54002676 CTGGCAGCTGAGGGAGTTCCTGG - Intergenic
907733837 1:57092663-57092685 CTGGCGGGGGAGGGGGGTGGGGG + Intronic
907960440 1:59275158-59275180 CTGGGAGGTGAGTGGGTCATGGG + Intergenic
909677112 1:78250901-78250923 CTGGCAGATGTGGGGCTAGTGGG + Intergenic
910147654 1:84101477-84101499 CTGACAGGTTTGGGGGTTGGTGG + Intronic
910520451 1:88115767-88115789 CTGGGAGGTGGTGGGGTAGTGGG - Intergenic
910864732 1:91777618-91777640 CAGGCATGTTAGGGGGATGTGGG - Intronic
912544329 1:110440244-110440266 CTGACAGGTGACAGGGTGGTGGG + Intergenic
913197765 1:116472136-116472158 TGGGCAGGTGAGGGGGAAGTAGG - Intergenic
914725296 1:150322024-150322046 CTGCGAGGTGCGGGGGTAGTGGG - Intronic
914746365 1:150504515-150504537 CTGGCAGGAGAGGGTGTGGAGGG - Intronic
914875975 1:151512903-151512925 GTGGGAGGTGATGGGGGTGTAGG + Intronic
915282991 1:154835407-154835429 CTGGCAGGTGTGGGGGCAGAGGG - Intronic
915362245 1:155293161-155293183 CTGGCCGGTGAGGGGGATATTGG - Exonic
915594352 1:156887817-156887839 AGGGCTGGTGAGGGGTTTGTGGG - Intergenic
915891625 1:159779303-159779325 GTGGGAGGTCAGGGGGTTGGGGG + Intergenic
915901076 1:159847142-159847164 CTGGCAGGTGTGTGGGTGGGAGG - Intronic
916424313 1:164666131-164666153 CTGGGAGGTGAGGGATTCGTGGG - Intronic
916973496 1:170049364-170049386 CTGGCAGGAGGGGTGGCTGTGGG + Intronic
920032972 1:203048436-203048458 CTGGCAGGTGAAGGGGGAGGTGG + Intronic
920106550 1:203557328-203557350 CCTGCAGGTGAGGGCCTTGTGGG + Intergenic
920501584 1:206488587-206488609 AGGGCTGGTGAGGGGGTTGGAGG + Intronic
920564761 1:206964457-206964479 GTGGGAGGTGATTGGGTTGTGGG + Intronic
920666774 1:207968721-207968743 CAGGCAGGCGTGGGGGTTGTTGG - Intergenic
920787098 1:209051818-209051840 CTGGCAGGGGTGGGGCTTGCTGG - Intergenic
921860034 1:220033097-220033119 CTGGGAGGTTAGGGAGTAGTGGG - Intronic
922209920 1:223479031-223479053 TTGGGAGGTGAGGAGGTTGGGGG + Intergenic
922209950 1:223479110-223479132 TTGGGAGGTGAGGAGGTTGGGGG + Intergenic
922212491 1:223496617-223496639 CTGGTAGGTGGGTGGGGTGTGGG - Intergenic
924588519 1:245380896-245380918 CTGGGAGGTGGGGAGGTTGGTGG + Intronic
1063357343 10:5412996-5413018 CTGGGAGGTGAGTGGGGGGTGGG + Intronic
1063425443 10:5946883-5946905 CTGGAAGGTGAGTTGGATGTAGG + Intronic
1063581975 10:7316366-7316388 CAGGCAGGTGAGGGGCTGGGTGG + Intronic
1066184299 10:32994252-32994274 CTGGTAGGGGAGGGGGATGGTGG - Intronic
1067134925 10:43599580-43599602 GTGGGAGGTGATTGGGTTGTGGG - Intergenic
1067703519 10:48590284-48590306 CTGGCAGATGTGGAGGCTGTGGG + Intronic
1068116094 10:52739463-52739485 CAGGCTTGTGGGGGGGTTGTGGG + Intergenic
1069631762 10:69901582-69901604 CTGGCAGGTGTGGGAGCTCTAGG - Intronic
1069950415 10:72014744-72014766 CTGGCAGCTGAGGGGTGGGTGGG - Intergenic
1070257722 10:74825848-74825870 CTGGCAGGGTAGGGGTGTGTTGG + Intronic
1070439633 10:76430831-76430853 GAGGCAGAGGAGGGGGTTGTGGG - Intronic
1070655524 10:78268630-78268652 CTGGGGGGTAAGGGGGTTGGAGG - Intergenic
1070751223 10:78965198-78965220 CTGGCAGGGGAGGGGGCTGCGGG - Intergenic
1071532464 10:86400616-86400638 CTGGAAGGTGAGGGTGTGGGAGG - Intergenic
1071935655 10:90527127-90527149 CTGGGAGCTGAGGGGGTGGGGGG + Intergenic
1072082730 10:92047986-92048008 CTTCCAGGTGAGGAGGGTGTTGG + Intronic
1072223663 10:93348560-93348582 TTGGAAGGTGAGGGAGGTGTGGG + Intronic
1072320627 10:94246211-94246233 CTGGCTGGGGAGGCAGTTGTGGG - Exonic
1073150166 10:101306006-101306028 GTTGCAGGGGAGTGGGTTGTTGG + Intergenic
1073233787 10:101995709-101995731 CTGGCAGATGAGAGGGTGGGTGG - Intronic
1073403371 10:103276777-103276799 CTGGGAGGTTAGGGGTTTCTGGG - Intergenic
1073591758 10:104764558-104764580 CTGCCTGGTGAGGTAGTTGTAGG + Intronic
1074524419 10:114251710-114251732 CAGGAAGGTGAGGGGCTCGTGGG + Intronic
1075548207 10:123372173-123372195 AAGGCAGGTGAGGGTGATGTTGG + Intergenic
1075651152 10:124128955-124128977 CTGGCCGGTGAGCTGGGTGTGGG + Intergenic
1075998190 10:126894935-126894957 TTTGCAGGGGAGGGGTTTGTAGG - Intergenic
1076839856 10:133040618-133040640 GTGGCAGGGGGGGGGGCTGTGGG + Intergenic
1076843623 10:133058379-133058401 CAGGCAGGTGAGGGGCCTGCAGG + Intergenic
