ID: 1149914928

View in Genome Browser
Species Human (GRCh38)
Location 17:60600227-60600249
Sequence CGAGAGCTGGGCCGGAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149914928_1149914935 16 Left 1149914928 17:60600227-60600249 CCGGCGCTCCGGCCCAGCTCTCG 0: 1
1: 0
2: 1
3: 21
4: 171
Right 1149914935 17:60600266-60600288 TCGCGCGCCCCCCCTTCTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
1149914928_1149914934 15 Left 1149914928 17:60600227-60600249 CCGGCGCTCCGGCCCAGCTCTCG 0: 1
1: 0
2: 1
3: 21
4: 171
Right 1149914934 17:60600265-60600287 ATCGCGCGCCCCCCCTTCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149914928 Original CRISPR CGAGAGCTGGGCCGGAGCGC CGG (reversed) Exonic
900119143 1:1041111-1041133 CGGGAGCGGGGCGGGAGCGGGGG + Intronic
900129472 1:1081332-1081354 CGAGAGCAGGGCCCGCGCTCTGG + Intergenic
900207019 1:1435939-1435961 CGGGAGCCGGGCGGGGGCGCGGG + Intronic
900207924 1:1439496-1439518 CGTGAGTTGGGCCCCAGCGCTGG + Exonic
900494109 1:2968701-2968723 CGAGGGCAGAGCCGGATCGCAGG + Intergenic
901862456 1:12083399-12083421 CGAGAGCAGGCCCGGAGTGGTGG + Intronic
901883487 1:12207396-12207418 CCAGAGCTGGGGCAGAGCCCAGG - Exonic
904822920 1:33256738-33256760 CGGGGGCCGGGCCGGGGCGCGGG + Intronic
904837724 1:33349809-33349831 CGAGGCCGGGGCGGGAGCGCGGG + Intronic
905862663 1:41361579-41361601 GGAGAGCAGGGCCCGTGCGCAGG + Intergenic
912451604 1:109770756-109770778 GGAGAGCTGGGCTGGAGAGGAGG + Intronic
915586906 1:156848890-156848912 CGGGGGCGGGGCCGGAGCGGGGG - Intronic
919487326 1:198160204-198160226 TGAGAACTGGGCCTGAGAGCAGG + Intronic
919919819 1:202161218-202161240 GGAGAGCTGGGCCGTGGCACAGG - Exonic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065025385 10:21535104-21535126 CGAGATCTGGGCCGGGGTGGGGG + Intronic
1067806281 10:49395562-49395584 CTAGGGCTGGGCGGGAGCGCTGG - Intronic
1069673821 10:70233162-70233184 GGAGACCTGGGGCCGAGCGCGGG + Intronic
1069992986 10:72326137-72326159 CGAGAGCAGCGCCGGTGGGCTGG - Intergenic
1070305183 10:75235313-75235335 CAAGAGCTGGGCCTGCTCGCAGG + Exonic
1070441125 10:76444388-76444410 TGAGAGCTGGGCTCGAGCCCTGG + Intronic
1073351481 10:102822993-102823015 CGGGAGCTGGGGCAGAGCACCGG + Intergenic
1076353857 10:129838375-129838397 CGAGAGCAGGGCCTGTGAGCCGG - Intronic
1076750035 10:132537916-132537938 CGAGCGCGAGGCCGGAGCCCCGG + Exonic
1076906267 10:133363090-133363112 TCAGAGCTGGGCCTGGGCGCGGG + Intronic
1077005993 11:356281-356303 CCACAGCAGGGCCGGGGCGCAGG + Intergenic
1077384623 11:2263135-2263157 AGAGGGCTGGGCCGGAGGGCTGG - Intergenic
1079003168 11:16774441-16774463 CTAGAGCTGGGAAGGAACGCGGG - Intergenic
1083941989 11:65900714-65900736 AGAGGGCTGGGGCGGGGCGCGGG - Intergenic
1084431530 11:69114099-69114121 CGAGGGCTGGGCTCGAGCCCAGG - Intergenic
1089354019 11:117838071-117838093 CGGGAGGTGGGCAGGACCGCAGG + Exonic
