ID: 1149915169

View in Genome Browser
Species Human (GRCh38)
Location 17:60601353-60601375
Sequence TGACCCGGGATTGCTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149915160_1149915169 7 Left 1149915160 17:60601323-60601345 CCTCCTACCGGTGGTGTCAGTTC 0: 1
1: 0
2: 1
3: 0
4: 58
Right 1149915169 17:60601353-60601375 TGACCCGGGATTGCTGGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 163
1149915162_1149915169 0 Left 1149915162 17:60601330-60601352 CCGGTGGTGTCAGTTCTCCAGAT 0: 1
1: 0
2: 1
3: 19
4: 133
Right 1149915169 17:60601353-60601375 TGACCCGGGATTGCTGGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 163
1149915158_1149915169 18 Left 1149915158 17:60601312-60601334 CCTCTCGGTTGCCTCCTACCGGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1149915169 17:60601353-60601375 TGACCCGGGATTGCTGGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 163
1149915156_1149915169 19 Left 1149915156 17:60601311-60601333 CCCTCTCGGTTGCCTCCTACCGG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1149915169 17:60601353-60601375 TGACCCGGGATTGCTGGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 163
1149915161_1149915169 4 Left 1149915161 17:60601326-60601348 CCTACCGGTGGTGTCAGTTCTCC 0: 1
1: 0
2: 0
3: 8
4: 47
Right 1149915169 17:60601353-60601375 TGACCCGGGATTGCTGGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149915169 Original CRISPR TGACCCGGGATTGCTGGGGT TGG Intronic
900999326 1:6140447-6140469 TGACCCAGCAGTGCTGGGGTGGG - Intronic
902598823 1:17527188-17527210 TGATCAGGGAATGCAGGGGTGGG + Intergenic
906514904 1:46433111-46433133 TGAAGCGGGCTAGCTGGGGTCGG + Intergenic
907617462 1:55939033-55939055 AGCCCCGGGAGTGCTTGGGTTGG + Intergenic
909635384 1:77811811-77811833 GAACCCGGCCTTGCTGGGGTAGG - Intronic
910105048 1:83623222-83623244 TGACATGGGAATGCTGGGTTAGG - Intergenic
910105159 1:83624249-83624271 TGACATGGGAATGCTGGGTTAGG + Intergenic
915505449 1:156353058-156353080 TGTCCAGGGATGGGTGGGGTTGG + Intronic
916594262 1:166227783-166227805 TGTCGCAGGATTGCCGGGGTTGG - Intergenic
917706593 1:177640935-177640957 TGACCTGGGATGCCTGGGGCTGG + Intergenic
920437968 1:205960469-205960491 TGACCCTGGATTTCTGTGTTGGG + Intergenic
920550601 1:206857555-206857577 TGACCCGGGGATGCTGGGCGGGG - Intergenic
920702392 1:208227636-208227658 TAACCAGGCAGTGCTGGGGTAGG + Intronic
922124858 1:222712347-222712369 GAACCCGGCCTTGCTGGGGTAGG - Exonic
1063419025 10:5896351-5896373 AGGCCAGGAATTGCTGGGGTAGG + Intronic
1067454273 10:46405102-46405124 TTACCCTGGATTGTTTGGGTGGG - Intergenic
1067632930 10:47979530-47979552 TTACCCTGGATTGTTTGGGTGGG + Intergenic
1068272110 10:54741840-54741862 TTACCCTGGATTGTTGAGGTGGG - Intronic
1068729754 10:60343833-60343855 TGAACCAGGAATGCTCGGGTGGG - Intronic
