ID: 1149921710

View in Genome Browser
Species Human (GRCh38)
Location 17:60666591-60666613
Sequence CAGTATTAGTGGTTGCATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149921705_1149921710 23 Left 1149921705 17:60666545-60666567 CCCAAAGTGCTAGGCAAATTTTA No data
Right 1149921710 17:60666591-60666613 CAGTATTAGTGGTTGCATTAGGG No data
1149921706_1149921710 22 Left 1149921706 17:60666546-60666568 CCAAAGTGCTAGGCAAATTTTAA No data
Right 1149921710 17:60666591-60666613 CAGTATTAGTGGTTGCATTAGGG No data
1149921704_1149921710 26 Left 1149921704 17:60666542-60666564 CCTCCCAAAGTGCTAGGCAAATT No data
Right 1149921710 17:60666591-60666613 CAGTATTAGTGGTTGCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149921710 Original CRISPR CAGTATTAGTGGTTGCATTA GGG Intergenic
No off target data available for this crispr