ID: 1149898554

View in Genome Browser
Species Human (GRCh38)
Location 17:60451227-60451249
Sequence ATGATGTTAAAGGTAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149898554 Original CRISPR ATGATGTTAAAGGTAGGAGA AGG Intronic
901825321 1:11857695-11857717 ATGATGGTTAGGGTGGGAGATGG + Intronic
903413420 1:23165755-23165777 ATGCTGTTACAGGTAGGACCCGG - Intronic
906748816 1:48240751-48240773 CTGCTGTTGAAGGGAGGAGAGGG - Intronic
907032303 1:51184375-51184397 ATGATGGTGAAGGTAGGGAAGGG + Intergenic
907156034 1:52334960-52334982 ATGACATTAAAACTAGGAGATGG + Intronic
907625703 1:56027165-56027187 ATGCTGATAGAGCTAGGAGAAGG - Intergenic
908111812 1:60905310-60905332 AGGGTGTTAAAGGTAGAATATGG + Intronic
908208294 1:61873653-61873675 GTGATGTTAGAGGCAGGAGGCGG + Intronic
909952882 1:81740066-81740088 ATGATGTCAAAGGAAGATGAGGG + Intronic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
915872554 1:159576527-159576549 ATGATGATAAAGGTGGGTGTTGG - Intergenic
915945998 1:160152235-160152257 AAGATGTTAAAGATAGGTGGAGG - Intronic
916316585 1:163455188-163455210 ATGATATAAAGGGTAGGAGAGGG + Intergenic
918331150 1:183461693-183461715 ATAATTTTAAAGGTAAGAAAAGG + Intergenic
920770938 1:208884691-208884713 CTGATGTTAATGGTAGGAGGTGG - Intergenic
921738487 1:218655962-218655984 ATGATTTTGAAGGCAGGACAAGG - Intergenic
922039515 1:221882846-221882868 ATGGTGGTCAAGGTAGGATAAGG + Intergenic
922919172 1:229286810-229286832 GTGATGTTGAAGATAGCAGAGGG + Intronic
923691196 1:236194830-236194852 ATGATTATAGAGGCAGGAGATGG + Intronic
924531839 1:244900198-244900220 ATGATGTTGAAGATACAAGAGGG - Intergenic
1063055968 10:2504624-2504646 ATTATGTTAAAGGGGGAAGAGGG + Intergenic
1065910530 10:30299883-30299905 ATGATATTAAATGTTGGTGAAGG + Intergenic
1066594460 10:37034699-37034721 ATGATTTTAAAGTTAGAACAAGG - Intergenic
1067927661 10:50526712-50526734 ATTCTGTTAAAGGCAAGAGAGGG + Intronic
1068022027 10:51596744-51596766 ATGATTTGAAAGCTAGGGGAAGG + Intronic
1070041086 10:72780690-72780712 ATGATGGGAAGGTTAGGAGAGGG - Intronic
1070295447 10:75157342-75157364 ATGATGGTAGAGGAAAGAGAGGG + Intronic
1071161359 10:82749435-82749457 ATGAGGGCAAAGGTAGCAGAGGG - Intronic
1071972797 10:90925070-90925092 CTGACGTTAGAGGTAGGTGAAGG + Intergenic
1072274154 10:93805994-93806016 AAGAAGTTACAGGTAGAAGACGG + Intergenic
1072464233 10:95648308-95648330 ATGATGATGAAGGTAGAATATGG - Intronic
1072797979 10:98371377-98371399 AAGATGTTAAAGGTAAAACAAGG + Intergenic
1074618136 10:115091597-115091619 AAGATGTTAAGGGAAGAAGAGGG + Intergenic
1075266144 10:121000877-121000899 ATGATGATAAAGGCAGGGAAAGG + Intergenic
1077704584 11:4472273-4472295 ATTTTGCTAAAGGTTGGAGAAGG - Intergenic
1078656822 11:13248341-13248363 ATGATGATAATAGTATGAGAAGG - Intergenic