1069751776 10:70749676-70749698 TGACTCGGGAGGGCTTGGGTGGG + Intronic
1073329137 10:102659558-102659580 TGTCCTGGGCTTCCTGGGGTGGG - Intergenic
1075521381 10:123145702-123145724 TGACTCGGGATGGCGGGGGCGGG - Intergenic
1076824691 10:132960984-132961006 TGACCAGGGAGGGCTGAGGTGGG - Intergenic
1078467734 11:11562594-11562616 TGCCATGGGGTTGCTGGGGTAGG - Intronic
1081926080 11:46830036-46830058 TTACCCTGGATTGTTTGGGTGGG + Intronic
1082725998 11:56737425-56737447 TGACCTGGGATTGCTGGTGCTGG + Intergenic
1084186381 11:67474448-67474470 TGACCAGATATTGCTGGGGTTGG + Intergenic
1087077812 11:94141977-94141999 CGACCTGGGGCTGCTGGGGTTGG + Intronic
1089534873 11:119154742-119154764 TGACCTGGCATGGGTGGGGTGGG + Intronic
1091228855 11:133974865-133974887 TGCCCCGGGATTCTGGGGGTGGG - Intergenic
1091391609 12:129525-129547 TCCCCCAGGACTGCTGGGGTGGG - Intronic
1091600088 12:1912755-1912777 TGACCCGGCAGTGCTGGGCATGG + Intronic
1095577734 12:43759087-43759109 TGCCCCAGGGTTGCTGGGGTCGG + Intronic
1096235428 12:49923005-49923027 TGACTCGGGAGGTCTGGGGTAGG + Intergenic
1096979170 12:55718607-55718629 TGACCCAGGGTTCCTGGGGAGGG + Intronic
1099864094 12:88256984-88257006 TGACCCAGCATTGCTGAGTTTGG - Intergenic
1100397152 12:94195260-94195282 TGACCCAGGAAGGGTGGGGTGGG - Intronic
1101860461 12:108478324-108478346 TCACCCTGGATTACTGAGGTGGG - Intergenic
1109138594 13:58683752-58683774 TGATCCGGGAGTGCTGGGAAGGG - Intergenic
1118930606 14:70236761-70236783 TGACCCTGGATAGCAGGGGGAGG - Intergenic
1118954259 14:70465493-70465515 TGACCCTGGATAGCAGGGGGAGG + Intergenic
1122862985 14:104590974-104590996 TGACCCGGGGTTCCTGAGGCTGG - Intronic
1127889394 15:63235235-63235257 TGACCAGGCATGGATGGGGTGGG + Intronic
1128256857 15:66203133-66203155 TGCTTTGGGATTGCTGGGGTGGG - Intronic
1129000178 15:72326504-72326526 TGAATCAGAATTGCTGGGGTGGG + Intronic
1132268931 15:100505759-100505781 GGACCCTGGGATGCTGGGGTGGG + Intronic
1135586860 16:23678439-23678461 TGACTCGGGAGGTCTGGGGTAGG + Intronic
1136464274 16:30431281-30431303 TGAACCAGGATTGCTGGATTGGG + Intergenic
1136991282 16:35152692-35152714 TGAGACGAGATTGCTGGGGGTGG + Intergenic
1139301040 16:65945589-65945611 TGTCCTGGGATTCCTGGGGCTGG - Intergenic
1139580963 16:67873345-67873367 TGAGCGGGGGTTGCGGGGGTGGG + Intronic
1141300776 16:82813628-82813650 AGACCCCAGATTGCTGGGGCTGG + Intronic
1141568897 16:84922382-84922404 TGACTCAGGAGTTCTGGGGTGGG + Intergenic
1141757670 16:86003121-86003143 AGACCCGTGATTGCCGGGGCTGG - Intergenic
1142433818 16:90044666-90044688 AGACCCAGGAAAGCTGGGGTGGG - Exonic
1143751347 17:9030338-9030360 GGTCCAGGGATTGCTGGGGGTGG - Intronic
1145269953 17:21399552-21399574 GGACCCAGGAGTGGTGGGGTAGG - Intronic
