ID: 1149897904

View in Genome Browser
Species Human (GRCh38)
Location 17:60444451-60444473
Sequence TGCGATCTTAGAAATAATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149897904_1149897907 28 Left 1149897904 17:60444451-60444473 CCTTCATTATTTCTAAGATCGCA 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1149897907 17:60444502-60444524 TAAACTTTTCCCAACAGGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1149897904_1149897906 23 Left 1149897904 17:60444451-60444473 CCTTCATTATTTCTAAGATCGCA 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1149897906 17:60444497-60444519 AATTATAAACTTTTCCCAACAGG 0: 1
1: 0
2: 2
3: 9
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149897904 Original CRISPR TGCGATCTTAGAAATAATGA AGG (reversed) Exonic
903792039 1:25900069-25900091 TGCTACTTTAGAAATAATTAAGG + Intronic
904100963 1:28026720-28026742 TCCCATCTTAGAAAGAAAGAAGG + Intronic
908049484 1:60212647-60212669 TTAGTTCATAGAAATAATGATGG + Intergenic
911279430 1:95904156-95904178 TGTGCTCTTGGAAATAATAAAGG - Intergenic
914956707 1:152169048-152169070 TGCTATTTGAGAAACAATGAAGG + Intergenic
915855134 1:159375311-159375333 GACTATCTCAGAAATAATGATGG + Intergenic
918197724 1:182237869-182237891 TAGGATCTTAGAAATACTAAAGG - Intergenic
920363335 1:205434584-205434606 TACCATCTCAGAAATAATGGTGG - Intronic
920927492 1:210356626-210356648 ATCGAGCTTAGTAATAATGAAGG - Intronic
921600893 1:217105325-217105347 TGTGATGTTAAAAATAATGAAGG - Intronic
923602778 1:235418167-235418189 TGCGAACTTAAAAAAAAGGAAGG - Intronic
924863221 1:247949078-247949100 TGCCATCTTAGGAACAATGGTGG - Exonic
924867684 1:248003351-248003373 TGCCATCTTAGGAACAATGGTGG - Intronic
924872217 1:248060902-248060924 TGCCATCTTAGGAACAATGGTGG - Exonic
1063902813 10:10752276-10752298 TGGCATCTTAGACATAAGGAGGG - Intergenic
1064689805 10:17904357-17904379 AGCTATCTTACAAAAAATGAAGG - Intronic
1066068805 10:31783610-31783632 TGCCCTCTTAAAAATTATGAAGG + Intergenic
1068330225 10:55555694-55555716 TGACATGTTAGAAGTAATGAGGG + Intronic
1069273225 10:66557238-66557260 TGATATGCTAGAAATAATGATGG - Intronic
1071683413 10:87730306-87730328 TGAGATTATAGAAAAAATGAAGG + Intronic
1073923964 10:108492659-108492681 TGCAATATTAGAAATCATTAGGG + Intergenic
1079669445 11:23149063-23149085 TGCAATCTTTGAAATTAGGAAGG - Intergenic
1080507038 11:32924920-32924942 TGCGTACTTGGAAATAAAGATGG - Intronic
1085559481 11:77457643-77457665 TGAGAACTTAGAAATGAAGAGGG - Intronic
1087876036 11:103358956-103358978 TGAGATCTTTGCAATAATTAAGG - Intronic
1091756401 12:3055152-3055174 TCCCATCTTAGAAGTAATCAGGG + Intergenic
1093935094 12:24992344-24992366 AGCCATCTGAAAAATAATGAAGG + Intergenic
1098431274 12:70422721-70422743 TGAGTTCTCAGAAATAAAGAGGG - Intronic
1098581114 12:72100311-72100333 TGCAATCTGAGAAGTAACGAGGG - Intronic