1078748665 11:14139386-14139408 ATGATGCTAACAATAGGAGAAGG - Intronic
1079876381 11:25862537-25862559 ATGAAATTAAAGTTAGGAGCAGG - Intergenic
1082932816 11:58626409-58626431 AGGAAGCTAAAGGAAGGAGAGGG + Intergenic
1083147777 11:60771747-60771769 ACGAAGGCAAAGGTAGGAGAAGG + Intronic
1085321044 11:75574225-75574247 ATGATGCTAAAGCTAGGTGCAGG - Intergenic
1085894001 11:80615155-80615177 ATGATTTTAAAGTTAGAACAAGG + Intergenic
1087251202 11:95902426-95902448 ATGATGTTGAAGGGAGGAAAGGG - Intronic
1088780136 11:113126185-113126207 TTGTTGTTAAGGGTAGGGGAGGG - Intronic
1089025275 11:115262895-115262917 AAGATGTTAACATTAGGAGAAGG - Intronic
1091173967 11:133543463-133543485 TTTATGTTAAAGGTAACAGAAGG - Intergenic
1092709925 12:11325204-11325226 ATGAGGTCAAAGCAAGGAGAAGG + Intergenic
1093158533 12:15716944-15716966 AAGGTATTAAAGTTAGGAGAAGG - Intronic
1093593636 12:20936999-20937021 AAAATGTTAAAGTGAGGAGATGG - Intergenic
1094114649 12:26897469-26897491 ATGAAGTTAAAAGTAGAGGATGG - Intergenic
1095861670 12:46924424-46924446 ATCAGATTAAAGGTAGAAGAGGG - Intergenic
1096936529 12:55286124-55286146 ATGGGGTTAGAGGTGGGAGATGG - Intergenic
1097308446 12:58093934-58093956 ATGATGTTCAAGGAAGGGAAAGG - Intergenic
1097516313 12:60611836-60611858 TTGATTTTAAAGGTAAGAAATGG - Intergenic
1097930200 12:65175117-65175139 ATGAAGTTAAAGGTAGGTATGGG + Intronic
1098560861 12:71870256-71870278 ATAATGTTAGAGGAAGGAGAAGG - Intronic
1099103558 12:78473272-78473294 AAGATTTTGAAGGTAGGAGCAGG - Intergenic
1099933182 12:89097277-89097299 AGGATGTTAAAGAAAGGAGTAGG + Intergenic
1099999757 12:89819215-89819237 ATCATGTTAAAGAGAGGAGAAGG - Intergenic
1100372659 12:93982752-93982774 ATCATTTTAAAGGTGGCAGATGG + Intergenic
1100601763 12:96117720-96117742 ATGATGTTAAAGGCACAAAAGGG - Intergenic
1100689497 12:97024778-97024800 ACCATGTCAAAGGAAGGAGACGG - Intergenic
1100942430 12:99739117-99739139 AGGTTGTGAAAGTTAGGAGATGG - Intronic
1106506757 13:30377149-30377171 ATGATGTCAAGGGCTGGAGAGGG - Intergenic
1106692975 13:32138886-32138908 AGGATGTAAAAGGTAGGAGCAGG + Intronic
1108564895 13:51686194-51686216 ATGATGATCAAGCTAGAAGATGG - Intronic
1111702858 13:91712857-91712879 ATCATGTTAAATGTAAGAGATGG + Intronic
1113066249 13:106376295-106376317 TTCAAGTTAAAGGTAGGAAATGG + Intergenic
1113177069 13:107577137-107577159 ACGATGTCAATGGTAGAAGATGG - Intronic
1114743069 14:25118125-25118147 ATGAAGTTAAAGGGTGGAAAGGG - Intergenic
1115527280 14:34293964-34293986 ATGATTATAAATGTAGTAGAAGG + Intronic
1115970053 14:38934829-38934851 ATAATGGTAAAGGAAGGACAAGG + Intergenic
1116324906 14:43520265-43520287 ATGATAGAAAAGTTAGGAGATGG + Intergenic
1116519735 14:45833549-45833571 ATAATATTTAAGGGAGGAGAGGG - Intergenic