1076997761 11:307279-307301 CTGACAGAAGAGGGGGCTGTGGG - Intergenic
1077295408 11:1824086-1824108 CTGGCAGGTGAGGGCATGGGTGG - Intergenic
1077543531 11:3158934-3158956 CCCGCAGGTGTGGGGGTTGCGGG + Intronic
1077892810 11:6431625-6431647 ATGGCAGGTGAGGGGCTTCTGGG - Exonic
1078710050 11:13782791-13782813 CGAGCATGTGAAGGGGTTGTGGG - Intergenic
1078891652 11:15563282-15563304 CTGGCAGGAGAGGCCCTTGTGGG + Intergenic
1080055658 11:27903960-27903982 CTTGGAGGTGAGGGGAGTGTGGG + Intergenic
1083174119 11:60938747-60938769 CGGGCAGGTGAGTGGGTAGGAGG - Intronic
1083544486 11:63538357-63538379 GGGGCTGGTCAGGGGGTTGTGGG + Intronic
1083628142 11:64082429-64082451 CAGGCAGGTGAGGGGCTTGAGGG + Intronic
1083738865 11:64697257-64697279 CTGGCAGAGTAGGGGGTTGGAGG - Intronic
1083818600 11:65152451-65152473 CTCCCAGGTGAGGTGGTTTTAGG + Intergenic
1083918936 11:65770033-65770055 TTTGCAGGGGTGGGGGTTGTGGG + Intergenic
1084063191 11:66688850-66688872 CTGGCAGGATCGGGGGTTGCAGG + Intronic
1084891094 11:72237542-72237564 CTGGCTGGTGAGGGGCCTGGGGG - Exonic
1084932912 11:72571172-72571194 CAGGCAGGTGAAGGAGTTGAAGG - Intergenic
1084934467 11:72579518-72579540 CCGGAAGGTGATGGGGTTGGGGG - Exonic
1085626713 11:78079531-78079553 CTGGGAGGAGAAGGGGTCGTAGG - Intronic
1085640361 11:78189151-78189173 CCGGGAGGTAAGGGGGTTGGGGG + Exonic
1085746801 11:79122077-79122099 CTGGTTGGTGAGGGGTTTGTGGG + Intronic
1085986666 11:81795952-81795974 CTGGTTGGTGTGGGAGTTGTGGG - Intergenic
1086211470 11:84325355-84325377 TTGGAGGGTGAGGGGGTTGGGGG - Intronic
1087890005 11:103527289-103527311 TTGGCAGGTGAGTAGGTTATTGG - Intergenic
1088313798 11:108487211-108487233 CTGGAAGGGGTGGGGGTGGTTGG - Intronic
1091379000 12:43669-43691 ATGGCAGAGGTGGGGGTTGTGGG - Intergenic
1091441900 12:517481-517503 GTGGGAGGCGAGGGGGTTGGAGG + Intronic
1091930712 12:4393175-4393197 CTGGGCGGTGAGAGGCTTGTTGG - Intergenic
1093752801 12:22819902-22819924 GTGGCAGGAGTGGGGGTTATGGG + Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094374211 12:29773270-29773292 CTGGCACCAAAGGGGGTTGTGGG + Intronic
1095085309 12:38053501-38053523 CTGGGAGGCGGGGGGGTTGGGGG + Intergenic
1096099043 12:48957636-48957658 GGGGCAGGTGTGGGGGCTGTGGG + Intergenic
1096982636 12:55737231-55737253 CTGCCAGGTGAGGGAGCTGTTGG - Intergenic
1097009394 12:55941462-55941484 ATGGCAGGCGCGGGGGTTGGGGG - Intronic
1097913325 12:64994114-64994136 CTGTCAGGGGAGGGGTGTGTGGG + Intergenic
1098024300 12:66186599-66186621 CTGTCAGGGGAGGGGGTAGGGGG - Intergenic
1098242613 12:68484004-68484026 TTTGGAGTTGAGGGGGTTGTTGG + Intergenic
1099019424 12:77384902-77384924 CATGCAGGTGAGCCGGTTGTAGG - Intergenic
1099760177 12:86911430-86911452 GTGGAAGGTGAAGGGGATGTAGG - Intergenic
1099906533 12:88778010-88778032 ATGGGAGGTGAGGGGTTTATAGG - Intergenic
1103446982 12:121001003-121001025 CAGGCAGGTGGGGTGGGTGTGGG + Intronic
1103740007 12:123084610-123084632 CTGGCATGAGAGGAGGTAGTAGG - Intronic
1103974492 12:124693523-124693545 CAGGCCGGTGAGGGGCTTGGGGG + Intergenic
1104111738 12:125710806-125710828 CTGTCAGGTGTGTGGGCTGTGGG + Intergenic
1104167446 12:126247275-126247297 CTGGAAGGAGTGGGGGTTGGAGG + Intergenic
1104939923 12:132390228-132390250 CTGGCAGGTGACAGGGTGGGCGG + Intergenic
1104954528 12:132457774-132457796 CGGGCAGGTGAGTGGGTGGGTGG + Intergenic
1104954575 12:132457922-132457944 CAGGCAGGTGAGCGGGTGGGTGG + Intergenic
1104954602 12:132457998-132458020 CGGGCAGGTGAGCGGGTGGGTGG + Intergenic
1105054084 12:133081066-133081088 CTGTTAGGTGAGGGGGTTCTGGG + Exonic
1106486562 13:30178153-30178175 CCGGCAGGTGAGGGGCAGGTGGG + Intergenic
1107750251 13:43557591-43557613 CTGGCTGGTGAGGTGGAAGTGGG - Intronic
1109889056 13:68583107-68583129 GTGGCAGGGGTGGGGGGTGTCGG - Intergenic
1110327359 13:74232126-74232148 CTGGCAGAGGAAGAGGTTGTGGG + Intergenic
1110946961 13:81433958-81433980 CTGGGAGGTGATTGGGTCGTGGG - Intergenic
1113124149 13:106957825-106957847 CTGACAGGTGAGGAGATTGTTGG + Intergenic
1113218279 13:108068965-108068987 TGGGGAGGTGAGGGGGTTGGGGG - Intergenic
