ID: 1149910971

View in Genome Browser
Species Human (GRCh38)
Location 17:60566404-60566426
Sequence AAGGGTAAACACCAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149910971 Original CRISPR AAGGGTAAACACCAGGAGGC AGG (reversed) Intronic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900637242 1:3671947-3671969 AAGGGAACACGCCAGGAGGGAGG + Intronic
900790764 1:4678739-4678761 AAGACTGAACACCAGGAGGTGGG + Intronic
901650048 1:10738056-10738078 AAGGGTAAACTCCACGAAGGAGG - Intronic
903655973 1:24948942-24948964 AGGGGCAAGCAGCAGGAGGCAGG - Intronic
903924891 1:26825211-26825233 AGGCGTAAATACCAGGAGGCAGG - Intergenic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905418175 1:37819088-37819110 GAGGGTCCACACCAGGAGGGCGG + Intronic
905470643 1:38189086-38189108 AAGCATGAACACCAGGAGGCTGG + Intergenic
905509898 1:38510965-38510987 AATGCAAACCACCAGGAGGCTGG + Intergenic
907221219 1:52908064-52908086 AAGGAGAAACACCAGGAACCCGG + Intronic
908451740 1:64262787-64262809 AGGTGTAAATACCAGGATGCAGG + Intronic
909098187 1:71316021-71316043 AGGCATGAACACCAGGAGGCAGG - Intergenic
910160523 1:84267458-84267480 AAGGGTGAACTCCAGGAGCAGGG - Intergenic
910310860 1:85822939-85822961 AAGAGGAAACACCAGGGGCCAGG - Intronic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911757485 1:101575892-101575914 AAGAGTAAACAGCCGGAGGCAGG + Intergenic
912475680 1:109933316-109933338 AAGAGTACAAACCAGGTGGCTGG + Intergenic
912964179 1:114222968-114222990 GAGTGTAAACTCCATGAGGCAGG + Intergenic
913434613 1:118833739-118833761 AATGGAAAACACAAAGAGGCAGG + Intergenic
916135238 1:161646978-161647000 AAGGGTAAAATTCAGGAGGGTGG - Intronic
918692006 1:187492536-187492558 AAGGACCAACACCAGGATGCAGG - Intergenic
919427192 1:197447499-197447521 AGGTGTAAACACCAGGAGGTGGG + Intronic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
919945004 1:202312501-202312523 AAGGGTAAACACCATCAGTTGGG - Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920710275 1:208288156-208288178 AAAGGTAAACCCCAGGAGGGAGG - Intergenic
920710699 1:208292079-208292101 GAGTGTGAATACCAGGAGGCAGG - Intergenic
920948946 1:210554913-210554935 AAGAGAAAACACCAGCAGGATGG - Intronic
921624501 1:217363507-217363529 AACGTTGAATACCAGGAGGCAGG - Intergenic
1062914312 10:1235569-1235591 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914609 10:1236797-1236819 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914649 10:1236917-1236939 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914763 10:1237277-1237299 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914780 10:1237325-1237347 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914848 10:1237541-1237563 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914864 10:1237589-1237611 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914887 10:1237661-1237683 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914896 10:1237685-1237707 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914936 10:1237805-1237827 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914999 10:1237998-1238020 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915096 