1116985651 14:51216570-51216592 TTCATCTTAAAGGAAGGAGAAGG + Intergenic
1118531921 14:66716358-66716380 ATGAAGTAAAAGGTTGGAAAAGG - Intronic
1120061653 14:79990421-79990443 ATGATGTTATAGGTTGGAGGAGG + Intergenic
1120163842 14:81173195-81173217 AGGGTATTAAAGGTAGAAGAAGG - Intergenic
1121138277 14:91518391-91518413 ATTATGTTAAGGGTAGGATAAGG - Intergenic
1125376337 15:39033792-39033814 AGGATATTAAAGGAGGGAGAGGG - Intergenic
1127726098 15:61751546-61751568 ATGAGGGTAAGGGTAAGAGAAGG - Intergenic
1128000126 15:64183537-64183559 AGGATGTTAATGGTAGAACAAGG - Intronic
1128054679 15:64690821-64690843 ATGATGATAAAGGTAATATATGG - Intronic
1128114784 15:65098339-65098361 CTGATGCTGAAGGAAGGAGAAGG - Intronic
1128484652 15:68072808-68072830 AAAATGTTAAAGGGAGGAAACGG - Intronic
1128957905 15:71968785-71968807 GTGATGTTAAAGGTTGGGAAGGG + Intronic
1129056056 15:72821426-72821448 ATGAAGGTAAAGGCAGGAGTTGG - Intergenic
1134306614 16:13038649-13038671 GTGATGTTAAGGGTCGGAGAAGG - Intronic
1137893027 16:52182109-52182131 ATTATGTTAAAGATCTGAGATGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138885071 16:61066650-61066672 ATGGTTTAAAAGGAAGGAGAAGG + Intergenic
1140194912 16:72847928-72847950 ATGATGTGAATGGAATGAGATGG - Intronic
1140579839 16:76217022-76217044 AGGATTTTAAAAGTAGGTGATGG + Intergenic
1142708793 17:1712410-1712432 ATGGTGATCAAAGTAGGAGAGGG + Intergenic
1142736743 17:1905710-1905732 GTGATGGTGAGGGTAGGAGAGGG - Intergenic
1143653610 17:8279853-8279875 AAGCTGTTACAGTTAGGAGAGGG - Intergenic
1144293204 17:13846408-13846430 TTTATGTAAAAGATAGGAGAGGG - Intergenic
1144472472 17:15557033-15557055 AACATGTGAAAGGCAGGAGATGG - Intronic
1144924005 17:18787655-18787677 AACATGTGAAAGGCAGGAGATGG + Intronic
1146518463 17:33508083-33508105 AAGATGGAAAAGGGAGGAGAGGG - Intronic
1146578329 17:34013781-34013803 CTGAGGGTAAAGGTAGGACAAGG - Intronic
1147439715 17:40440624-40440646 GTGATGATCAAGGAAGGAGATGG + Intergenic
1147805097 17:43125559-43125581 ATGACGTAAAAGGAAAGAGACGG + Intergenic
1149433129 17:56610395-56610417 ATGGTGTTAAATGTAAGTGATGG - Intergenic
1149898554 17:60451227-60451249 ATGATGTTAAAGGTAGGAGAAGG + Intronic
1150014145 17:61536470-61536492 AGCATGTTTAAGGTAGGATAAGG - Intergenic
1151161708 17:72171336-72171358 GTGATATGCAAGGTAGGAGAAGG - Intergenic
1151267496 17:72968032-72968054 ATGATGTTACAGGTTGGATGGGG - Intronic
1153541090 18:6156261-6156283 ATGATGATAAAGGCACCAGAAGG - Intronic
1155499736 18:26475183-26475205 ATGATGGTAAAGGTGGGTAATGG - Intronic
1156913238 18:42436158-42436180 ATGTTGATAAAGGTAGGGGTTGG + Intergenic
1156994044 18:43445675-43445697 ATGATTTTAAGGGTAAGAGAAGG + Intergenic
1157486039 18:48087902-48087924 ATGAGGTTAAATGGAGGAAAAGG - Intronic
