ID: 1149914207

View in Genome Browser
Species Human (GRCh38)
Location 17:60593600-60593622
Sequence CAAGCTTCCTCTCTTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149914197_1149914207 23 Left 1149914197 17:60593554-60593576 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1149914207 17:60593600-60593622 CAAGCTTCCTCTCTTTAAATAGG No data
1149914200_1149914207 19 Left 1149914200 17:60593558-60593580 CCAAAGTGCTGGGATTATAGGTG 0: 6178
1: 87471
2: 224511
3: 254762
4: 197112
Right 1149914207 17:60593600-60593622 CAAGCTTCCTCTCTTTAAATAGG No data
1149914202_1149914207 -8 Left 1149914202 17:60593585-60593607 CCACCCAACCTGGACCAAGCTTC No data
Right 1149914207 17:60593600-60593622 CAAGCTTCCTCTCTTTAAATAGG No data
1149914199_1149914207 20 Left 1149914199 17:60593557-60593579 CCCAAAGTGCTGGGATTATAGGT 0: 6588
1: 101778
2: 322380
3: 233931
4: 142133
Right 1149914207 17:60593600-60593622 CAAGCTTCCTCTCTTTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149914207 Original CRISPR CAAGCTTCCTCTCTTTAAAT AGG Intergenic
No off target data available for this crispr