1089496536 11:118911002-118911024 CGAGGGCTGAGTGGGAGCGCCGG + Intronic
1089730620 11:120516627-120516649 TGAGGGCTGGGCCTGGGCGCTGG + Intronic
1090269506 11:125376196-125376218 GGAGAGCTGGGCTGGAGCCCAGG + Intronic
1090778344 11:129984593-129984615 TGAGAGCTGTGGGGGAGCGCTGG - Intronic
1099191398 12:79565135-79565157 CGAGTGCAGGGCCGGTGGGCTGG - Intergenic
1101009003 12:100430485-100430507 CGAGAGCAGCGCCGGTGGGCTGG - Intergenic
1101493964 12:105236172-105236194 CGGGGGCTGGGCCGGCGGGCAGG - Intronic
1103322570 12:120100592-120100614 CCAGGGCTGGGCAGGAGCTCTGG - Intronic
1105968252 13:25404287-25404309 TGAGAGCTGGGGAGGAGAGCTGG + Intronic
1106057825 13:26254600-26254622 GGAGAGCTGGGTCGGGGGGCCGG - Exonic
1107935238 13:45340889-45340911 CCAGAGCTGGGCGCGAGCCCCGG + Intronic
1108435356 13:50396778-50396800 CGAGAGCAGCGCCGGTGGGCTGG - Intronic
1110999834 13:82165127-82165149 CGAGCGCTGCGCCGGTGGGCCGG + Intergenic
1118729518 14:68656601-68656623 CGAGCTCTGGGCCAGAGCGCAGG - Intronic
1118776817 14:68978726-68978748 GGAACGCCGGGCCGGAGCGCGGG - Intronic
1119320699 14:73728511-73728533 CCAGAGCTGAGCCGCAGCGATGG - Intronic
1119602055 14:75982807-75982829 CGAGAGCGGCTCCGGAGCGGCGG - Intronic
1119749159 14:77065238-77065260 CGAGCCCTGGGCAGGAGAGCTGG - Intergenic
1122779121 14:104136263-104136285 GGCGGGCGGGGCCGGAGCGCGGG + Intergenic
1122975437 14:105168908-105168930 CGCGCGCCGGGCCGGGGCGCTGG - Intergenic
1123055427 14:105567040-105567062 CACGAGCTGGCCCTGAGCGCGGG + Intergenic
1123799152 15:23803097-23803119 CGAGAGCAGCGCCGGTGGGCTGG - Intergenic
1124696762 15:31870344-31870366 CGACCGCGGGGCCGGGGCGCGGG - Intronic
1129726541 15:77904394-77904416 CGGGAGCTGGGGCGGAGCTGAGG + Intergenic
1129803828 15:78438040-78438062 CGCGAGCGGGGGCGGAGCGCTGG - Intronic
1131053483 15:89362620-89362642 CTAGAGCTGGGCCTGAGCCCGGG + Intergenic
1131130120 15:89893678-89893700 CGAGAGCGGGGCAGTAGGGCGGG + Intronic
1131888652 15:96948028-96948050 CGAGAGCCGGGCAGCAGCGCGGG - Intergenic
1132512843 16:352725-352747 CGGGGGCGGGGCCGGGGCGCGGG + Intergenic
1132588102 16:715003-715025 CGGGGGCGGGGCCGGAGCTCGGG - Intronic
1132657464 16:1047223-1047245 CCAGAGCTGGGCAGGAGAGATGG + Intergenic
1132869443 16:2109280-2109302 CGTGAGCTGGGCCCAGGCGCAGG - Exonic
1133325037 16:4937095-4937117 CGAGGGGCGGGCGGGAGCGCAGG + Exonic
1134486354 16:14661815-14661837 CGAGAGATGGGAAGGAGCGTGGG + Intronic
1134717969 16:16366319-16366341 CGTGAGCTGGGCCCAGGCGCAGG + Intergenic
1134956782 16:18385840-18385862 CGTGAGCTGGGCCCAGGCGCAGG - Intergenic
1136020687 16:27437964-27437986 GGAGAGCTGGCCCAGAGGGCAGG - Intronic
1136382130 16:29900608-29900630 CGAGAGCCAGGCAGGACCGCAGG + Intronic
1136414682 16:30096042-30096064 CGCGGGCTGGGCAGGGGCGCGGG + Exonic
1136554929 16:31001993-31002015 TGAGATCTGGGCAGGAGAGCAGG - Intronic