1158378589 18:56902775-56902797 ATGATGTTAAGGGAAGTAAAAGG + Intronic
1158719657 18:59913452-59913474 AAGATGTGAAAAGTAGGAGTTGG + Intergenic
1158738690 18:60113963-60113985 CTGAAATTAAAGGTAAGAGAAGG - Intergenic
1161605038 19:5210156-5210178 ATGATGTTAAAGGGCTGAAAGGG - Intronic
1167735282 19:51290782-51290804 ATGTGGTGAAAGGGAGGAGATGG - Intergenic
1168198639 19:54796551-54796573 ATGATGATATAGGGAGAAGAGGG + Intronic
925237316 2:2291358-2291380 ATGATTTTACAGGTTGGAGCTGG + Intronic
925504320 2:4543892-4543914 ATGAGGTTACAGGGAGAAGATGG - Intergenic
928249925 2:29666840-29666862 AGGCTGGGAAAGGTAGGAGAAGG - Intronic
929237375 2:39620357-39620379 ATGATTTTAAAAGGAAGAGAAGG - Intergenic
929665395 2:43830085-43830107 ATGATGTTACAGAGATGAGAAGG - Intronic
929719996 2:44358487-44358509 AAGAAGTAAAAGGTAGGAGAGGG + Intronic
931460958 2:62449796-62449818 ATGTTTTGAAAGGGAGGAGAAGG - Intergenic
931545076 2:63373777-63373799 ATAATTTTCAAGGAAGGAGAGGG - Intronic
931624705 2:64246615-64246637 ATGGAGCTAAAGGTAGAAGAGGG + Intergenic
933563051 2:83913210-83913232 AGAATGTCAAAGGTAGTAGAAGG + Intergenic
934119021 2:88822554-88822576 CTGTTGTGAAAGGTAGGACAGGG - Intergenic
935049905 2:99516513-99516535 ATGATTTTATAGGTAGGTGTAGG + Intergenic
935127689 2:100238890-100238912 AGGATGTTAGAGTTAGGAGGGGG - Intergenic
936162473 2:110094906-110094928 CTGTTGTGAAAGGTAGGACAAGG - Intronic
936182187 2:110276460-110276482 CTGTTGTGAAAGGTAGGACAAGG + Intergenic
936521347 2:113213761-113213783 ATGACCTTAAAGGTTAGAGAGGG + Intergenic
936678593 2:114744619-114744641 ATGGTGTTACATGTAGAAGAGGG + Intronic
937546931 2:123033777-123033799 AAGAGGTGGAAGGTAGGAGAAGG + Intergenic
937766006 2:125661204-125661226 TTGATATTTAAGGAAGGAGATGG + Intergenic
938813810 2:134879106-134879128 ATGATGCTAAAGTTAAGATACGG - Intronic
941075993 2:161007328-161007350 ATGATGTAACAGGAATGAGAGGG - Intergenic
941461828 2:165781200-165781222 ATGATGATCAAAGTAGAAGAAGG - Intronic
941618085 2:167745276-167745298 ATAATGTAAATGTTAGGAGAGGG - Intergenic
944020178 2:195093599-195093621 ATGTTCTTAAAGGAAGGAAAAGG + Intergenic
944310392 2:198226553-198226575 ATCAAGTTAAAGGTGGGATAAGG - Intronic
944901600 2:204222123-204222145 ATGTTGTTAAAGGTGGGGGGTGG - Intergenic
944926454 2:204470057-204470079 ATGATGTGAAAAGTCAGAGATGG + Intergenic
945911174 2:215651362-215651384 ATGATGTGAAAGTCATGAGAAGG - Intergenic
946541974 2:220694802-220694824 GTGATGGAAAAGGTCGGAGAAGG + Intergenic
947034616 2:225838014-225838036 ACAATCTTAAAGGTAGGTGAGGG - Intergenic
948172768 2:235918713-235918735 ATCATGTTAAATGTAAGTGATGG + Intronic
1169789053 20:9390352-9390374 ATAATTTTAAAAGAAGGAGAAGG - Intronic
1170405871 20:16035846-16035868 TTGCGGTAAAAGGTAGGAGAAGG + Intronic