10:1238304-1238326 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915217 10:1238686-1238708 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915261 10:1238827-1238849 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915391 10:1239240-1239262 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915439 10:1239385-1239407 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915587 10:1239841-1239863 GGGAGTAAACACCGGGAGGCAGG - Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1065119800 10:22517234-22517256 ATGGGTACATGCCAGGAGGCGGG - Intergenic
1067156383 10:43784480-43784502 AACAGAAAACACCAGGAGACAGG + Intergenic
1067684878 10:48460070-48460092 GAGGATGCACACCAGGAGGCTGG + Intronic
1069591097 10:69642405-69642427 ACGCATGAACACCAGGAGGCTGG + Intergenic
1071549282 10:86553988-86554010 ATGGGTGAACACCAGGAGGCAGG + Intergenic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1074951622 10:118342391-118342413 AAAGGGAAGCCCCAGGAGGCCGG - Intergenic
1075938759 10:126369799-126369821 GAGAGTGAATACCAGGAGGCGGG - Intronic
1079294714 11:19222595-19222617 GGGTGTAAACACCAGGAGGTGGG + Intergenic
1080123644 11:28705643-28705665 TATGGGAAACTCCAGGAGGCTGG - Intergenic
1081686664 11:45047799-45047821 AAGGGTAAAGTTCTGGAGGCAGG - Intergenic
1081689406 11:45067076-45067098 AGGTGTGGACACCAGGAGGCAGG + Intergenic
1081717220 11:45259004-45259026 AAGTGAAAACATCTGGAGGCTGG - Intronic
1081858910 11:46320832-46320854 AATGGGAAGCTCCAGGAGGCAGG - Exonic
1083904052 11:65658699-65658721 AAAGGTATACATCAGGAGGCAGG - Exonic
1084572173 11:69966374-69966396 AAGGCTGAAAACCAGGTGGCAGG - Intergenic
1088920212 11:114254994-114255016 TATGATACACACCAGGAGGCTGG - Intergenic
1089005980 11:115091150-115091172 AACTGCAAACACCAAGAGGCTGG + Intergenic
1090523981 11:127509455-127509477 AAGTGTAAATTCCAGAAGGCAGG - Intergenic
1091088883 11:132750375-132750397 AAGGGACAACCACAGGAGGCAGG + Intronic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1092776530 12:11949146-11949168 AAGTGCAAACACCCTGAGGCAGG + Intergenic
1094171276 12:27494912-27494934 AAGGGCAAGCACTAGAAGGCAGG - Intronic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1097312790 12:58139495-58139517 TAGGGTATACACCTGGAGGAAGG - Intergenic
1098113371 12:67147896-67147918 AGGCATAAACACCAGGAGGCAGG + Intergenic
1098139658 12:67438615-67438637 ATCCGTGAACACCAGGAGGCTGG - Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1100722170 12:97370653-97370675 AAGGGCAAAAACCAGGGGACAGG + Intergenic
1100727465 12:97423857-97423879 AAAGTTAAAAACCAGGAGGCAGG - Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101540315 12:105659177-105659199 AAAGGAAACCACCAGGAGTCAGG + Intergenic
1101708649 12:107244387-107244409 AAATGTAAAGGCCAGGAGGCAGG + Intergenic
1103016352 12:117497609-117497631 GAGGGTACAGACCAGGAGACTGG + Intronic
1103496664 12:121367983-121368005 ATGGGTAGAACCCAGGAGGCGGG + Intronic
1104871641 12:132002785-132002807 AGGAGTGAACACCAGGAGGTGGG + Intronic
1105399052 13:20071751-20071773 AAGGGAAAACACCTGGGGGCAGG - Intronic
1105988812 13:25597275-25597297 AGGTGTAGACACCAGGAGGCAGG - Intronic
1106502829 13:30345859-30345881 AAGGGTGAACACCAGGAGGTGGG + Intergenic