1117288009 14:54306233-54306255 CTGGCTGTTGTGGGGATTGTGGG + Intergenic
1118383960 14:65239804-65239826 CTGGAAGCTCAGAGGGTTGTCGG - Intergenic
1118489923 14:66249036-66249058 CTGGAGGGTGAGGGGGAGGTGGG + Intergenic
1118745604 14:68770856-68770878 CTGGCAGGTGAGGGTCCTCTGGG - Intergenic
1118870475 14:69737010-69737032 CGGGCAGGGGAGGGGGGTGGCGG + Intronic
1119086935 14:71747643-71747665 ATGGTAGGTGAGGGTGTTGTCGG + Intergenic
1119599875 14:75968390-75968412 TTGGCAGCTGTGGGGGTGGTGGG + Intronic
1121055226 14:90846408-90846430 CAGGGTGGTGAGGGGGTTTTGGG - Intergenic
1121144659 14:91573800-91573822 CTGGCAGGAGAGGAGGAGGTTGG + Intergenic
1121144677 14:91573873-91573895 CTGGCAGGAGAGGAGGAGGTTGG + Intergenic
1121144688 14:91573910-91573932 CTGGCAGGAGAGGAGGAGGTTGG + Intergenic
1121473283 14:94173737-94173759 CTGACGGGGGAGGGGGCTGTGGG - Intronic
1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG + Intergenic
1121691952 14:95884339-95884361 CTGGCAGCTGGGTGGGTTCTAGG - Intergenic
1122404888 14:101494525-101494547 CTGGCAGGGGAGGCAGTAGTGGG + Intergenic
1122414329 14:101541596-101541618 CAGGCAGGTGAGGGCGTGGAGGG + Intergenic
1122422572 14:101586868-101586890 CTGGCATGTGACGGGGTGGCGGG - Intergenic
1122587452 14:102819144-102819166 GTGGCAGGGGAGGGGGTCTTGGG - Intronic
1122598579 14:102909613-102909635 CTGGCAGGTGGTGGGCCTGTGGG - Exonic
1122604654 14:102940083-102940105 CTCGCAGTTGAGGAGGTTGAGGG + Exonic
1124064061 15:26323217-26323239 CTGGCTGGTGAGTGGGTGGTAGG + Intergenic
1124375082 15:29124625-29124647 CTGGGAGGTGGGGCGGGTGTTGG - Intronic
1124441236 15:29687845-29687867 CTGTCAGGTGGGGCTGTTGTTGG + Intergenic
1124510884 15:30323799-30323821 CCAGCAGGTGAGGGGTTTGCTGG - Intergenic
1124629660 15:31329128-31329150 GTGGCAGGTGATGGGGTAGAGGG + Intronic
1124732004 15:32206732-32206754 CCAGCAGGTGAGGGGTTTGCTGG + Intergenic
1125533522 15:40429176-40429198 CTGGCAGGGGATGGAGTGGTGGG - Intronic
1127188747 15:56507267-56507289 CTGGCAGGGGAGGGGATTGCTGG - Intergenic
1128325499 15:66721398-66721420 CTGTTAGATGAGGGTGTTGTTGG - Intronic
1129172357 15:73816072-73816094 CAGCCAGGTGAGGTGGTTGCTGG + Intergenic
1129524080 15:76203163-76203185 CTGGCAGGGGTGGGGGCTGCGGG - Intronic
1129772070 15:78208736-78208758 CTGGGAGGCGAGGGGGATCTGGG - Intronic
1129996982 15:80015446-80015468 CTGGGAGGTGATTGGATTGTGGG - Intergenic
1130260975 15:82354023-82354045 TTGGGGGGTGGGGGGGTTGTGGG + Intergenic
1131083219 15:89554333-89554355 CTCACAGGTGAGGGGTTTCTGGG + Intergenic
1131558673 15:93420665-93420687 CTGGCAGGTGACAGGGTTGGAGG + Intergenic
1132119797 15:99167002-99167024 TTTGGAGGTGAGGGGGTTGGGGG - Intronic
1132448494 15:101951454-101951476 ATGGCAGAGGTGGGGGTTGTGGG + Intergenic
1132606723 16:796755-796777 CTGGTAGGTGAGGGGCTTGCGGG - Exonic
1133160345 16:3907733-3907755 CTGACAGGTGACTGGGGTGTGGG + Intergenic
1135739088 16:24957880-24957902 CACGGAGGTGAGGGGGCTGTGGG + Intronic
1137652664 16:50133885-50133907 CTGGCTGATGAGGGGGTGGCTGG + Intergenic
1137742632 16:50795397-50795419 CAGGCAGGATAGTGGGTTGTAGG + Intronic
1139549947 16:67667519-67667541 CTGTCAAGTGAGGGGGCTCTCGG + Exonic
1140409049 16:74730302-74730324 GTGGCAGGGGTGGGGGTTGGGGG + Intronic
1140712190 16:77688988-77689010 CTGGCAGGTGAGGAGCCTGGGGG - Intergenic
1141263558 16:82475521-82475543 ATGGGAGGTAAGGGGGTGGTGGG - Intergenic
1141713899 16:85716231-85716253 CTCGGAGGAGAGGGGGTTGGAGG + Intronic
1141720397 16:85752297-85752319 CTGGCCGGTGCTGGGGTGGTGGG + Intergenic
1141829462 16:86501696-86501718 CTGGCAGGGGTGGGGGTGGGGGG - Intergenic
1143476968 17:7208413-7208435 CTGGCGGGAGAGGGGGCTGTTGG - Intronic
1143578190 17:7807407-7807429 CCTGGAGGTGAGGGGGTTGGTGG + Intronic
1143825988 17:9607829-9607851 CTGGCAAGTGAGCTTGTTGTTGG + Intronic
1143982291 17:10880347-10880369 CTGGTTGGTGAGGGTGTTGGTGG + Intergenic
1144916497 17:18727752-18727774 CTTGGAGGTATGGGGGTTGTGGG + Exonic
1145972294 17:28963500-28963522 CAGGCAGGTGAGGGTGTTTAGGG - Intronic
1146775058 17:35606683-35606705 CCAGCAGGAGAGGGGGTTGGAGG - Intronic