1170509913 20:17065841-17065863 TTGATGTTCAGGGAAGGAGAAGG + Intergenic
1171341027 20:24429832-24429854 ATTATGTTAAATGTAGGAACAGG + Intergenic
1173164472 20:40676982-40677004 ATGAGGTTAGAGCTAGGAGTAGG + Intergenic
1173225597 20:41160718-41160740 ATGATGGTAATGGTAGGAAGTGG + Intronic
1173859170 20:46270809-46270831 ATGATATTTAAGGCAGGAGCTGG + Intronic
1175341200 20:58230537-58230559 ATGTTCTCAAAGGTAGGATAAGG - Intergenic
1177482989 21:21716556-21716578 ATGATGTTAGAAGTATAAGAAGG + Intergenic
1178229753 21:30768270-30768292 ATGATTTTAAAAGTTGGAGCAGG - Intergenic
1178497291 21:33098120-33098142 ATGACTTTAAAGGGAGAAGAGGG + Intergenic
1179037756 21:37774077-37774099 ATGAAGGAAAAGGTAGGATAAGG - Intronic
1180907806 22:19427401-19427423 ATAATGATAAAGTTAGGAGTGGG - Intronic
1181294057 22:21820620-21820642 ATGGTGTTGAAAGGAGGAGACGG - Intronic
1181376911 22:22466027-22466049 ATGATGTCAAAGCTAGCTGATGG + Intergenic
1182638456 22:31748389-31748411 ATGTTATTAAAGGGAGGAAATGG - Intronic
1184268619 22:43364527-43364549 ATGATGATAATGGTAGGACCTGG + Intergenic
950023937 3:9808139-9808161 GTGATGTTAAAGGGAGGAGGGGG + Intronic
950356024 3:12409971-12409993 ATGATGTTAAAGTTGGTAGAAGG - Intronic
951558445 3:23944379-23944401 AAGATGTTAAACTTAGGCGATGG - Intronic
952209295 3:31213162-31213184 ATAATGTAAAAGGTAGGCAAAGG - Intergenic
952467912 3:33610680-33610702 GTGATTTAAAAGGTAGGGGATGG - Intronic
952554362 3:34515126-34515148 ATGATTTTAAACCTATGAGAAGG + Intergenic
954980897 3:54744456-54744478 AGGAAGTCAGAGGTAGGAGAAGG + Intronic
955218134 3:57001795-57001817 ATGGTGTTGAAGGCAGGAGGAGG - Intronic
957416625 3:79914062-79914084 TTGGAGATAAAGGTAGGAGATGG + Intergenic
957708438 3:83821321-83821343 ATGGTGGGAAAGGTATGAGAGGG - Intergenic
957745873 3:84341434-84341456 ATGACGTTAAAAGTATGACATGG + Intergenic
960245110 3:115391719-115391741 TTCATGTTAAAGGAAGAAGAAGG - Intergenic
961830522 3:129620823-129620845 ATGATGGGGAAGGTAGGGGAAGG + Intergenic
964570432 3:158103925-158103947 CTGTTTTTAAAGGGAGGAGAAGG - Intronic
965718914 3:171638981-171639003 ATGGTGTTAATGGTAGTAAAAGG - Intronic
966687393 3:182710702-182710724 TTGATGTTAGAGGTGAGAGACGG + Intergenic
968262604 3:197337273-197337295 ATTTTGTGAAAGGAAGGAGAAGG + Intergenic
969166747 4:5322696-5322718 CAGTTGTTAAAGGTAGGGGAGGG - Intronic
971577594 4:28295715-28295737 ATGCTTTAAAAAGTAGGAGAGGG - Intergenic
971953191 4:33381425-33381447 ATTATTTAAAAGGTAGGACACGG + Intergenic
972179409 4:36444922-36444944 ATTATGTTCAGGGCAGGAGAAGG + Intergenic
973307762 4:48672278-48672300 ATGTTGAGAAAGGAAGGAGATGG - Intronic
973325202 4:48853527-48853549 AAGAAGTTAAAGGGAGGGGAGGG + Intronic
973845015 4:54902685-54902707 ATTTTGTTAAAGGTAGGTAATGG + Intergenic
