ID: 1149909378

View in Genome Browser
Species Human (GRCh38)
Location 17:60553048-60553070
Sequence TTCCATTCATGTGTTTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149909376_1149909378 4 Left 1149909376 17:60553021-60553043 CCTTTGGGGAGCTATCTCTCTTC No data
Right 1149909378 17:60553048-60553070 TTCCATTCATGTGTTTCAGATGG No data
1149909375_1149909378 5 Left 1149909375 17:60553020-60553042 CCCTTTGGGGAGCTATCTCTCTT No data
Right 1149909378 17:60553048-60553070 TTCCATTCATGTGTTTCAGATGG No data
1149909373_1149909378 16 Left 1149909373 17:60553009-60553031 CCACCTGATTTCCCTTTGGGGAG No data
Right 1149909378 17:60553048-60553070 TTCCATTCATGTGTTTCAGATGG No data
1149909374_1149909378 13 Left 1149909374 17:60553012-60553034 CCTGATTTCCCTTTGGGGAGCTA No data
Right 1149909378 17:60553048-60553070 TTCCATTCATGTGTTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149909378 Original CRISPR TTCCATTCATGTGTTTCAGA TGG Intergenic
No off target data available for this crispr