1148050002 17:44765211-44765233 CTGGCAGGTGGGTGGGTGGGTGG + Intronic
1148118232 17:45190658-45190680 CTGCCTGGTGAGGGAGTTGCTGG + Intergenic
1149894198 17:60416444-60416466 CTGGCAGGTGAGGGGGTTGTGGG - Intronic
1150644638 17:66970288-66970310 GGGGCAGGTAAGGGGGTTGTTGG + Intronic
1151436642 17:74101702-74101724 CTGGCAGGGGAGGGGAATGAAGG + Intergenic
1151556513 17:74849562-74849584 CTGCCAGGTGAGGGTGGGGTTGG - Intronic
1151575847 17:74952234-74952256 CCGGCAGGGCCGGGGGTTGTGGG - Intronic
1151656707 17:75499611-75499633 CTCACAGGTGAGGGGGTTTAGGG - Exonic
1151765680 17:76132178-76132200 AGGGCAGGTGAGGGGCTGGTGGG + Intergenic
1152026687 17:77814258-77814280 CTGGCAGGTGGCAGGCTTGTTGG - Intergenic
1152069172 17:78126645-78126667 CTGGCTGCAGAGGGGGTTGGCGG + Exonic
1152592965 17:81222734-81222756 CGGGCAAGGGAGGGGGTTGCAGG - Intronic
1152631314 17:81411824-81411846 CGGGGCGGTGAGGGGCTTGTCGG - Intronic
1155703540 18:28779273-28779295 CAGGCAGATGAGCGGGTTGTGGG - Intergenic
1155839487 18:30628878-30628900 CAAGCAGCTGAGGGGATTGTTGG - Intergenic
1155887711 18:31228204-31228226 CTGGGAGGTGAGTGGGTTCTTGG + Intergenic
1156574504 18:38298965-38298987 GTGGCAGGGGTGGGGGTTGGAGG + Intergenic
1157378932 18:47193235-47193257 CTGGCAGGTGGGTGGGAAGTGGG - Intergenic
1157712993 18:49862894-49862916 CTGGCTGGGGAGGGGGGTGGGGG - Intronic
1158653139 18:59305563-59305585 CTGGGAGATGATGGGCTTGTCGG + Intronic
1160367064 18:78335460-78335482 AGGGCAGGTGAGGGGCTTATGGG + Intergenic
1160636771 19:81099-81121 ATGGCAGAGGTGGGGGTTGTGGG - Intergenic
1161020930 19:2011204-2011226 TTGGCAGGTGAGGGCGTGGGGGG - Intronic
1161153340 19:2720781-2720803 CTGGCCGGTGAGGGGTTTGATGG + Intronic
1161285213 19:3464873-3464895 CGGGCGGGGGAGGGGGTGGTCGG + Intronic
1161449828 19:4338854-4338876 CTGGCAGGGGAGGGAGTTGACGG - Intronic
1161496743 19:4590725-4590747 CAGGCAGGTAAGGGGGCTTTTGG + Intergenic
1161572776 19:5039633-5039655 CTAGCAGGTGAGGCCCTTGTTGG + Intronic
1162019435 19:7862012-7862034 CTGGCAGGTGAGGGCCGGGTGGG + Exonic
1162032293 19:7922754-7922776 CTGCCAGGTGAGGGGCATGGCGG + Exonic
1162531968 19:11241395-11241417 ATGGGAGGTGAGGTGGCTGTCGG + Intronic
1162925028 19:13926584-13926606 CCCCCAGGTGAGGGGGCTGTAGG + Exonic
1163396379 19:17065352-17065374 CTGGCAGGTGAAAGGAGTGTGGG - Intronic
1163598487 19:18233964-18233986 CTGGCATGGGTGGGGGTTTTAGG - Intronic
1164828890 19:31305164-31305186 GTGGCAGGAGAGGGGGTGGCTGG - Intronic
1165108092 19:33486310-33486332 CTGGCAGGAGGGGTGGGTGTGGG - Intronic
1165682875 19:37792402-37792424 CTGGAAGAGGAGGGGGTGGTGGG + Intronic
1165855634 19:38878113-38878135 GTGGCAGGAGAGGAGGCTGTGGG + Intronic
1166990482 19:46689861-46689883 CTGGCAGGTGGGGTGGAGGTGGG - Intronic
1167521397 19:49958267-49958289 CTACCAGGTGAGGGGACTGTGGG - Exonic
1168251289 19:55143695-55143717 CTGGCAGCTCACGGGGCTGTCGG - Intronic
925419825 2:3703332-3703354 CGGGCAGGTGAGGGGCGTGGCGG - Intergenic
926316926 2:11716573-11716595 CAAGCAGGGGAGGGGGTAGTGGG + Intronic
928507190 2:31965808-31965830 GTGGCCTGTCAGGGGGTTGTGGG + Intronic
928511930 2:32010596-32010618 CTGGGAGGGGAGGGGGCCGTGGG - Intronic
929490529 2:42392261-42392283 CTGGCAGGGCAGGGAGATGTGGG - Intronic
931119640 2:59201772-59201794 ATGGCAGGTGTGGGGGTTGAGGG - Intergenic
932759418 2:74429790-74429812 CAGGCAGCTGAGGGTGGTGTCGG + Intronic
933805763 2:85997261-85997283 CTGGCAGGGGAGGGACTTCTGGG - Intergenic
933877508 2:86633470-86633492 CTGGCAGAGGTGGGGGTTGGGGG - Intronic
934624166 2:95833976-95833998 CTGGCAGGGGTGGGGGGAGTTGG + Intergenic
935673069 2:105571977-105571999 CTGGCAGGTGAGTGGGGAGAGGG - Intergenic
936564705 2:113573942-113573964 ATGGCAGAGGTGGGGGTTGTGGG + Intergenic
936647591 2:114389338-114389360 TTGGCAGGTGAGTGGGTGCTGGG - Intergenic
936656823 2:114498317-114498339 CTGGCAGGGGAGGGGGAGGGAGG - Intronic
937216520 2:120316736-120316758 CGGGCAGGGGTGGGGTTTGTGGG + Intergenic
938155497 2:128936079-128936101 TTGGGAGGTGAGGGGATTGCTGG + Intergenic
938230819 2:129657298-129657320 GTGGCGGGGGAGGGGGTTGCGGG - Intergenic