1144302177 17:13931901-13931923 CTAGAGCTGGGGCGTAGCTCAGG - Intergenic
1145265876 17:21379407-21379429 CCAGAGCTGGGCCTGGGAGCAGG - Intronic
1145748870 17:27341170-27341192 CGAGGGCTGGGCTGGGGCCCAGG + Intergenic
1146079173 17:29761514-29761536 CGAGATCTGGGGCGGGGCGCCGG - Intronic
1146831145 17:36070566-36070588 CGAGGGGTGGGCAGGAGCACTGG - Intronic
1147965195 17:44190927-44190949 CCAGAGCTGGGCCCAAGGGCCGG + Exonic
1148048807 17:44759360-44759382 TGACAGCCGGTCCGGAGCGCGGG + Intronic
1149914928 17:60600227-60600249 CGAGAGCTGGGCCGGAGCGCCGG - Exonic
1150061907 17:62075830-62075852 TGAGAGCTGGCCGGGCGCGCTGG + Intergenic
1150435444 17:65150656-65150678 CTAGAGCTGGGCAGGAGAGAAGG - Intronic
1150806615 17:68324453-68324475 CTGGAGCTGGGCCGGTCCGCAGG - Intronic
1151313915 17:73310834-73310856 GGAGAGCTGGGCGGGAGCCGGGG - Intronic
1151569904 17:74921016-74921038 ACAGAGCTGGCCCAGAGCGCTGG + Intronic
1151570568 17:74923529-74923551 CGAGAGCTGGGGAGGGGTGCCGG + Intergenic
1158954763 18:62526838-62526860 CGGGGGCGGGGCCGGCGCGCCGG - Intronic
1160266389 18:77343187-77343209 CCAGGGATGGGGCGGAGCGCAGG + Intergenic
1160768887 19:821716-821738 CGCGTGCTGGGCCGGGGCGCGGG - Intronic
1161258044 19:3320551-3320573 AGAGAGATGGGCCGGGGCGGTGG + Intergenic
1162901080 19:13795780-13795802 CGAGAGCTGGGCCTTCGAGCAGG + Exonic
1163496364 19:17648407-17648429 TGAGCGCAGGGCCTGAGCGCAGG - Intronic
1165058515 19:33194106-33194128 GGAGCACTGGGCTGGAGCGCGGG + Intronic
1168154093 19:54463630-54463652 CCAGAGCTAGGCCGGAGCGCGGG - Exonic
929452662 2:42047754-42047776 CGCGGGCTGGGCGGGACCGCGGG + Intergenic
929599901 2:43198491-43198513 GCAGAGCTGGGCCAGAGCCCTGG - Intergenic
929857568 2:45650109-45650131 GGAGGGCAGGGCCGGAGCGCTGG - Intergenic
930028707 2:47045328-47045350 CAAGAGCTGGGGTGGAGCCCTGG - Intronic
930700678 2:54456263-54456285 CGGGGGCTGGGCGGGAGCGCGGG - Exonic
937877563 2:126836973-126836995 CAGGAACTGGGCCGGAGGGCTGG - Intergenic
940666696 2:156618234-156618256 CGAGAGCTGCGCCGGTGGGCTGG + Intergenic
942461014 2:176169042-176169064 AGAGAGCTGGGCCGGCCCCCAGG - Exonic
945116299 2:206411056-206411078 GGGGAGGTGGGGCGGAGCGCGGG - Intergenic
945245321 2:207711939-207711961 CCCAAGCTGGGCCGGCGCGCGGG + Exonic
945710025 2:213284239-213284261 CGAGAGCTCGGGCGCAGCTCTGG - Intergenic
946328291 2:218996216-218996238 CGAAAGCTGGCGCGGAGGGCGGG + Intergenic
947591414 2:231388295-231388317 AGAGAGGTGGGCTGGAGAGCTGG - Intergenic
948159376 2:235811731-235811753 CCAGAGCTGGGCCGGGCCGGGGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172612910 20:36265065-36265087 CTAGGGCTGGGCCAGAGCGGGGG + Intronic
1173494261 20:43507621-43507643 AGAGCGCGGGGCCCGAGCGCCGG - Intergenic
1174292875 20:49521436-49521458 GGAGAGCTGGGCAGGAGCTGGGG - Intronic
1175820854 20:61908036-61908058 CCAGAGCTGGGCCGGGCTGCGGG + Intronic