1099013010 12:77313836-77313858 TGAGATCTTAGAAATAAATGAGG - Intergenic
1099758472 12:86887316-86887338 TGACATTTTAGAAATAATAAAGG - Intergenic
1103121820 12:118386971-118386993 TGCGATGGTAGAAGTAATGATGG + Intronic
1106035249 13:26038298-26038320 TGCTATCTTAGGAAGAATGCTGG - Intergenic
1110029867 13:70596314-70596336 TGAAATATTTGAAATAATGATGG - Intergenic
1110294325 13:73844850-73844872 TCAGAGCCTAGAAATAATGATGG - Intronic
1111184415 13:84713069-84713091 TTCTATCTTGGACATAATGAGGG - Intergenic
1111577818 13:90181381-90181403 TGCTATCATAGAAAGAATGAAGG + Intergenic
1111737055 13:92154809-92154831 TGCAATCTGAGCACTAATGATGG + Intronic
1113198006 13:107832164-107832186 TAAGATTTTAGAAATAATGATGG + Intronic
1115040621 14:28920754-28920776 TGCAATATTAGAGAAAATGATGG + Intergenic
1116199629 14:41774961-41774983 TGGCCTCTTAGGAATAATGAAGG + Intronic
1119427876 14:74547540-74547562 TGGAATCTGAGAAATAATGAAGG - Intronic
1120339183 14:83197161-83197183 TGAGATTCTAAAAATAATGATGG - Intergenic
1121158577 14:91711685-91711707 TGCAATATCAGAAATAAAGAGGG + Intronic
1122962732 14:105104478-105104500 TGCCTTGTAAGAAATAATGAAGG + Intergenic
1124411127 15:29438196-29438218 GGAGATCACAGAAATAATGAAGG + Intronic
1125697921 15:41654682-41654704 TGCCATCTTTTAAATAAAGATGG + Intronic
1126236064 15:46385935-46385957 TGAGATCTGAGTAAAAATGAAGG + Intergenic
1129427385 15:75473592-75473614 TTAGCTTTTAGAAATAATGAGGG - Intronic
1130739986 15:86588859-86588881 TGCCATCAAAGAAATAATAAAGG - Intronic
1131023980 15:89123907-89123929 TGCTTTATTAGAAATAATTAGGG - Intronic
1133458281 16:5962397-5962419 TGTAATCTTAGAGATAAAGAAGG - Intergenic
1133888164 16:9851445-9851467 TGCCAGCCTAGGAATAATGATGG + Intronic
1139085939 16:63585830-63585852 TGTGAACTTACAAATATTGACGG + Intergenic
1140640278 16:76964227-76964249 TTCGATCTTAAAAATTGTGAAGG + Intergenic
1143695916 17:8617836-8617858 TGCACTCTTAGAAATTATTAAGG + Intronic
1149314648 17:55427671-55427693 TGCGAGTTTAGAAATAGTCATGG - Intergenic
1149897904 17:60444451-60444473 TGCGATCTTAGAAATAATGAAGG - Exonic
1152049403 17:77960013-77960035 GGGGATCTTAGCAAAAATGAAGG + Intergenic
1152982917 18:295897-295919 TGAGATTTTAGAAAAAAGGAAGG + Intergenic
1153782286 18:8505229-8505251 TGTGATCCTGGAGATAATGAAGG + Intergenic
1154026943 18:10716849-10716871 TGTTTTCTTAGAAATGATGAAGG + Intronic
1156056366 18:33009382-33009404 TGAGAACAGAGAAATAATGAAGG - Intronic
1156409242 18:36811916-36811938 TGCCATCTCAGACAAAATGAAGG - Intronic
1159223624 18:65500784-65500806 TGCTATCTTAAATATAATAATGG + Intergenic
926078018 2:9957989-9958011 TTGGATCTTAGAAGAAATGAAGG + Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926834587 2:17004183-17004205 TGAGATCTTAGAAAGTAAGATGG - Intergenic
927222946 2:20731281-20731303 TGCTGTTATAGAAATAATGATGG + Intronic
