ID: 1149921710 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:60666591-60666613 |
Sequence | CAGTATTAGTGGTTGCATTA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149921705_1149921710 | 23 | Left | 1149921705 | 17:60666545-60666567 | CCCAAAGTGCTAGGCAAATTTTA | No data | ||
Right | 1149921710 | 17:60666591-60666613 | CAGTATTAGTGGTTGCATTAGGG | No data | ||||
1149921706_1149921710 | 22 | Left | 1149921706 | 17:60666546-60666568 | CCAAAGTGCTAGGCAAATTTTAA | No data | ||
Right | 1149921710 | 17:60666591-60666613 | CAGTATTAGTGGTTGCATTAGGG | No data | ||||
1149921704_1149921710 | 26 | Left | 1149921704 | 17:60666542-60666564 | CCTCCCAAAGTGCTAGGCAAATT | No data | ||
Right | 1149921710 | 17:60666591-60666613 | CAGTATTAGTGGTTGCATTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149921710 | Original CRISPR | CAGTATTAGTGGTTGCATTA GGG | Intergenic | ||
No off target data available for this crispr |