974164527 4:58184716-58184738 ATGATGAGAAAGTTTGGAGAAGG + Intergenic
975059510 4:69979528-69979550 ATGAAGTTCAAAGTAGGAAAAGG - Intergenic
976193125 4:82508056-82508078 TTAAAGTTAAAAGTAGGAGATGG + Intronic
976756607 4:88505226-88505248 GTGAGGTTCAAGGCAGGAGAAGG - Intronic
976840426 4:89426391-89426413 ATGCTGGTAAAGGGATGAGAAGG + Intergenic
976952673 4:90851592-90851614 ATGATGGTAAAGGTCGGATCAGG - Intronic
977216509 4:94291332-94291354 ATGATTTTAAGGGTAGGAGGAGG - Intergenic
978357649 4:107893851-107893873 ATATTGTGAAAGGAAGGAGAGGG - Intronic
979231863 4:118355472-118355494 GTGATGTGACAGGTAGAAGAGGG - Intergenic
981050722 4:140306768-140306790 AGTATGTTGTAGGTAGGAGAAGG + Intronic
981500886 4:145450021-145450043 ATGATGTCCAAGGCAGCAGAAGG + Intergenic
983526455 4:168765251-168765273 ATGATGCTGAAGGAGGGAGAAGG + Intronic
984506262 4:180622639-180622661 ATTATATCAAAGGTGGGAGATGG + Intergenic
984568542 4:181361610-181361632 ATCATGTGAAAAGTAGAAGAGGG + Intergenic
987516703 5:18919207-18919229 CTGATGTCAAAAGTAGTAGAAGG - Intergenic
989748756 5:44865245-44865267 ATAATGTTATAGGTAAGAGTAGG - Intergenic
992461544 5:76965334-76965356 ATGAGATTTAAGGTAGGAGTGGG + Intronic
992473755 5:77082693-77082715 CTGATGTGAAAGGAGGGAGAAGG + Intronic
992697879 5:79308767-79308789 AAGATGTTAGGTGTAGGAGAAGG - Intronic
995137767 5:108698585-108698607 ATGTTGCCAAAGGTAGAAGAAGG + Intergenic
996230222 5:121054232-121054254 ATGATGTTAAATTATGGAGATGG + Intergenic
996415279 5:123203897-123203919 ATGCTCTTAACTGTAGGAGATGG - Intergenic
996751957 5:126897532-126897554 ATGGGCTTAAAGGAAGGAGAGGG + Intronic
998668279 5:144324167-144324189 ATCATGGTAAATGTAGGAGATGG - Intronic
999197389 5:149791783-149791805 AAGTTGTTAAAGGTAGGGAAGGG - Intronic
999437328 5:151573118-151573140 AAGATGTGGAAGGCAGGAGAAGG + Intergenic
999883772 5:155896684-155896706 ATAAAATTAAAAGTAGGAGATGG + Intronic
1001690928 5:173631754-173631776 TTGATTTTAAAAGGAGGAGAAGG - Intergenic
1001745490 5:174089388-174089410 ATGAGGTGGAAGGTAGGAGAGGG + Intronic
1005130191 6:22498171-22498193 AGGATGATGAAGGTAGGAGCTGG - Intergenic
1005659181 6:27977131-27977153 ATGATGTGAAAGGAAGGCAATGG + Intergenic
1007055277 6:38876968-38876990 ATGCTGCTAAAGGTTTGAGATGG + Intronic
1008103941 6:47422684-47422706 ATGAGTTTATAGGTAGGATAGGG - Intergenic
1009528867 6:64784247-64784269 ATTATTTTAAAGATAGTAGAAGG - Intronic
1009645046 6:66390719-66390741 ATGATGTTAAAAGAAAGAAATGG + Intergenic
1009989945 6:70829912-70829934 ATGGTGGTAAATGTAGGAGTTGG + Intronic
1010889424 6:81287935-81287957 ATGACATTAAAGGAAGTAGACGG + Intergenic
1013115593 6:107101566-107101588 ATGTTTTTTCAGGTAGGAGATGG - Intronic