1176115056 20:63428591-63428613 AGAGAGGTGGGCCTGAGCCCAGG - Intronic
1179657461 21:42854020-42854042 GGAGAGCTGCGCCTGAGCCCAGG - Intronic
1179972879 21:44845988-44846010 CGTGTCCTGGGCCGGAGCGCCGG + Intergenic
1180843673 22:18970524-18970546 CCGGGGCTGGGCCGGAGCGGCGG + Intergenic
1180875218 22:19171943-19171965 CGTGACCTGGGCCGGCCCGCAGG + Intergenic
1180877912 22:19183668-19183690 CAGCAGCTGGGCCGGAGGGCAGG + Intronic
1182547551 22:31084871-31084893 CGGGGGCCGGGCCGGCGCGCGGG - Intronic
1183407543 22:37637886-37637908 GGAGACCAGGGCAGGAGCGCGGG + Intronic
1183433273 22:37778822-37778844 CGGCAGCAGGGCCTGAGCGCCGG + Intergenic
1183693555 22:39405532-39405554 CGTGAGCGGCGCTGGAGCGCAGG - Intronic
1183830784 22:40417488-40417510 CGAGGGCTGGACAGGAGAGCAGG + Exonic
1184286543 22:43475001-43475023 CCAGAGCTGAGGCTGAGCGCAGG + Intronic
1184549465 22:45196829-45196851 CCAGAGCGGGGCCAGAGCGGCGG - Exonic
1185005721 22:48275709-48275731 CCAGAGCTGGGCTGGACCTCAGG + Intergenic
1185391314 22:50562869-50562891 CCAGAGCAGGACCGGAGCGCGGG - Exonic
950612864 3:14137346-14137368 CGTGAGCTGGGCCTCAGCCCTGG - Intronic
952233591 3:31456088-31456110 CAAGAGCTGGGCCTGATCCCTGG - Intergenic
954540989 3:51392779-51392801 CGAGAGCTTGGACGCAGCCCAGG + Exonic
955379406 3:58424821-58424843 CGAGAGCTGGGCAGGTGCCTCGG - Exonic
960996755 3:123345271-123345293 CAAGAACTGGGCCGAGGCGCAGG + Intronic
961472508 3:127124999-127125021 GGAGGGCTGGGCTGGAGCCCAGG - Intergenic
965474061 3:169132113-169132135 CAGGAGCTGGGCCTGAGGGCAGG - Intronic
968534378 4:1113894-1113916 CGGGAGCTGGGCCGGAGGCCAGG + Intergenic
968629832 4:1644587-1644609 CAGGAGCTGGGACGGAGCCCCGG - Intronic
969723883 4:8907889-8907911 CCAGACCTGGGCTGGAGGGCAGG + Intergenic
970133410 4:12895717-12895739 CGAGAGCTGGGCAGAAGACCTGG - Intergenic
982042289 4:151408661-151408683 GCAGAGCTGGGCCGGGGCGCCGG + Intergenic
984662259 4:182386735-182386757 CGAGAGCAGCGCCGGTGGGCTGG - Intronic
988564780 5:32312526-32312548 TGAGCGCAGGGCCCGAGCGCTGG - Intronic
991567554 5:68020578-68020600 CGAGAGCAGCGCCGGTGGGCTGG + Intergenic
991620331 5:68538837-68538859 CGAGAGCTGTGCTGGAGGGTAGG - Intergenic
992042367 5:72848539-72848561 CGGGGGCTGGGCCGCAGCGCGGG - Intronic
992088460 5:73298345-73298367 CGAGAGCTGGGACAAAACGCCGG + Intergenic
997668108 5:135648544-135648566 CTACAGCTGGGCTGGAGCGCAGG - Intergenic
1000071356 5:157743796-157743818 CGCGGGCTGGGCGGGCGCGCGGG - Exonic
1003770143 6:9290615-9290637 CGAGAGCAGCGCCGGCGGGCTGG + Intergenic
1003868679 6:10384860-10384882 CGCGCGCCGGGCCGGGGCGCGGG + Intergenic
1004224407 6:13772674-13772696 CGAGAGCAGCGCCGGTGGGCTGG - Intergenic
1004906920 6:20244946-20244968 CGAGAGCAGCGCCGGTGGGCTGG + Intergenic
1005959828 6:30686930-30686952 TGAGAGCGGGGACGGGGCGCAGG - Exonic
1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG + Exonic
