ID: 1149909373

View in Genome Browser
Species Human (GRCh38)
Location 17:60553009-60553031
Sequence CTCCCCAAAGGGAAATCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149909373_1149909378 16 Left 1149909373 17:60553009-60553031 CCACCTGATTTCCCTTTGGGGAG No data
Right 1149909378 17:60553048-60553070 TTCCATTCATGTGTTTCAGATGG No data
1149909373_1149909379 17 Left 1149909373 17:60553009-60553031 CCACCTGATTTCCCTTTGGGGAG No data
Right 1149909379 17:60553049-60553071 TCCATTCATGTGTTTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149909373 Original CRISPR CTCCCCAAAGGGAAATCAGG TGG (reversed) Intergenic
No off target data available for this crispr