1110565845 13:76956953-76956975 AACCGTAACCACCAGGAGGCAGG - Intronic
1111842446 13:93467361-93467383 AATGGTATGCACCAGGAGGGTGG + Intronic
1115351047 14:32396264-32396286 AAAGCTAAACACCATGAGGCTGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117072093 14:52066910-52066932 AAGACTAAAGACCAGGAGCCTGG + Intronic
1117718399 14:58604063-58604085 AAGAGGAAACACCAGGATGGGGG - Intergenic
1118428039 14:65688872-65688894 GAAGGTAAACACCAGGAAGAAGG - Intronic
1119092261 14:71795645-71795667 AAAGATAAACACCAGTTGGCAGG + Intergenic
1122025501 14:98873000-98873022 AAAGGTACAGACCAGGAGGAGGG - Intergenic
1124145351 15:27120022-27120044 ATGTGTGAACACCAGGAGGTGGG + Intronic
1124653281 15:31488154-31488176 AAGGGTAAACACCAGGCAGAAGG + Intronic
1125280752 15:38040238-38040260 AGAAGTAAACATCAGGAGGCTGG + Intergenic
1126993726 15:54415424-54415446 AATAGTATCCACCAGGAGGCGGG + Intronic
1127572226 15:60254952-60254974 AAGCATAAACACCAAGGGGCAGG + Intergenic
1128873390 15:71181825-71181847 AAGAGTTAACAACAGGAGTCAGG - Intronic
1129014484 15:72454211-72454233 AATGGTAAAACCCAGGAAGCTGG - Intergenic
1129672873 15:77616750-77616772 AGGAGTCAAGACCAGGAGGCAGG - Intronic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1130689069 15:86064624-86064646 AAGCATGAACACCAGGAGGTGGG + Intergenic
1130717063 15:86345308-86345330 GAGGTTAAACACCAGGGGGATGG - Intronic
1131323507 15:91420725-91420747 AAGGGTAAAGACCTGGAATCAGG + Intergenic
1131441642 15:92464141-92464163 CAGGGTATACATCAAGAGGCCGG - Exonic
1132392141 15:101446999-101447021 AAGGTGACACAGCAGGAGGCAGG + Intronic
1132818929 16:1851477-1851499 GAGGGTAAACTCCATGAGGGTGG + Intronic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1134622429 16:15699629-15699651 AAGGGTGAACATCAAGAGTCAGG - Intronic
1135350666 16:21726545-21726567 AAGGGCACACACTGGGAGGCTGG - Exonic
1138126395 16:54442457-54442479 AAGGAAAAATCCCAGGAGGCTGG + Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138418929 16:56886798-56886820 AAGGGAAAACACAAGGAGTGGGG - Intronic
1138653336 16:58474389-58474411 AAGCGCAAAGGCCAGGAGGCAGG - Intronic
1139404582 16:66707863-66707885 AAGGGCAGAGGCCAGGAGGCTGG + Intergenic
1141359045 16:83377440-83377462 AAGAGGAAACCCCAGGAGGAAGG - Intronic
1142002237 16:87670528-87670550 AAGGATAACCAACAGGAGGCTGG - Intronic
1142803974 17:2362048-2362070 AGGGGTAAACCCCAGAATGCTGG - Intronic
1143865357 17:9919148-9919170 AAGGGTGAACAACAGGCGGCAGG - Intronic
1143943481 17:10568196-10568218 AAGGCCAAACACTGGGAGGCAGG + Intergenic
1144830643 17:18129262-18129284 GTGGGTAAACACCAGAAGGGTGG - Intronic
1147186384 17:38715570-38715592 AAGGTTCAACACCAGGTGCCTGG - Intronic
1148606127 17:48930442-48930464 AAGGGCACACAGCAGCAGGCAGG - Exonic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150107397 17:62472436-62472458 CAGGATAAAAGCCAGGAGGCTGG + Intronic
1150317981 17:64185976-64185998 AAGGGTAAGTGCCAGGTGGCTGG + Intronic
1151432238 17:74071402-74071424 AAAGTTAAACACCAGCAGGAGGG + Intergenic
1151575206 17:74949679-74949701 AAGGGTGCACCCCAGGAGGCTGG + Exonic
1152673627 17:81624830-81624852 AAGCACAAAGACCAGGAGGCAGG + Intronic