1013120315 6:107135020-107135042 ATGTTTTTTCAGGTAGGAGATGG + Intergenic
1014108516 6:117593907-117593929 AAGATAATAGAGGTAGGAGAAGG - Intronic
1015664537 6:135613478-135613500 ATAATATAAAAGGTAGGAGAAGG - Intergenic
1015929408 6:138342329-138342351 CTGATCTTAAAGGTAGAAGTTGG - Exonic
1016649322 6:146446204-146446226 CTAACGTTAAAGGAAGGAGAGGG + Intergenic
1016675019 6:146755124-146755146 ATCCTGTTAAAGTTAAGAGAAGG - Intronic
1017923413 6:158890448-158890470 ATGATGTGAAAGGGACCAGATGG + Intronic
1019759568 7:2800459-2800481 ATGCTGTTGAAGTCAGGAGACGG - Intronic
1020179071 7:5907268-5907290 CTGCTGTGAAATGTAGGAGATGG + Intronic
1020303863 7:6817601-6817623 CTGCTGTGAAATGTAGGAGATGG - Intronic
1022057257 7:26750757-26750779 ATGATGTTTATGGAAGGAAAAGG + Intronic
1022993653 7:35732257-35732279 ATGATGATGATGGTAGTAGATGG - Intergenic
1023851412 7:44152353-44152375 ATGCTGGTGAAGGTGGGAGAAGG - Exonic
1024634646 7:51276922-51276944 AAGAGGTGAAATGTAGGAGAGGG + Intronic
1026569928 7:71520644-71520666 ATGATGGCAAAGGCAGTAGATGG + Intronic
1028311739 7:89346763-89346785 ATAATGATAATGATAGGAGAAGG - Intergenic
1028883191 7:95903242-95903264 AAGATGTAAAAACTAGGAGAAGG - Intronic
1030581272 7:111358841-111358863 AAGATAGTAAAGGAAGGAGAAGG + Intronic
1030766997 7:113422206-113422228 ATTTTCTCAAAGGTAGGAGAAGG - Intergenic
1030863847 7:114673579-114673601 ATAATGTTGAAGGTAAGAGCAGG + Intronic
1031479665 7:122263093-122263115 AGATTGTTTAAGGTAGGAGATGG + Intergenic
1031754336 7:125618725-125618747 ATGATGTTCAAGCTAGGTGCAGG - Intergenic
1031940557 7:127784477-127784499 ATGATTTCAGAAGTAGGAGAGGG - Intronic
1032634452 7:133691247-133691269 TTGATGTTAGTGGTTGGAGATGG + Intronic
1032663790 7:134015069-134015091 AAGATGTTCAAGGAAGGAGGTGG + Intronic
1032745439 7:134781814-134781836 CTTATATTAAAGTTAGGAGAAGG + Intronic
1033238999 7:139661521-139661543 TTGATGTGAAGGGTAGTAGAAGG - Intronic
1033646090 7:143305469-143305491 ATGAAATAAAAGATAGGAGATGG - Exonic
1034036922 7:147834604-147834626 AGGATCTCAAAGGTGGGAGATGG - Intronic
1035943238 8:3928601-3928623 ATGATGTCATAAGAAGGAGAAGG + Intronic
1036632118 8:10523301-10523323 ATGATGATATAGGTCGGATATGG - Intergenic
1038108355 8:24464216-24464238 ATGGTGTTAAGTCTAGGAGAGGG + Intronic
1038844746 8:31217969-31217991 ATGATGCTAAGTGTTGGAGAAGG - Intergenic
1043185129 8:77138691-77138713 ACCATGTTAAAGGTAGGATCAGG + Intergenic
1043320432 8:78978260-78978282 ATGATGTTAAAAGGAGTAGTGGG + Intergenic
1043659734 8:82723573-82723595 TTAATGTTAGAGGTAGGAAATGG + Intergenic
1044085209 8:87935402-87935424 ATGAGGTTAAAGTGAGAAGATGG - Intergenic
1044114983 8:88325012-88325034 AAGATTTTAAAGGTCTGAGATGG + Intronic
1046464082 8:114580013-114580035 ATGATGTTATAGCCAGGAGCAGG + Intergenic