939387903 2:141525177-141525199 CTGGCACATGAGTGGGTTTTAGG + Intronic
941324127 2:164091847-164091869 CTGGCAGGTGGGGAGGGGGTGGG - Intergenic
942395136 2:175539136-175539158 ATGGAAGGTGAGGGTGTAGTGGG - Intergenic
942849837 2:180471657-180471679 CTGGAAGCAGAGGGGGTTCTAGG - Intergenic
943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG + Intergenic
943714388 2:191134311-191134333 CAGGCAGGTGTGTGGGTTCTTGG - Intronic
944451924 2:199852022-199852044 TTGGCAGGTAGGAGGGTTGTTGG + Intergenic
945808610 2:214520645-214520667 CTGGCAAGTGTGAGAGTTGTGGG - Intronic
945882887 2:215344865-215344887 CGGGCAGGTAAGTGGGCTGTTGG + Exonic
946148896 2:217750955-217750977 CTGCCAGGAGAGGGGGTTAATGG + Intronic
948094291 2:235321298-235321320 CTGGCCAGTGCGGGGGCTGTGGG + Intergenic
948214177 2:236216343-236216365 CAGGCAGGTGAGGGAGTTCCTGG - Intronic
948385566 2:237578545-237578567 CTGGCAGGCGAGGGGCCGGTAGG - Intronic
948852934 2:240717269-240717291 CTGGCAGGAGAGGGGCTGGGCGG + Exonic
948907275 2:240985899-240985921 CTGGCAGGTGAGGGCAGAGTGGG + Intronic
948918997 2:241052670-241052692 CAGGCAGGTGAGAGGGTCGGCGG + Intronic
1169267571 20:4175889-4175911 CTGGCGGGGGAGGGGGTGGGGGG + Intronic
1170874441 20:20237189-20237211 CTGGCAGGGGAGGGGCATGGTGG - Intronic
1171207761 20:23294486-23294508 CTGGCAGGTGAGGGTGGGGCTGG - Intergenic
1171936943 20:31283885-31283907 TTGGCAGGTTAGGGGTTTCTAGG - Intergenic
1172019170 20:31900777-31900799 CTAGCAGGTGGGGGTGGTGTAGG + Intronic
1172503417 20:35443311-35443333 CTGACAGGAGAGGGGGAGGTTGG - Intronic
1172754928 20:37276912-37276934 ATGGCAGGTAAAGGGGTTGACGG + Intergenic
1172890571 20:38260887-38260909 CTGGCTGCTGAGGGGGTGGACGG - Intronic
1173443394 20:43096831-43096853 CTGCCAGCTGAGGAGGTTGGAGG + Intronic
1173465271 20:43276028-43276050 CTGGAAGGAGAGGAGGTTGCAGG - Intergenic
1173606590 20:44336261-44336283 CTGGAAGGGGAGGGGGCTGTGGG + Intergenic
1173873793 20:46357367-46357389 CTGGCAGGAGAGGGAGCTGCGGG + Intronic
1174762131 20:53216541-53216563 CTGGCTGGTGAAGGGTTGGTTGG - Intronic
1175185153 20:57174915-57174937 CTGGCAGGTAAGGGGCTGGCTGG - Exonic
1175289999 20:57869388-57869410 CTGTCTGGTGAGGAGGTTTTGGG + Intergenic
1175568010 20:59996048-59996070 CTGGCAGGTCAGTGGTCTGTAGG + Exonic
1175688367 20:61047653-61047675 CTTGCAGGTGAGGTGGCTGGCGG - Intergenic
1175862025 20:62155672-62155694 CTGGCAGGAGATGGGGTTGGAGG - Intronic
1176094237 20:63332654-63332676 AGGGCAGCTGAGGGGGTGGTGGG - Intronic
1177466941 21:21496889-21496911 GTTGTAGGTGAGGTGGTTGTAGG + Intronic
1177949520 21:27517195-27517217 GTGGAAGGTGAGGGGGAAGTAGG - Intergenic
1178011891 21:28296764-28296786 CTGGGAGGTGATTGGGTTGGAGG - Intergenic
1178437382 21:32572083-32572105 CTGGCATGGGTGTGGGTTGTGGG + Intergenic
1178534091 21:33398296-33398318 ATGGCAGGAGTGGGGGTTGGGGG + Intergenic
1178839897 21:36130118-36130140 CTGGGAGGGGAGGGGGCCGTGGG + Intergenic
1179525171 21:41971317-41971339 CAGGCAGGGGAGGGGCTTGCTGG + Intergenic
1179912401 21:44457072-44457094 CTCGCAGTGCAGGGGGTTGTGGG - Exonic
1180193947 21:46182575-46182597 CTGGTAGATGAGGGGGTCGCGGG - Intronic
1180654493 22:17408198-17408220 CTGGGGGGTGAGGGGGCTGAGGG - Intronic
1180764183 22:18234113-18234135 CTGGGAGGTGAGGGGGACCTAGG + Intergenic
1180771459 22:18390428-18390450 CTGGGAGGTGAGGGGGACCTAGG - Intergenic
1180802841 22:18640043-18640065 CTGGGAGGTGAGGGGGACCTAGG - Intergenic
1181186275 22:21107203-21107225 ATGGCATGTCAGGGGGTTGGGGG - Intergenic
1181218877 22:21355218-21355240 CTGGGAGGTGAGGGGGACCTAGG + Intergenic
1181435954 22:22911001-22911023 CTGGCAGCTGTAGAGGTTGTGGG - Intergenic
1181961931 22:26628453-26628475 CTGGCAGGGGAGGGGCTACTGGG + Intronic
1183585303 22:38749943-38749965 CTGGCAGGTGGGGGTGGGGTAGG - Intronic
1184125306 22:42482557-42482579 CTGGCAGGTGATGGGGAGGAGGG - Intergenic
1184133790 22:42534017-42534039 CTGGCAGGTGATGGGGAGGAGGG - Intergenic
1184237220 22:43189439-43189461 CTGGAGGGGGAGGGGGTTGGTGG - Intergenic
1184497276 22:44849196-44849218 AGGGCAAGAGAGGGGGTTGTTGG + Intronic
1185168230 22:49275309-49275331 GTGGCATGGGAGGGGGTTTTGGG + Intergenic