1146401656 17:32504495-32504517 TGACCCTGGGTGGCTGGGGTGGG + Intronic
1146703357 17:34980926-34980948 TGAACCGGGAGCGCTCGGGTGGG + Intronic
1147935385 17:44007755-44007777 CTACCAGGGATTGATGGGGTTGG - Exonic
1149337332 17:55649456-55649478 TTACCCTGGATTGCCTGGGTGGG - Intergenic
1149655836 17:58309170-58309192 TGAACCTGCATTGCTGGGGCTGG - Exonic
1149915169 17:60601353-60601375 TGACCCGGGATTGCTGGGGTTGG + Intronic
1152900438 17:82937979-82938001 GGTCCGGGGTTTGCTGGGGTTGG + Intronic
1158609324 18:58924283-58924305 TGACCTGTGCTTTCTGGGGTAGG + Intronic
1159955100 18:74513467-74513489 TGAGCCTGGCTTCCTGGGGTCGG + Intronic
1161364040 19:3868368-3868390 TGACCCCCGATTGCGGGGGGAGG - Intronic
1163538272 19:17890908-17890930 GGCCCCGGGATTGTTGTGGTGGG + Exonic
1163617000 19:18335334-18335356 TGATACGGGAGTGCTGGGATGGG + Intergenic
1163690403 19:18735515-18735537 TCCCCTGGGAGTGCTGGGGTGGG + Intronic
1166060005 19:40320305-40320327 TGACCCGGGAGTGCTGGATCGGG - Exonic
1166315303 19:41985986-41986008 TCACCAGGGCTTGCTGAGGTGGG + Exonic
1166855833 19:45782286-45782308 GGACCCGGGCTTCCTGGGGCTGG - Intronic
1167272199 19:48511816-48511838 GGAGCCGGGGTTGCTGGGGTGGG + Intronic
1168429809 19:56269530-56269552 TTATCCTGGATTACTGGGGTAGG + Intronic
926264989 2:11307973-11307995 GAACCCGGCCTTGCTGGGGTAGG + Intronic
927022568 2:19032601-19032623 TCAACCGGGTTTGCTGGGCTGGG + Intergenic
927714594 2:25343260-25343282 TGGGCAGGGATTGCTGGAGTTGG + Intergenic
929583195 2:43097435-43097457 GGACCCGGGAAGGTTGGGGTGGG + Intergenic
931096786 2:58949317-58949339 TTACCTGGGATTGCATGGGTGGG + Intergenic
931897929 2:66754025-66754047 TGACTAATGATTGCTGGGGTGGG - Intergenic
932435522 2:71700707-71700729 TGACCAGGAATGGCTGGGGAAGG + Intergenic
932572377 2:72944905-72944927 GGGCCCAGGACTGCTGGGGTTGG + Exonic
932609361 2:73187415-73187437 TGACCTGGGAGGTCTGGGGTAGG - Intergenic
933969124 2:87455990-87456012 TAACCCAGGGTTGCTGAGGTTGG + Intergenic
934947697 2:98553974-98553996 TGACCTGTGATTGCTAGGGGAGG - Intronic
936324666 2:111494518-111494540 TAACCCAGGGTTGCTGAGGTTGG - Intergenic
937364286 2:121249491-121249513 GCACCTGGGCTTGCTGGGGTTGG - Intronic
940517382 2:154698436-154698458 TGACCCGGGATGCCGGTGGTGGG + Exonic
947502807 2:230683673-230683695 TTACCCAGCATTGCTGGGGATGG - Intergenic
947815239 2:233032335-233032357 TGCCCCTGGATTGATGGGCTGGG + Intergenic
948053609 2:234995759-234995781 TGTCCCGCGGCTGCTGGGGTGGG - Intronic
948568503 2:238901644-238901666 TGACTCGGGGTGGCTGAGGTGGG + Intronic
1171372597 20:24671146-24671168 TGCCCCTGCATTGCTGGGGCAGG - Intergenic
1171457089 20:25278251-25278273 TGACCTGGGCTTCCTGGGGGAGG + Intronic
1172839056 20:37891074-37891096 TGACCCCAGATTGCTGGGCCTGG - Intergenic