931795810 2:65708803-65708825 AGTGATCTTGGAAAAAATGATGG + Intergenic
933017702 2:77150512-77150534 TGAGATCTTAAAATGAATGAGGG - Intronic
933449912 2:82435546-82435568 TGCCATATTAGAAACAAAGATGG - Intergenic
933610064 2:84424705-84424727 TACCATCATAAAAATAATGAGGG + Intronic
936277375 2:111111840-111111862 TTCCATCTTAGAGATAAGGAAGG + Intronic
937270781 2:120650470-120650492 TGGGTTCTTAGAAAGAAAGAAGG - Intergenic
938300773 2:130210165-130210187 TGGGATATTACAAATAATAAAGG + Intergenic
938455951 2:131464308-131464330 TGGGATATTACAAATAATAAAGG - Intergenic
943358798 2:186893684-186893706 TGAGATCTTTGATATAAGGAGGG - Intergenic
944650283 2:201822620-201822642 TGCCATTTTTGAAATAATGAAGG + Intronic
945708128 2:213261162-213261184 TGAGAATTTAGAAATAAAGAAGG + Intergenic
947309882 2:228789921-228789943 GGCCATCTCAGAATTAATGAGGG - Intergenic
948101194 2:235374604-235374626 TGAGATTCTGGAAATAATGACGG - Intergenic
948384611 2:237573792-237573814 TGCCATCCTAGCAGTAATGATGG + Intergenic
948961696 2:241344009-241344031 TGCGATGTGAGAAACACTGAGGG - Intronic
1176699710 21:10030191-10030213 TGAGATCATTGAAGTAATGATGG - Intergenic
1177069557 21:16486424-16486446 TCCAATCTTGGAAATTATGAAGG + Intergenic
1177554862 21:22676288-22676310 TGAGATGTTAGAAATTATGCTGG - Intergenic
1177917887 21:27113687-27113709 CTCTATCTTAGAAATAATGCTGG + Intergenic
1178185447 21:30214471-30214493 TGTGATCTAAGAAAAAGTGATGG - Exonic
1182131807 22:27859405-27859427 GGAGATCTGAGATATAATGAGGG + Intronic
949188579 3:1223463-1223485 TGTGATCTTTGAAAGAATAAAGG - Intronic
949654536 3:6201744-6201766 TGTGTTCTTATAAATAATGAAGG - Intergenic
951422107 3:22498985-22499007 TGCGATCTCAAATATAAAGAAGG + Intergenic
956974060 3:74559697-74559719 TGACTTCTTAGAAAAAATGAAGG + Intergenic
957236409 3:77598097-77598119 TGCACTTTTAGAATTAATGAAGG + Intronic
959144411 3:102526909-102526931 GGGAATCTTAGAAATTATGAAGG + Intergenic
959388582 3:105744207-105744229 TCCAATCATAGAAATAATGAGGG - Intronic
959989117 3:112611211-112611233 TTTGATTTTAGAAATAAGGAAGG - Intronic
964689183 3:159430927-159430949 TGAGATCCTAGAAATGAAGAGGG + Intronic
964949451 3:162270431-162270453 AGCGATGTTAGAAATCATGATGG + Intergenic
967368723 3:188718178-188718200 TGTGATCTTAGAAATTATCTAGG + Intronic
975794343 4:77990499-77990521 TGCAATCTTAGTAAAAAGGAAGG - Intergenic
978264123 4:106802119-106802141 TGTGATTATAGAAATAACGAAGG + Intergenic
980311121 4:131129965-131129987 TGCATTCTTAAAAATAATGTGGG + Intergenic
980372119 4:131888816-131888838 TGAGATCATTGAAGTAATGATGG - Intergenic
985042233 4:185903111-185903133 TGCTTTAGTAGAAATAATGATGG - Intronic
986947784 5:13045942-13045964 TGCTTTCTTAGAAATAAAGTTGG - Intergenic
988490003 5:31698204-31698226 TTCAATCTAAGAAATAAGGAAGG - Intronic