1152978454 18:248385-248407 AAGGGCAAACACCAAGATGATGG + Intronic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1155235002 18:23810362-23810384 AGGGCTGAACACCAGCAGGCTGG - Exonic
1156801551 18:41120960-41120982 AATGACAAACACCAGGAGGAAGG + Intergenic
1157848712 18:51028250-51028272 AAGCTTGAACACCAGGAGGTGGG - Intronic
1157933642 18:51850545-51850567 ATACATAAACACCAGGAGGCAGG - Intergenic
1158229164 18:55234464-55234486 AGGGATGAACACCAAGAGGCTGG + Intronic
1158695652 18:59700875-59700897 AAAAGTAAACACCAGGACACAGG + Intergenic
1161582955 19:5090748-5090770 AAGGTCACACAGCAGGAGGCTGG + Intronic
1162752488 19:12837474-12837496 AAGGGCAAAGGCCTGGAGGCGGG - Intronic
1164334398 19:24297767-24297789 AAGGATAAAAACTAGAAGGCTGG + Intergenic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
926108620 2:10168095-10168117 AAGGGGAAACACCAGGAATGAGG - Intronic
926972656 2:18482352-18482374 CACGGTAAGCACCAGGAGGCAGG + Intergenic
927875342 2:26651473-26651495 TGGGTTACACACCAGGAGGCAGG + Intergenic
928959726 2:36911658-36911680 AAGTGAAGACACAAGGAGGCTGG - Intronic
929022934 2:37572002-37572024 AAGGTTCAACACAAGGAGGTGGG + Intergenic
929265073 2:39909495-39909517 AAATGTGAATACCAGGAGGCAGG + Intergenic
930209041 2:48615628-48615650 AGTGGTCAATACCAGGAGGCAGG + Intronic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
932220717 2:69997023-69997045 AAGTGGACACACAAGGAGGCTGG + Intergenic
932438069 2:71714804-71714826 GAGTGTAAACCCCAGGAGGAGGG + Intergenic
933878638 2:86645784-86645806 AGGTGTGAATACCAGGAGGCAGG - Intronic
934855353 2:97725855-97725877 AAGTGCAAAGATCAGGAGGCAGG + Intronic
935848469 2:107192668-107192690 GAGGGTAACCACCAGGAGGTGGG + Intergenic
937203060 2:120218222-120218244 AAGGTTAAGTACCAGGAGGGAGG - Intergenic
939218184 2:139267113-139267135 ATGGGGAAACTCCAGGAGGATGG + Intergenic
939960589 2:148561795-148561817 AAGGGGCAATACGAGGAGGCTGG - Intergenic
940256752 2:151739108-151739130 AAGTATGATCACCAGGAGGCAGG - Intergenic
940908718 2:159191479-159191501 GGGGGTAAAGACCATGAGGCCGG + Intronic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
943784478 2:191861917-191861939 AAGAGTGTAGACCAGGAGGCAGG - Intergenic
945660652 2:212681496-212681518 GAGGGTAAACATCATGAGGCAGG + Intergenic
947039152 2:225895493-225895515 ATTGGAAATCACCAGGAGGCAGG - Intergenic
947770381 2:232665827-232665849 AACATTAAACACCAGGAAGCAGG - Intronic
948117940 2:235507515-235507537 AAGGGAAGAAACCAGGAGGATGG - Intronic
948274315 2:236696458-236696480 ATGGGTTAAGACCAGGAGCCAGG - Intergenic
948681295 2:239636456-239636478 AGGCATAAACACCAGGAGGCAGG - Intergenic
1169248237 20:4041000-4041022 AATTGTAGACTCCAGGAGGCAGG + Intergenic
1172197124 20:33099607-33099629 ATGGGCAAAGGCCAGGAGGCAGG - Intronic
1172419854 20:34806976-34806998 AGGCATGAACACCAGGAGGCTGG - Intronic
1174003377 20:47390943-47390965 AAGTATAAATAACAGGAGGCTGG - Intergenic
1175136650 20:56829277-56829299 AAGGGTAAACGCCCTGAGGTGGG - Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175891278 20:62317132-62317154 ACGGGCAAAGACCTGGAGGCGGG - Intronic
1177006325 21:15676742-15676764 ATGGGTGAATTCCAGGAGGCAGG - Intergenic
1180717214 22:17879952-17879974 AAGGGTAAAGACCTGCAGGTAGG + Intronic