1185341146 22:50291723-50291745 CTGGCAGGGGAGGCTGATGTAGG - Intronic
1203233298 22_KI270731v1_random:131419-131441 CTGGGAGGTGAGGGGGACCTAGG - Intergenic
949892821 3:8745888-8745910 GTGGCAGGGCAGGGGGTGGTGGG + Exonic
950426826 3:12928770-12928792 CTGCCAGGAGAGGAGGTGGTGGG - Intronic
951267680 3:20588710-20588732 CTTTCAGTTGAGGAGGTTGTGGG + Intergenic
952865587 3:37853148-37853170 GTGGCAGGGGAGGGGGAAGTGGG + Intergenic
953880832 3:46690555-46690577 CTGGTAGGGGAGGGCTTTGTTGG - Intronic
954458974 3:50615661-50615683 CTGTAAGGTCAGGGGGTTGCAGG + Intronic
954973738 3:54673885-54673907 CTGGCAGGTGAAGGGGCAGCTGG - Intronic
955687691 3:61562585-61562607 CTGGCCGGGGAGGGGGCTGGGGG + Intronic
956598567 3:70994720-70994742 CTGGCAGGCGACGGGGGTGGAGG - Intronic
958415354 3:93867478-93867500 CTGCCAGGAGTGGGGATTGTGGG - Intergenic
958978865 3:100697377-100697399 CAGGCAGGTGAAGAGGTCGTGGG - Intergenic
961491796 3:127261477-127261499 CTGGCAGCTGAGGGTGTGTTGGG + Intergenic
961723076 3:128908811-128908833 CTGGCAGGTGGTGGGTTTGGGGG + Intronic
961771444 3:129252953-129252975 CAGGCAAGTCATGGGGTTGTGGG + Exonic
962346453 3:134622824-134622846 CTGGGAGCTGAGGGGAATGTGGG - Intronic
962821680 3:139054686-139054708 CAGGCAGGTGAGTGGGTTCTTGG + Intronic
963810663 3:149773390-149773412 GAGGCAGGTGAGGGGGATGAGGG - Intronic
966423624 3:179758240-179758262 CTGGCATGTGAGAGGTTTGCTGG + Intronic
966919523 3:184602671-184602693 CAGGCAGGCAAGGGGGTGGTGGG - Intronic
968653530 4:1769196-1769218 CAGGCAGGTGTGGGGCCTGTGGG + Intergenic
969281718 4:6175112-6175134 TTGGCAGGTGAGGGGAGTTTGGG - Intronic
969326535 4:6447528-6447550 CTGGCATGTGAGTGGGGTGGGGG - Intronic
969348289 4:6582793-6582815 GTGGGGGGTGAGGGGGTGGTGGG - Intronic
970441183 4:16082658-16082680 CGCGCAGGGGAGGGGGTTGCCGG + Intronic
971969977 4:33607387-33607409 CTGGCAGGAGCGGGGCTTGCTGG - Intergenic
971972355 4:33636003-33636025 CTGGCAGGAGAGGGAGTTTGGGG - Intergenic
974723716 4:65773482-65773504 CTGGCAGGTGTGGGGCTGGCTGG + Intergenic
975621895 4:76305014-76305036 TGGGCAGGGGAGGGGGTAGTGGG + Intronic
976209800 4:82656255-82656277 CTGGCCTGTTGGGGGGTTGTGGG - Intronic
977996067 4:103498372-103498394 GTGGTGGGGGAGGGGGTTGTGGG - Intergenic
978232978 4:106423365-106423387 CTGGGAGGTGAGTGGGCTGCAGG + Intergenic
978725382 4:111963489-111963511 TTGTCAGGGGAGGGGGTGGTGGG - Intergenic
979968562 4:127106448-127106470 CGGGCAGGGGAGGGGGGTGGGGG + Intergenic
979969882 4:127121537-127121559 CTTACAGGTGATGGGGTTTTGGG - Intergenic
980825212 4:138064104-138064126 CTGACAGGTGAGTGGGTCTTTGG - Intergenic
981298750 4:143163299-143163321 CTGGTAGGTCAGAGGGTTGTTGG - Intergenic
981806171 4:148717961-148717983 CTGGCAGGTGGGGGTAATGTTGG + Intergenic
982375628 4:154687716-154687738 CAGGCAGGTGTAGGGGTTGGAGG + Intronic
983249451 4:165327758-165327780 CGTTCAGGTGAGGGGGTTGGAGG + Exonic
985579463 5:689324-689346 CTGGCAGGTGCGGCTGTTGGTGG + Intronic
985594309 5:781383-781405 CTGGCAGGTGCGGCTGTTGGTGG + Intergenic
985748936 5:1663557-1663579 CTGGGAGGTCAGGGGGTGGCTGG + Intergenic
985772900 5:1824322-1824344 CTGGCAGGTCAGGGGCCTGGTGG + Intergenic
987314566 5:16712097-16712119 GTGGCAGGTGAGGTGGGGGTGGG + Intronic
987872796 5:23642418-23642440 TTGGGAGGTGGGGGGGTTGGGGG - Intergenic
988609713 5:32712744-32712766 CAGGGAGGTGAAGGGGTTGGAGG + Intronic
988848505 5:35154981-35155003 CTGTCAGGGGAGGGGGTTCAGGG + Intronic
989168590 5:38453796-38453818 CTGGCAGTTTAGGGGGAAGTTGG - Intronic
990856929 5:60279051-60279073 CTGGCAGGTGAAGGGGCAGGTGG + Intronic
991772109 5:70050027-70050049 CTGGCTGGTGTGGGGGAGGTGGG + Intronic
991851402 5:70925445-70925467 CTGGCTGGTGTGGGGGAGGTGGG + Intronic
992613755 5:78530722-78530744 CTGGCAGGTACAGGTGTTGTTGG - Intronic
995304763 5:110631864-110631886 CAGGCAGGTGAGGGAGTTCTTGG - Intronic
995368138 5:111386863-111386885 CTGGCAGCTGAGGGACCTGTAGG + Intronic
995386172 5:111591960-111591982 ATGACAGGGGAGGGGGGTGTGGG + Intergenic
995838527 5:116421764-116421786 GTGGAAGGTGAGGGGGAAGTAGG + Intergenic
