ID: 1149900854

View in Genome Browser
Species Human (GRCh38)
Location 17:60476618-60476640
Sequence GACATAAGGTCTTGGTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149900854 Original CRISPR GACATAAGGTCTTGGTATAC AGG Intronic
910211171 1:84794871-84794893 GACATGAGGTGTTGATGTACTGG + Intergenic
915285856 1:154851615-154851637 GACAAAAGGTCATGGTGTGCAGG - Intronic
917776782 1:178345874-178345896 GAAATGAGCTCTTGGTACACAGG - Intronic
920578840 1:207085642-207085664 GAGATGAGGTCTTGCTATGCTGG + Intronic
922299059 1:224279873-224279895 GAGACAGGGTCTTGGTATGCTGG + Intronic
1072939783 10:99751376-99751398 GAGATGAGGTCTTGCTATATTGG + Intronic
1075108798 10:119560885-119560907 GAGATGAGGTCTTGCTATATTGG + Intergenic
1085090413 11:73707602-73707624 GATATAAGGACTGGTTATACAGG + Intronic
1087562856 11:99813732-99813754 GACATAAGGTTGTGGTATCTTGG + Intronic
1097755254 12:63400695-63400717 GACATAGGCTCTGGGCATACAGG - Intergenic
1105064717 12:133186354-133186376 GACATAAGCTGTTGGTCTCCAGG + Intronic
1106249526 13:27972898-27972920 GAGATAGGGTCTTGCTATCCTGG - Intergenic
1114931045 14:27467043-27467065 GACATAGAGTCTGGGTCTACTGG - Intergenic
1118067243 14:62205712-62205734 GACAGATGGGCTTAGTATACTGG - Intergenic
1119567823 14:75643778-75643800 GACATAATGATTTGGTACACTGG + Intronic
1120725560 14:87936042-87936064 GAGATAAGGTCCTGTTAGACAGG - Intronic
1125346425 15:38723407-38723429 GACATCAGGTTTTGGCATCCTGG - Intergenic
1127007654 15:54588514-54588536 TCCATAAGTTATTGGTATACAGG + Intronic
1134167613 16:11942923-11942945 GACATAAGGTTATTGTAAACAGG + Intronic
1134493088 16:14710789-14710811 GACATAAGGTTATTGTAAACAGG - Intronic
1134498469 16:14749913-14749935 GACATAAGGTTATTGTAAACAGG - Intronic
1134525021 16:14936547-14936569 GACATAAGGTTATTGTAAACAGG - Intronic
1134547874 16:15124376-15124398 GACATAAGGTTATTGTAAACAGG + Intronic
1134582106 16:15379172-15379194 GACATAAGGTTATTGTAAACAGG + Intronic
1134712611 16:16335034-16335056 GACATAAGGTTATTGTAAACAGG - Intergenic
1134720475 16:16378345-16378367 GACATAAGGTTATTGTAAACAGG - Intergenic
1134946952 16:18333540-18333562 GACATAAGGTTATTGTAAACAGG + Intronic
1134954216 16:18373659-18373681 GACATAAGGTTATTGTAAACAGG + Intergenic
1135313040 16:21420575-21420597 GACATAAGGTTATTGTAAACAGG + Intronic
1135365964 16:21852855-21852877 GACATAAGGTTATTGTAAACAGG + Intronic
1135445851 16:22518307-22518329 GACATAAGGTTATTGTAAACAGG - Intronic
1136152195 16:28358307-28358329 GACATAAGGTTATTGTAAACAGG + Intronic
1136210885 16:28756975-28756997 GACATAAGGTTATTGTAAACAGG - Intronic
1136255607 16:29036934-29036956 GACATAAGGTTATTGTAAACAGG - Intergenic
1136309709 16:29399303-29399325 GACATAAGGTTATTGTAAACAGG + Intronic
1136323152 16:29501083-29501105 GACATAAGGTTATTGTAAACAGG + Intronic
1136437836 16:30241051-30241073 GACATAAGGTTATTGTAAACAGG + Intronic
1138163646 16:54779208-54779230 GACATAAGGGCTTATTTTACAGG - Intergenic
1140365282 16:74376238-74376260 GACATAAGGTTATTGTAAACAGG - Intergenic
1140546211 16:75812189-75812211 GAAATAAGGTATTGGCACACAGG + Intergenic
1144650023 17:17001598-17001620 CACATAAGGTCTTGGGAGACAGG + Intergenic
1147339671 17:39745979-39746001 GACAGCAGGGCTTGGTAGACGGG + Exonic