1175400708 20:58698498-58698520 TGGCCCTGGGTTGCTGGGGGTGG + Intronic
1179543681 21:42100710-42100732 GGGCACGGGGTTGCTGGGGTGGG - Intronic
1179543723 21:42100812-42100834 GGGCACGGGGTTGCTGGGGTGGG - Intronic
1183685973 22:39361735-39361757 TGCCCCGAGACTCCTGGGGTAGG - Intronic
1184505797 22:44901272-44901294 TGACCTGGGAAGGCTGGGCTGGG + Intronic
951130955 3:19044425-19044447 TGACCCAGTAGTTCTGGGGTGGG + Intergenic
953375810 3:42427818-42427840 TGACTCAGTATTGCTGAGGTAGG + Intergenic
954286574 3:49623783-49623805 TGACCCTAGATTGCTGGGGATGG - Intronic
955803244 3:62707317-62707339 AGACCCGGGGTTGCAGGGGATGG - Intronic
956584812 3:70852974-70852996 TCACCTGGGCGTGCTGGGGTGGG - Intergenic
958917602 3:100066845-100066867 TGACCCAGGATTTCAGGAGTTGG - Intronic
960939030 3:122921826-122921848 GGACCCGGGAGACCTGGGGTCGG - Intronic
961818069 3:129561473-129561495 TGACCCAGTACTGCTGGGGCAGG - Intronic
962814296 3:138984635-138984657 TGATCCAGGATGCCTGGGGTAGG + Intergenic
964945656 3:162220634-162220656 TGACCCAGGACTACTTGGGTGGG - Intergenic
966616809 3:181921994-181922016 TGAGCCTGGATTGCTTGGTTGGG + Intergenic
968512666 4:1002487-1002509 TGAGCCGGGGCCGCTGGGGTGGG + Intronic
968515883 4:1015445-1015467 TGATCCAGGATGGCTGGGGCAGG + Intronic
971373118 4:26034145-26034167 TGTCCTGGGGATGCTGGGGTAGG + Intergenic
971510642 4:27418942-27418964 AAACCCGGGAATGCTGGGGTTGG - Intergenic
972270153 4:37502902-37502924 AGACCAAGGATTGCTGAGGTCGG + Intronic
975616433 4:76251881-76251903 AGACCCGCGCTTGCTGGGGCGGG + Intronic
979860162 4:125683180-125683202 TGATACGGGAGTGCTGGGATGGG - Intergenic
980446740 4:132920134-132920156 TGACCTGGGAATCCTAGGGTTGG - Intergenic
983484581 4:168318508-168318530 TGGCCCAGGAGTGCTGGGCTCGG - Intronic
987542340 5:19271575-19271597 TTACCCTGGATTGCTTGGGTGGG + Intergenic
988191104 5:27935951-27935973 AGACCCGGGATTGTAGGTGTAGG + Intergenic
990374735 5:55158147-55158169 TGACTCGGGAAGTCTGGGGTGGG + Intronic
990693801 5:58392654-58392676 TGCCCCGGGAAATCTGGGGTGGG - Intergenic
992152486 5:73918958-73918980 TGTCCCCGGATTGCTGGCCTGGG + Intronic
992240115 5:74759888-74759910 TGTCCTGGGATTGCTGAGGAAGG - Intronic
993865609 5:93191066-93191088 TGACCCTGGAAGGCTGGGGTAGG - Intergenic
997210348 5:132073469-132073491 TGGCCTGGAATGGCTGGGGTGGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998734808 5:145124891-145124913 TGACCCGTCATTCCTGGGGCTGG - Intergenic
998858391 5:146418502-146418524 AGATCAGTGATTGCTGGGGTTGG + Intergenic
1000924690 5:167179577-167179599 GGAGCCGGGGTTGCGGGGGTGGG - Intergenic
1002718449 5:181243647-181243669 GGACCCGAGATTGCAGGGCTGGG - Intronic
1006387181 6:33737775-33737797 TGAACCGGGGCTGCTCGGGTGGG + Intronic
1010022411 6:71175949-71175971 TGAGAAGGGAATGCTGGGGTGGG - Intergenic