996835504 5:127787349-127787371 CTGGCAGGTGAGGAGGAGGTAGG - Intergenic
997470203 5:134113307-134113329 GTGGCGGGGGAGGGGGGTGTGGG + Intergenic
999817733 5:155194395-155194417 GTGGCATGTGAGGTGGTTTTAGG + Intergenic
1001519660 5:172381980-172382002 CTGGCAGGAGGGAGGGCTGTGGG + Intronic
1001562343 5:172677831-172677853 GTGGCTGGTGAGGGGGCTGATGG - Intronic
1001599297 5:172918770-172918792 CAGGCAGGTGGGGGGTTGGTGGG + Intronic
1001871288 5:175158109-175158131 AAGGCAGGAGAGGGAGTTGTTGG - Intergenic
1001971361 5:175957440-175957462 CTTGCAGGGGCGGGGGGTGTAGG - Intronic
1002182178 5:177436340-177436362 CAGGCAGGTGAGTGGGTGGGAGG - Intronic
1002246081 5:177886337-177886359 CTTGCAGGGGCGGGGGGTGTAGG + Intergenic
1002496149 5:179613005-179613027 GTGACAGGTGAGGGGGCTCTGGG - Intergenic
1005822402 6:29608585-29608607 CTGCCAGGTGAGGAGGTGGTGGG - Exonic
1006784583 6:36657307-36657329 ATGGAAGCTGAGGGGGTTGTGGG + Intergenic
1007109441 6:39304479-39304501 CTGGCAGGTGAGGGGGCTGCTGG - Exonic
1007393418 6:41563446-41563468 CTGACAGATGAGGGCCTTGTAGG - Intronic
1008246853 6:49186532-49186554 CTGGCTGGCTAGGGGGTTGAAGG - Intergenic
1012903915 6:105041885-105041907 CTGGCATGGGAGGGTGATGTGGG + Intronic
1013465964 6:110417341-110417363 AGGGCCGGTGAGGGGGTGGTGGG + Intergenic
1014495995 6:122123516-122123538 CTGGCAGGAGAGGTGATTGTAGG + Intergenic
1014847689 6:126298751-126298773 TTGGAAGGTGAGTAGGTTGTGGG - Intergenic
1015591036 6:134823259-134823281 CTGTGGGGTGAGGAGGTTGTAGG - Intergenic
1017701798 6:157081145-157081167 CTGGCAGGTGAGGTAATTGCAGG - Intronic
1018759623 6:166880927-166880949 CTGGAAGGTGGGGGGGTGGGAGG + Intronic
1018796391 6:167188560-167188582 CTGGCATGGGTGTGGGTTGTGGG - Intronic
1018819921 6:167366447-167366469 CTGGCATGGGTGTGGGTTGTGGG + Intronic
1018859924 6:167704062-167704084 CTGGGAGGGGAGGGGGTTCCAGG + Intergenic
1020279771 7:6644256-6644278 CTTGCAGGTGAAGGTGTTGGGGG + Intronic
1020428437 7:8095253-8095275 CTGGGGGGTGGGGGGGTTGGGGG + Intergenic
1022291697 7:29010890-29010912 TTCACAGGTGAGGGGGTTCTTGG + Intronic
1022313291 7:29218195-29218217 CTGGCGAGTGAGGGGGTGGAAGG - Intronic
1022503315 7:30895924-30895946 CTGGCAGGAGAGTGGGGTGTGGG + Intergenic
1023311911 7:38896165-38896187 TTTGCAGGTGAGGAGGGTGTTGG - Intronic
1023544928 7:41308405-41308427 TTGGCAGGTGGTGGGGTTGGGGG + Intergenic
1023698108 7:42868033-42868055 GTGGGAGGTGATTGGGTTGTGGG + Intergenic
1023948891 7:44825397-44825419 TGGGCATGTGAGGGGCTTGTAGG + Intergenic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1026218296 7:68369027-68369049 CTGACAGGTGAGGAGCTGGTTGG - Intergenic
1026622712 7:71964258-71964280 CAGGCAGGTGTAGGGGTCGTGGG + Intronic
1026796530 7:73369445-73369467 CTGGAAGGGAAGGGGGATGTGGG - Intergenic
1027932538 7:84555975-84555997 TAGGCAGGGGAGGGGGTTGATGG - Intergenic
1028346778 7:89793216-89793238 CAAGCAGGTGAAGAGGTTGTGGG + Intergenic
1028773576 7:94655687-94655709 CTGGGCGGGGAGGGGGATGTTGG + Intronic
1029510465 7:100991500-100991522 CTGGCAGAAAAGTGGGTTGTTGG - Exonic
1029510786 7:100993648-100993670 CTGGCAGGGAAGTGTGTTGTTGG - Exonic
1029511104 7:100995733-100995755 CTGGCAGAAAAGTGGGTTGTTGG - Exonic
1029511280 7:100996897-100996919 CTGGCAGGGAAGTGTGTTGTTGG - Exonic
1029511506 7:100998319-100998341 CTGGCAGGGAAGTGTGTTGTTGG - Exonic
1029511832 7:101000404-101000426 CTGGCAGAAAAGTGGGTTGTTGG - Exonic
1029512004 7:101001568-101001590 CTGGCAGGGAAGTGTGTTGTTGG - Exonic
1029512325 7:101003653-101003675 CTGGCAGAAAAGTGGGTTGTTGG - Exonic
1029512405 7:101004232-101004254 CTGGCAGAAAAGTGGGTTGTTGG - Exonic
1030389745 7:108912128-108912150 CTGGTAGGAGATGGGGTTGGGGG + Intergenic
1031776775 7:125915533-125915555 CTGGCAGGAGTGGGGGTCGCAGG - Intergenic
1031992140 7:128205422-128205444 TTGGCAGGGGAGGGGGGTGGAGG + Intergenic
1033528448 7:142240465-142240487 ATGGCTGCTGAGGGGCTTGTAGG + Intergenic
1033583932 7:142760481-142760503 CTGCCAGGAAAGGGGGTGGTTGG - Intronic
1033707738 7:143905217-143905239 GTGGTGGGTGAGGGGGTTGGAGG - Intergenic
1034313607 7:150110823-150110845 CTGGCAGGGGGGTGGGCTGTTGG + Intergenic