1148179541 17:45594257-45594279 GCCATAAAGGCTTGGTAAACAGG - Intergenic
1148269366 17:46251646-46251668 GCCATAAAGGCTTGGTAAACAGG + Intergenic
1149900854 17:60476618-60476640 GACATAAGGTCTTGGTATACAGG + Intronic
1154118838 18:11634930-11634952 GACATAAGGTTATTGTAAACAGG + Intergenic
1163051004 19:14683479-14683501 GACATAAGGGCCTTGTATAAGGG - Intronic
939783383 2:146477303-146477325 GGCATAAGGTCTTGCTTTACAGG - Intergenic
943762390 2:191623954-191623976 GAGATAAAGTCTGGGTAGACAGG - Intergenic
947208672 2:227685597-227685619 GACACAGGGTCTTGCTATATTGG + Intronic
947690143 2:232127837-232127859 GACATAAGGACAGTGTATACAGG - Intronic
948508135 2:238444897-238444919 GATATCAGTTCTTGGTATTCAGG - Intronic
1169463331 20:5815791-5815813 GAAATGAGGTCTGGGTATAGTGG + Intronic
1178129871 21:29560250-29560272 CATATAAGGTCCTGGTATAGTGG - Intronic
949379553 3:3429948-3429970 GAAATAAGGTCGTGGAATAAAGG - Intergenic
952267267 3:31798789-31798811 GATACAAGCTCTTTGTATACAGG - Intronic
952299798 3:32094384-32094406 GACATTTGTTCTTGGTATAGCGG - Intergenic
952451276 3:33435445-33435467 GAGATAAGGTCTTGCTATGTTGG - Intronic
952784028 3:37134518-37134540 GACACAAGCTCTTGGTATTGTGG - Intronic
953426679 3:42800734-42800756 AACAAAAGGTCTTGGACTACTGG + Intronic
966448432 3:180030243-180030265 GGCATAATGTCTTGGAATAGGGG + Intronic
970202275 4:13622049-13622071 GAGACAAGGTCTTGCTATATTGG + Intronic
974076002 4:57169119-57169141 GACATTTGGCCTTGGTATCCTGG + Intergenic
980304602 4:131042240-131042262 GAAATAATGTCTGGGTGTACAGG + Intergenic
984106535 4:175554898-175554920 GACATGATGTTTTGTTATACAGG + Intergenic
992315928 5:75554973-75554995 AAAATAAGGTCTTTTTATACAGG - Intronic
992713948 5:79490743-79490765 GAGATGGGGTCTTGCTATACTGG - Intronic
993277328 5:85877352-85877374 GCCATAAGTTATTGGTGTACAGG + Intergenic
1005432755 6:25775612-25775634 GAGATGAGGTCTTGTTATATTGG + Intronic
1008718223 6:54315764-54315786 GACATAACCTTTTGGTATAGAGG + Intronic
1010235921 6:73574571-73574593 GAAATAAGGTCTTGCTATGTTGG + Intergenic
1013900497 6:115150548-115150570 TACATAAGTTATTGGCATACAGG + Intergenic
1015996260 6:138998187-138998209 GACATATGGTCTTGGTAAGTGGG - Intergenic
1016679677 6:146814512-146814534 CATATAAGGCCTTGGTATCCTGG + Intronic
1021119951 7:16788012-16788034 GACATGGGGTCTTGGTATGTTGG + Intergenic
1031967047 7:128033938-128033960 GATATAAGTTCTTGGTATGGTGG - Intronic
1032869614 7:135969643-135969665 GAGAAAAGGTCTTTGTAAACAGG + Intronic
1037761711 8:21745913-21745935 GAGATGAGCTCTTGGTATAAGGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041977062 8:63811829-63811851 GTCACAAGGTCTTGGGATGCTGG + Intergenic
1048112459 8:131483722-131483744 GAGAAAAGGCCTTGGTTTACTGG + Intergenic
1052806089 9:33014570-33014592 GACATCAGGTTTTGGTAATCAGG + Intronic
1059776061 9:117476271-117476293 GACATAACCTCTTGAAATACTGG - Intergenic
1188012299 X:25069916-25069938 GAGATAAGGTCTTGCTATGTTGG + Intergenic
1190111266 X:47590537-47590559 GACATATGGTCATGCTACACTGG + Intronic
1190920657 X:54848724-54848746 CACATAAGCTCTTTGTAAACTGG + Intergenic
1193174545 X:78377304-78377326 GAAATACCGTCTTTGTATACTGG - Intergenic
1193474612 X:81947981-81948003 AACATATGGTCTTGGGATATAGG + Intergenic
1199622742 X:149714264-149714286 GAGATGAGGTCTTGGTGTAAAGG + Intronic