1181773046 22:25140607-25140629 GGGCGTGAACACCAGGAGGCAGG + Intronic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1184419143 22:44369459-44369481 AAGGGCAAAGGCCTGGAGGCAGG - Intergenic
1184438166 22:44492934-44492956 TAGGGTAGACTCCAGGAGGTGGG - Exonic
1184837316 22:47031679-47031701 AAAGGTGCACACAAGGAGGCAGG - Intronic
950171231 3:10840269-10840291 AAGGGCAAAAGCCAGGAGGCTGG - Intronic
950457759 3:13102785-13102807 AAATGTAAGCTCCAGGAGGCGGG + Intergenic
950892013 3:16412611-16412633 AAGTGTGAACACCAGGAGGTGGG - Intronic
951576982 3:24123934-24123956 AAGGGGTGACACAAGGAGGCTGG + Intronic
951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG + Intronic
952932166 3:38368821-38368843 AGGGGTGAACACCAGGAGGTGGG + Intronic
954448585 3:50559681-50559703 ATCGGTAAACACCAGCCGGCTGG + Exonic
954553121 3:51498841-51498863 AAAGGTAAACTCCAGTAAGCTGG + Intronic
954855913 3:53643324-53643346 GTGGGTAAACCACAGGAGGCTGG - Intronic
954930244 3:54275000-54275022 AGGCATAAAGACCAGGAGGCAGG + Intronic
955235659 3:57136840-57136862 AATTGTAAACACCTAGAGGCAGG - Intronic
955487630 3:59450549-59450571 GACGGTAAACTCCATGAGGCAGG + Intergenic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
960046009 3:113199233-113199255 AAGGGTAAACACCAAGTGATAGG + Intergenic
960258828 3:115541649-115541671 AAGGGTAATAACCCGGAGGGAGG - Intergenic
961540976 3:127599162-127599184 AAGGGCAAAGATCTGGAGGCTGG + Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962095446 3:132287968-132287990 AAGTGTAAAAACCCTGAGGCAGG - Intergenic
963444532 3:145387368-145387390 AAGGGTAAAAACCAGCATGGGGG - Intergenic
963475614 3:145799885-145799907 AAGGGTAAACACTTGGAAGGAGG - Intergenic
967043468 3:185715431-185715453 CCAGGTAAACACCGGGAGGCAGG + Intronic
967169763 3:186813873-186813895 AAGTGTGAACACCTGGAGGTAGG + Intergenic
967378543 3:188832072-188832094 AGATGTAAACACCAGGAGGCAGG - Intronic
970124999 4:12799302-12799324 AGGCGTAAATACCAGAAGGCAGG - Intergenic
970422098 4:15914890-15914912 ATGGGGAAGCACCAGGAGGCAGG + Intergenic
970453949 4:16203067-16203089 AAATATAAACACTAGGAGGCTGG - Intronic
970944417 4:21673125-21673147 AAGGGTGAATACCAGGAGGTGGG + Intronic
971261569 4:25062029-25062051 AAGTGTAAACTCCATGAGGACGG - Intergenic
971971855 4:33631178-33631200 AAATGGAAATACCAGGAGGCAGG + Intergenic
973994134 4:56439531-56439553 AAGGGTAAAGAACAGTGGGCCGG - Intronic
975053338 4:69894349-69894371 AAGGGTAAACACCAGCAGTGAGG + Intergenic
977241407 4:94574668-94574690 AAGAATAAATCCCAGGAGGCGGG - Intronic
979312876 4:119224699-119224721 AGGGAGAAACTCCAGGAGGCTGG + Intronic
983970286 4:173863307-173863329 AGGCATGAACACCAGGAGGCAGG + Intergenic
986872868 5:12070848-12070870 AAGTGTTAACATCAGCAGGCAGG + Intergenic
988549862 5:32190647-32190669 AAGAGTGAACGCCAGAAGGCAGG + Intergenic
988850396 5:35174737-35174759 AAGGGTAAAGTCAAGGTGGCTGG - Intronic
990466170 5:56073914-56073936 CAGGGTATGCACCAGGAGGCTGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991100702 5:62789347-62789369 AAGGGTACAAAGCAGGAGGCAGG + Intergenic
992180267 5:74189414-74189436 GAGTGTGAATACCAGGAGGCAGG + Intergenic
992351934 5:75939144-75939166 AAGCTGAAAAACCAGGAGGCTGG - Intergenic