1034436323 7:151064377-151064399 CAGGCAGGGGAGGGGGAGGTGGG + Intronic
1034451606 7:151139960-151139982 CTGGCTGGTGAGGGGAGAGTTGG - Exonic
1035015690 7:155763925-155763947 CTGGCAGATGTGGGGGCTGCTGG - Exonic
1035238877 7:157517373-157517395 CTGGAAGGTGAGTGGGTCGGGGG + Intergenic
1036021532 8:4852271-4852293 GTGGGAGGTGCTGGGGTTGTGGG + Intronic
1037014287 8:13883243-13883265 CTGGCAGATGAGAGGGTAGGAGG - Intergenic
1037681550 8:21101865-21101887 CTGGCAGGGGAGGGAGTGGGAGG - Intergenic
1038988105 8:32835598-32835620 TTGGTAGGGGAGGGGGTTGTGGG - Intergenic
1041157558 8:55004190-55004212 CTAGCAAGGGAGGGGCTTGTGGG + Intergenic
1042752380 8:72171906-72171928 CTGTCAGGGGAGTGGGGTGTTGG - Intergenic
1045365461 8:101471610-101471632 CAGTGAGGTGGGGGGGTTGTGGG + Intergenic
1047681309 8:127257332-127257354 CTGGCATGTGATTGGGCTGTGGG + Intergenic
1049299451 8:141861952-141861974 AAGGCAGGTGAGGGGCTTGCTGG + Intergenic
1049746427 8:144265140-144265162 GGAGCAGGTGAGGGGGTTGCAGG + Intronic
1049815099 8:144595565-144595587 CTGGCAGGTGAGGGGCAGCTGGG + Intronic
1049887712 9:39272-39294 ATGGCAGAGGTGGGGGTTGTGGG - Intergenic
1050388649 9:5114097-5114119 CTGGCAGGTGTAGGTGTGGTCGG - Intronic
1051274594 9:15386784-15386806 GTGGCAGGTGACGGGATCGTGGG + Intergenic
1052975306 9:34405832-34405854 CTGGGGGGTGAGGGAGATGTGGG - Intronic
1053056383 9:34995347-34995369 CTGGCAGTAGTGGGGGATGTGGG - Intronic
1053276652 9:36788297-36788319 CCTGCAGGTGAGGGAGTGGTGGG + Intergenic
1053478240 9:38397163-38397185 GTGGCAGGTGACGATGTTGTAGG - Exonic
1054912294 9:70465629-70465651 CAGGCAGATGAGCAGGTTGTGGG + Intergenic
1054915769 9:70494077-70494099 CTGGAAGGTGAGAGGGCAGTTGG + Intergenic
1054947596 9:70812287-70812309 CTGGCTGGTGAGAGGCATGTAGG + Intronic
1055641388 9:78321231-78321253 CAGGCAACTGAGGGGGTGGTGGG - Intronic
1056881207 9:90395725-90395747 ATGGTAGGTGAGGGTGTGGTGGG - Intergenic
1057447878 9:95131244-95131266 CAGGCAGGGGAGGGGGTGCTGGG - Intronic
1058997691 9:110315833-110315855 GCGGCAGGGGAGGGGGTTGAGGG + Intronic
1060218989 9:121754606-121754628 CTGGCAGAAGAGAGGGCTGTAGG - Intronic
1060730571 9:126034266-126034288 ATGGCAGGTGAAGAGGTTTTTGG + Intergenic
1061487174 9:130925759-130925781 GTGGAGGGTGAGGGGGTAGTGGG + Intronic
1061496690 9:130978848-130978870 CTGGCAGGTGATGGAGGTTTGGG - Intergenic
1061509114 9:131049747-131049769 CTGGCGGGTGAGGGGCTGATGGG - Intronic
1061785098 9:133023142-133023164 AAGTCAGGTGTGGGGGTTGTGGG + Intergenic
1061924164 9:133797911-133797933 CTGTCAGGGGAGGGGCCTGTTGG - Intronic
1062209639 9:135356684-135356706 CTGGCAGGTGGGGAGGGTCTGGG + Intergenic
1062225287 9:135446725-135446747 CTGGCAGGGGTGGGGGGAGTAGG + Intergenic
1062225395 9:135447006-135447028 CTGGCAGGGGTGGGGGGAGTAGG + Intergenic
1062550245 9:137082789-137082811 CTGGCAGGTCTGGGGGGAGTCGG - Exonic
1186646995 X:11517813-11517835 CTGTCAGGTGGTGGGGTTGGGGG + Intronic
1187207123 X:17193417-17193439 ATGGCAGGTGATGGGATGGTGGG + Intergenic
1187895290 X:23974594-23974616 CTGGCAGGTGTGGGTGATATAGG + Intergenic
1187914013 X:24135871-24135893 CTGGCAGGTGTGGGTGATATAGG + Intergenic
1190304986 X:49076755-49076777 TGGGCAGGTGGGTGGGTTGTCGG + Intronic
1190877917 X:54472650-54472672 CTGGCTGGGCAGGGGGCTGTGGG + Intronic
1191192129 X:57678753-57678775 CTGGAAGCTGAGGTGGATGTAGG + Intergenic
1193030420 X:76892148-76892170 CTGTCAGGGGTGGGGGTTGGGGG + Intergenic
1194750665 X:97680608-97680630 CTGGAAGGTGAGAGGATGGTGGG + Intergenic
1194781311 X:98028500-98028522 CTGGCAGGGGTGGGGCTTGCTGG + Intergenic
1195522965 X:105851750-105851772 ATGGGAGGGGAGGGGGTTGAAGG + Intronic
1197076822 X:122363436-122363458 ATGGCAGTTGGTGGGGTTGTGGG + Intergenic
1198420831 X:136469572-136469594 CAGGGTGGGGAGGGGGTTGTGGG + Intergenic
1198641464 X:138760514-138760536 TGGGCAGGGGAGGGTGTTGTGGG + Intronic
1200154479 X:153968157-153968179 CTGCCAGGTGTGGGGGGTGGGGG - Intronic
1200244029 X:154513231-154513253 CAGGAAGTTGAGGGGGTTCTTGG - Intronic
1200883599 Y:8245872-8245894 ATGGCAGGTGAGGGTGGTCTTGG + Intergenic