1018706406 6:166466577-166466599 AGAACCAGGATTGCTGGGCTGGG - Intronic
1018770852 6:166970583-166970605 TGCCCCGGGTTTGCAGGGGTGGG + Intergenic
1019360426 7:601877-601899 TGACCCGGGGGGGCTGGGGAGGG + Intronic
1020128456 7:5546228-5546250 TGTCACAGGGTTGCTGGGGTTGG + Intronic
1020136598 7:5591610-5591632 TAAACTGGGATTGCTGGGGCTGG - Intergenic
1021423678 7:20474152-20474174 TTACTAGGGATTGCTGGAGTTGG - Intergenic
1022828206 7:34038179-34038201 TGACCCTGGATTCTTTGGGTGGG + Intronic
1023875357 7:44283651-44283673 TGACCGGGCAGTGCTGCGGTTGG - Intronic
1023905484 7:44518871-44518893 AGACCCCGAATTGCTGGGCTGGG - Intronic
1026857099 7:73762203-73762225 TGGCTTGGGGTTGCTGGGGTGGG + Intergenic
1026857135 7:73762350-73762372 TGGCCAGGGACTGCTGGGGGTGG + Intergenic
1027190848 7:75994702-75994724 TGTCCCGGATTGGCTGGGGTGGG - Intergenic
1028742430 7:94291138-94291160 TGAACCAGGATAGCTGTGGTGGG - Intergenic
1029190447 7:98768004-98768026 TGACATGAGATTGCTGGGTTAGG - Intergenic
1030339464 7:108360417-108360439 TGACCCGGGGTTGCAGGGTGGGG + Intronic
1033366953 7:140678967-140678989 AGATCTGGGATTGCTGGGGCAGG + Intronic
1035154119 7:156898310-156898332 TGAGCCGGCATAGCTGGGCTGGG - Intergenic
1035586861 8:782947-782969 TGACCCGGGAAAGCTGGATTAGG + Intergenic
1036784364 8:11676136-11676158 TGACCCAGCATTGCAGGGCTGGG - Intergenic
1043553169 8:81398387-81398409 TGACAGGGGATTCATGGGGTGGG + Intergenic
1044584705 8:93858878-93858900 TGACTCAGGAGGGCTGGGGTGGG + Intronic
1045491608 8:102674491-102674513 AGAACTGGGATTGGTGGGGTGGG - Intergenic
1048478564 8:134766524-134766546 TGCCCTGGCATTGCTGGGATTGG - Intergenic
1049328991 8:142039691-142039713 GGTCCCCGGATGGCTGGGGTTGG - Intergenic
1049785369 8:144448251-144448273 TGCCCCGGGACTGCGGAGGTGGG + Intergenic
1059114449 9:111588343-111588365 TTACCCGGGTTTGGTGTGGTGGG - Intronic
1061614776 9:131772656-131772678 TGACCGTGGACTGCTGGCGTGGG - Intergenic
1061941758 9:133887654-133887676 TGTCCCTGGGGTGCTGGGGTTGG - Intronic
1061988663 9:134145429-134145451 TGCCCTTGGATTGCTGGTGTGGG + Intronic
1062462657 9:136668376-136668398 TAGCCTGGGAGTGCTGGGGTGGG + Intronic
1203769387 EBV:41125-41147 TCACCCCGGGGTGCTGGGGTGGG - Intergenic
1203789665 EBV:144044-144066 TCACCCCGGGGTGCTGGGGTGGG - Intergenic
1203362308 Un_KI270442v1:228084-228106 TGAGGCGGGATGGGTGGGGTGGG - Intergenic
1189480404 X:41388247-41388269 AGTCCCGGGATTGTGGGGGTGGG + Intergenic
1200909182 Y:8515749-8515771 TCAGCCAGGATTGCTGAGGTGGG - Intergenic
1200958139 Y:8971746-8971768 TCAGCCAGGATTGCTGAGGTGGG - Intergenic
1202232471 Y:22670806-22670828 TCAGCCAGGATTGCTGAGGTGGG - Intergenic
1202310685 Y:23525352-23525374 TCAGCCAGGATTGCTGAGGTGGG + Intergenic
1202560117 Y:26145242-26145264 TCAGCCAGGATTGCTGAGGTGGG - Intergenic