992669158 5:79041696-79041718 AAGAGAAAGCTCCAGGAGGCCGG + Intronic
993376812 5:87158108-87158130 AATGGTAAACAACAGGATGTGGG + Intergenic
994383661 5:99102261-99102283 GGGTGTAAACACCAGGAGGTGGG - Intergenic
994474286 5:100247898-100247920 AAGCCTCAACACCATGAGGCAGG + Intergenic
996403490 5:123086682-123086704 AAGGGAATAGACCAGGAGTCAGG - Intergenic
997701095 5:135899941-135899963 AAGGGTAAAGGCCTGGAGGATGG - Intergenic
998170900 5:139871468-139871490 AAGGGTAGACATCAGGAGATGGG + Intronic
998511553 5:142718449-142718471 ATGGGTAAATACAAGGAAGCTGG + Intergenic
998989620 5:147801399-147801421 AAGGGTAGACATCAGAAGTCAGG + Intergenic
1000763587 5:165256940-165256962 AAAGGTAGACACCAGGAGCAGGG + Intergenic
1003094794 6:3133613-3133635 AAGGGCCCACACAAGGAGGCAGG - Intronic
1003691923 6:8363352-8363374 AAGGCTATACACTAGGAGCCAGG + Intergenic
1004504939 6:16239641-16239663 AGGAGTAAACACGAGGAGGCTGG + Intronic
1005892670 6:30153099-30153121 AAGTGGCAACACCAGGAGGAAGG + Exonic
1006917647 6:37605210-37605232 AAGAGAAGACACCAGGAAGCAGG - Intergenic
1007691732 6:43706839-43706861 AAGGTGAAACAACAGGAGTCCGG - Intergenic
1008798627 6:55339171-55339193 AAGCGTAATCTCCAGGTGGCTGG + Intronic
1010345603 6:74806545-74806567 GAGTGTGAACACCCGGAGGCAGG - Intergenic
1010351540 6:74880911-74880933 TTGGATAAACACCAGGAGGCTGG + Intergenic
1012296685 6:97533041-97533063 AGATGTAAATACCAGGAGGCAGG + Intergenic
1012638661 6:101580767-101580789 AAGTGTAAACTCCCAGAGGCAGG - Intronic
1012865685 6:104615554-104615576 AAGGGAATATACCAGGAGGAGGG - Intergenic
1013301059 6:108805297-108805319 GCGTGCAAACACCAGGAGGCAGG + Intergenic
1014163737 6:118200378-118200400 AAGTGGAAACACCAGGAGTAAGG + Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015431616 6:133137234-133137256 AAGTGGAAAAACCAGGAAGCAGG + Intergenic
1016498396 6:144690150-144690172 AAGGGGCAAAACCAGGAGGGAGG + Intronic
1017166368 6:151411952-151411974 AAAAGTGAACACCAGGAGGTGGG - Intronic
1017494939 6:154975349-154975371 AAGGAGAAACACCTGGAGGGAGG + Intronic
1020407143 7:7849655-7849677 AATGGTAAACTCCATGAGGCAGG - Intronic
1020782484 7:12534656-12534678 AATGGAAAATAACAGGAGGCTGG + Intergenic
1021141419 7:17030147-17030169 AAGGGCAAACACCAGCCTGCTGG + Intergenic
1021981199 7:26057293-26057315 AAGGGTGAATGCCAGGAGACAGG + Intergenic
1022329758 7:29366410-29366432 AAGGGTGAAGACCAGGAGGGTGG + Intronic
1023961094 7:44926990-44927012 AAGGGCAGACACCACGTGGCAGG - Intergenic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1027290485 7:76703966-76703988 ATAGGTAACCACCAAGAGGCAGG + Intergenic
1029506136 7:100965203-100965225 AGGGGTTAGCGCCAGGAGGCAGG - Intronic
1031584349 7:123516793-123516815 TAGGGAAAACACAAGGTGGCTGG + Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032036443 7:128524972-128524994 CAGGATAAAAGCCAGGAGGCCGG + Intergenic
1032189946 7:129759156-129759178 AAAAGGAAACACCAGGAGCCCGG - Intergenic
1032313496 7:130812054-130812076 AAAGGTAAATACCAGAAGGCAGG + Intergenic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1033142416 7:138839665-138839687 AAGCCAAAACACCAGGAGGCAGG + Intronic
1033549876 7:142437579-142437601 AAAGGCAGACACCTGGAGGCAGG + Intergenic