1007532362 6:42554243-42554265 CGGGAGCTGGGGCTGCGCGCGGG + Intergenic
1010244906 6:73653849-73653871 CGAGACCTGGCCCGGAACGATGG - Exonic
1011633980 6:89353097-89353119 CGAGAGCTCGGAGGGGGCGCCGG + Intergenic
1014137548 6:117907209-117907231 GGAGAGCCGGGCGGGGGCGCCGG - Intergenic
1016069877 6:139726523-139726545 CGAGAGCAGTGCCGGTGGGCTGG + Intergenic
1019539258 7:1544408-1544430 AGAGAGCTTGGCGGGTGCGCTGG + Exonic
1019757960 7:2787426-2787448 CGGGAGGTGGGCCAGAGCGGTGG - Intronic
1020262229 7:6536889-6536911 CGAGAGCTGCGCCGGGGCTGGGG + Intronic
1020726342 7:11820098-11820120 CAAGAGCTGGGCCTGACCCCCGG + Intronic
1024098064 7:46000788-46000810 CGGGACCTGGGCTGGAGGGCAGG - Intergenic
1024301094 7:47888479-47888501 GGAGAGCTGGGCCAGAGCCCAGG - Intronic
1024472109 7:49775242-49775264 CTAGAGCTATGCCGGAGCCCGGG + Intronic
1026806926 7:73434557-73434579 GGAGACCTGGGCCCGGGCGCGGG + Exonic
1029228495 7:99046897-99046919 CGAGGGCTGGGCCTGAGTGTTGG - Intronic
1037337033 8:17801490-17801512 CGAGAGCGGGAGCGGAGAGCGGG - Intergenic
1037737280 8:21577881-21577903 CGGGAGCTGGGCTGGAGTGGGGG - Intergenic
1038480428 8:27897997-27898019 CCAGAGCTGGGCCCGTGCCCTGG - Intronic
1039834456 8:41245763-41245785 CGAGAGATGGAGCGGAGGGCTGG + Intergenic
1040936763 8:52789625-52789647 GGAGAGCTGGGCCAGATCACGGG - Intergenic
1042152180 8:65799716-65799738 AGAGAGCTGGGCTGGAGAGAGGG + Intronic
1049305325 8:141899800-141899822 CCAGAGCTGGGACGGGGCCCTGG - Intergenic
1049405331 8:142449758-142449780 CGAGCGCGGAGCCGGAGAGCCGG + Exonic
1049748183 8:144271802-144271824 CGGGAGCCGGGCCGGAGCTGAGG - Intronic
1053157652 9:35791861-35791883 CGAGGCCTGGGCCGGAGGGCAGG - Intergenic
1053180276 9:35962413-35962435 GGAGAGCTGGGCTGGGGCGGGGG - Intergenic
1056710923 9:88991395-88991417 CGAGGGGAGGGGCGGAGCGCGGG + Intronic
1058885412 9:109319248-109319270 TGAGAGCTGGGCCGGCGCTGCGG - Intronic
1060142438 9:121221792-121221814 TGAGAGCTGGGCCTCAGCTCTGG - Intronic
1061361340 9:130144258-130144280 CTAGAGCTGGGACAGAGCCCAGG - Intergenic
1061916774 9:133759661-133759683 CGAGGGCAGGGGCGGAGCGAGGG + Intergenic
1062351516 9:136141976-136141998 CCAGAGCTGGGCAGGAGCTGAGG - Intergenic
1062365232 9:136205179-136205201 CGGGAGGTGGGCGGGCGCGCGGG - Intergenic
1062583883 9:137240464-137240486 CGAGGGCCGGGGCGGAGGGCAGG - Intergenic
1185791250 X:2929279-2929301 CGAGCGCTGGCCCAGAGCGCAGG + Exonic
1186813030 X:13208659-13208681 TGAGAGCTGGGCCATAGCGGAGG + Intergenic
1187904023 X:24049876-24049898 CGAGAGCAGCGCCGGCGGGCTGG - Intergenic
1191878591 X:65822185-65822207 CCCAAGCTGGGCCGGCGCGCCGG - Intergenic
1195004313 X:100671237-100671259 GGAGAGCTGGGCAGGGGCCCGGG - Exonic
1195010869 X:100731580-100731602 CGAGAGCTGGCCCTGGGGGCGGG - Intronic
1197952054 X:131908228-131908250 CGAGGGTTGGGGCGGAGCCCGGG + Intergenic
1198750470 X:139932705-139932727 CGAGTGCGGGACCAGAGCGCGGG - Intronic