1047041829 8:121005451-121005473 ATGCCCTTAAAGGAAGGAGAGGG + Intergenic
1049913844 9:297124-297146 AAGATGTGAAAGGAAAGAGAGGG + Intronic
1051404055 9:16715019-16715041 ATGATGTCACAAGGAGGAGATGG - Intronic
1051883932 9:21870020-21870042 CTAATGTTAAAGGCAGGAGGGGG - Intronic
1052753399 9:32515696-32515718 ATGAAGGTAAAGGTATAAGATGG - Intronic
1053100938 9:35371880-35371902 ATGATGTTAAAGGCTCGAAAGGG - Intronic
1053287160 9:36857178-36857200 ATGATTTAAAAGGTAGGGCATGG + Intronic
1054952993 9:70873884-70873906 ATAATGATAAAAATAGGAGAAGG - Intronic
1055864661 9:80798266-80798288 ATGATGTTGGGGGTGGGAGAGGG + Intergenic
1057057047 9:91971371-91971393 ATGACCTTAAAAGTAGCAGATGG + Intergenic
1059311389 9:113391021-113391043 GTGATGATGAAGGAAGGAGAAGG - Intronic
1059343914 9:113615612-113615634 ATGGTCTTAAAGGAAGGAGCAGG + Intergenic
1060036724 9:120262163-120262185 ATGATGTCAAAGGCAGGAGTGGG - Intergenic
1060460661 9:123851438-123851460 ATGATGTTAAAATTACGAAATGG + Intronic
1061416811 9:130451534-130451556 ATGGGGTTGCAGGTAGGAGAGGG + Intronic
1061988183 9:134142592-134142614 GTGATTTTACAGGAAGGAGAGGG - Intronic
1185523984 X:762571-762593 ATGATGTTATGGGTTGAAGAGGG - Intergenic
1185988256 X:4861174-4861196 ATTATGTTATACGGAGGAGATGG - Intergenic
1186878132 X:13837567-13837589 ATGATGATAAAGAGAGGAGAAGG - Intronic
1187715424 X:22097709-22097731 ATGGTGTTTTAGGTAGGATAGGG + Intronic
1188941049 X:36237982-36238004 TTGATTTTGAAGGTAAGAGATGG - Intronic
1189804992 X:44726770-44726792 CTGATTTTAAAAGTAGCAGATGG + Intergenic
1190650086 X:52560697-52560719 ATAAAATTAAAGGTATGAGAAGG + Intergenic
1190684845 X:52862692-52862714 ATGACATTAAAGGTAGGCAAAGG + Intronic
1192881270 X:75285918-75285940 GTGAAGGTAAAGGAAGGAGAAGG + Intronic
1192951678 X:76024580-76024602 CTGATATTAAAGGTTGGAGATGG + Intergenic
1193451806 X:81679927-81679949 AGGATGCTAAAGGCAGGAGTGGG - Intergenic
1194130689 X:90078169-90078191 AAGTTGTTAAAGGTAGAACATGG + Intergenic
1197334557 X:125196530-125196552 TTAATGTTAAAGGCAGGAGGGGG + Intergenic
1197822564 X:130555820-130555842 GAGATGTTAAGGGAAGGAGAGGG - Intergenic
1197998074 X:132401951-132401973 ATGATGTAAAAAGGTGGAGAGGG + Intronic
1198126918 X:133653971-133653993 AGGATGTTAAAGCCAGGAGAGGG - Intronic
1198445638 X:136711228-136711250 AAGATTTTAAATGAAGGAGAGGG - Intronic
1199371058 X:147048617-147048639 ATGAAGTTAAAGGACAGAGAAGG + Intergenic
1199462283 X:148098082-148098104 ATGATTTTTCAGGAAGGAGATGG + Intergenic
1201850711 Y:18476888-18476910 ATGGCCTTAAAGGTAGAAGATGG - Intergenic
1201859798 Y:18584433-18584455 AGGATCCTAAAGTTAGGAGAGGG - Intronic
1201873523 Y:18735948-18735970 AGGATCCTAAAGTTAGGAGAGGG + Intronic
1201882607 Y:18843489-18843511 ATGGCCTTAAAGGTAGAAGATGG + Intergenic