1033986074 7:147227185-147227207 AAGTGCAAAGGCCAGGAGGCAGG + Intronic
1034440246 7:151082486-151082508 AAGGGCCAGCACCAGAAGGCAGG + Exonic
1034893049 7:154857472-154857494 CATGGCAAACACCTGGAGGCTGG - Intronic
1035485981 7:159226378-159226400 AAGGGTAGAAGCCAGGAGGGAGG + Intergenic
1036468080 8:9021610-9021632 TAGGGTTAACTCCAGGAGGAAGG - Intronic
1036587101 8:10134308-10134330 AACGGTAAACACCCAGAAGCTGG - Intronic
1037516319 8:19635393-19635415 GAGGAAAAACACCAGTAGGCAGG - Intronic
1037954287 8:23042135-23042157 CAGGGTCAAGACCAGGAAGCAGG - Intronic
1039714717 8:40095040-40095062 AAGGGGAGGCACCAGGAGGCAGG - Intergenic
1041717147 8:60942756-60942778 GGGGGTGAACACCAGGAGGATGG + Intergenic
1041963578 8:63648495-63648517 AAGGGGGGACACCAGGAAGCAGG - Intergenic
1044701654 8:94970620-94970642 AATGCTGAACACCAGGAGACTGG + Intronic
1046719292 8:117600833-117600855 AGGCATAAACATCAGGAGGCAGG - Intergenic
1047319361 8:123765068-123765090 AAGGGTAAAAACTGGGAGGTGGG + Intergenic
1047724856 8:127675115-127675137 AAGTGTGAACACCAGGAGGGAGG + Intergenic
1047883132 8:129218454-129218476 AAAGGAACACACCAGCAGGCAGG + Intergenic
1049268819 8:141683494-141683516 AAGGGGAAACCCCATAAGGCAGG - Intergenic
1049836928 8:144742008-144742030 CAGAGTAAAAACCAAGAGGCCGG + Intronic
1050596029 9:7205497-7205519 AGATGTAAGCACCAGGAGGCAGG + Intergenic
1050849482 9:10265207-10265229 GAGAGTAAGCTCCAGGAGGCAGG - Intronic
1052849952 9:33372021-33372043 GAAGGTAAACAGCAGGAGACAGG + Intergenic
1053034601 9:34813835-34813857 AAGCATGAACACCAGGAGGTGGG + Intergenic
1058337408 9:103848373-103848395 AAGTGTGAACACCAGGAGGTGGG - Intergenic
1061389701 9:130310630-130310652 GGGTGTGAACACCAGGAGGCGGG + Intronic
1061604210 9:131696243-131696265 GAGTGTGAATACCAGGAGGCGGG + Intronic
1062467909 9:136689296-136689318 AAGGGTGAACACCAGACAGCCGG + Intergenic
1062650841 9:137576439-137576461 AAGGATAAAAAACAGGTGGCCGG + Intronic
1187602056 X:20842772-20842794 AAGGGAAAATCCCAGGAGGCTGG + Intergenic
1187871982 X:23772123-23772145 AGGCATGAACACCAGGAGGCAGG - Intergenic
1189052927 X:37665336-37665358 AAGGGCAAAGACATGGAGGCAGG - Intronic
1189630236 X:42944621-42944643 AAGGAAAAACACAAGCAGGCTGG + Intergenic
1189961192 X:46326420-46326442 AAGAGAAAACACTAGGAGGATGG - Intergenic
1190437740 X:50443179-50443201 AGGGGTGAACACCAGGAGGCAGG + Intronic
1190725558 X:53188307-53188329 AGGTGTGAATACCAGGAGGCGGG - Intergenic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1191269320 X:58442761-58442783 AAGGATAAACACTAGAAGGTAGG - Intergenic
1191822796 X:65331190-65331212 AAGCCTAAACTCCAGGAGGGTGG - Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1193191458 X:78575798-78575820 TAGGGTAAAAACCAGCAGCCTGG + Intergenic
1195863517 X:109406348-109406370 AAGGGTGAAAACTAGGAGGTAGG + Intronic
1198671711 X:139088207-139088229 ATGGGTAAACCCCCAGAGGCTGG - Intronic
1198789457 X:140327758-140327780 AAGTGTGAAGACCCGGAGGCAGG + Intergenic
1199095192 X:143730080-143730102 AGGCGTAAACTCCAGGAGGAAGG - Intergenic
1199574623 X:149301505-149301527 GAGGGCAAACAGCAGAAGGCAGG + Intergenic
1199711473 X:150472796-150472818 GGGTGTAAATACCAGGAGGCAGG + Intronic
1200838072 Y:7752475-7752497 AAGTGTGAACACCAGGAGGTAGG - Intergenic