989271790 5:39541968-39541990 TTCGATCTTAGAATAAATGGAGG - Intergenic
989477764 5:41893714-41893736 TGCTATATAAGAAATAATAAAGG + Intergenic
990888937 5:60627530-60627552 TGAGATTGTAGAAATGATGAAGG - Intronic
992293090 5:75301213-75301235 TGTGACCTTGGAAATAATGGAGG - Intergenic
992536634 5:77712053-77712075 TGCGGTATGAGAAATAATAAAGG + Intronic
995368524 5:111391239-111391261 AGAGATCTCAGAAAGAATGAGGG + Intronic
1000000593 5:157135087-157135109 TGCAAACTTAAAAAAAATGAGGG - Intronic
1000431279 5:161155509-161155531 TGTGGTCATAGAAATAATGTGGG - Intergenic
1001726259 5:173904111-173904133 TGTGAGCTTAGTAATCATGAAGG - Intronic
1004285249 6:14315480-14315502 TGAGATCTAAGAAAGAAGGAAGG + Intergenic
1005106764 6:22232101-22232123 TGCAATTCTAGTAATAATGATGG + Intergenic
1007121548 6:39386356-39386378 TGCCATCTGAGAAATATTTAAGG + Intronic
1013810470 6:114039457-114039479 AGCAATCTTGGAAATAATCAAGG - Intergenic
1017393341 6:153966500-153966522 TGCCATGTTTGAAATGATGAGGG - Intergenic
1020668070 7:11072503-11072525 TGCTATTTTATAGATAATGAAGG - Intronic
1023329444 7:39099225-39099247 AGCGATTTTAAAAATAATGTTGG + Intronic
1024169562 7:46769717-46769739 TGTGACCTTATAAATAAGGAAGG - Intergenic
1027712607 7:81624544-81624566 TGCAAAATTGGAAATAATGATGG - Intergenic
1027889566 7:83953309-83953331 TGCATTCTTAGAGATCATGATGG + Intergenic
1032975352 7:137216522-137216544 TTCCAACTGAGAAATAATGAAGG - Intergenic
1033946534 7:146725568-146725590 TGTGACCTTTGAAATAATGGTGG - Intronic
1034354064 7:150437152-150437174 TGCTATGTTAGAAAGAATGCTGG + Intergenic
1035313930 7:157986681-157986703 TGCTAAATTAGAAATAATGAAGG + Intronic
1035976187 8:4314187-4314209 TGCAGTCTTGAAAATAATGAGGG - Intronic
1037136502 8:15468934-15468956 TGCTGACTTAAAAATAATGAGGG + Intronic
1037680004 8:21089331-21089353 TGCATCCTTAGAAATAACGATGG + Intergenic
1039283962 8:36019338-36019360 TGGAATCTTAGAAATATTGAAGG - Intergenic
1042897818 8:73690394-73690416 TCCCATTTTAGATATAATGAAGG - Intronic
1045094472 8:98783772-98783794 TGCCATCTTGGAAATAAAAAAGG - Intronic
1046185412 8:110708554-110708576 TGAGATTTCAGAAAGAATGAGGG - Intergenic
1047469578 8:125156720-125156742 AGCAATCTTAGATATAATAAAGG + Intronic
1050813086 9:9775046-9775068 TTAGCTCTCAGAAATAATGAGGG - Intronic
1054317690 9:63613454-63613476 TGAGATCATTGAAGTAATGATGG - Intergenic
1058284587 9:103160945-103160967 TGCAATCTCAAAAATGATGATGG - Intergenic
1059899479 9:118907351-118907373 TGGGATCTCAGCAATAAAGATGG - Intergenic
1202784725 9_KI270719v1_random:250-272 TGAGATCATTGAAGTAATGATGG - Intergenic
1186569689 X:10701202-10701224 TGCGATGTAAGAACTAAGGAAGG - Intronic
1186996156 X:15125308-15125330 TGGTATCCTAGAAATACTGAGGG - Intergenic
1191163512 X:57361940-57361962 TGCTATCTTCAAAATAATGAAGG - Intronic
1196422287 X:115535169-115535191 TTCCATCTTAAAAATAATTATGG - Intergenic