ID: 1149909373 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:60553009-60553031 |
| Sequence | CTCCCCAAAGGGAAATCAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149909373_1149909378 | 16 | Left | 1149909373 | 17:60553009-60553031 | CCACCTGATTTCCCTTTGGGGAG | No data | ||
| Right | 1149909378 | 17:60553048-60553070 | TTCCATTCATGTGTTTCAGATGG | No data | ||||
| 1149909373_1149909379 | 17 | Left | 1149909373 | 17:60553009-60553031 | CCACCTGATTTCCCTTTGGGGAG | No data | ||
| Right | 1149909379 | 17:60553049-60553071 | TCCATTCATGTGTTTCAGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149909373 | Original CRISPR | CTCCCCAAAGGGAAATCAGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||