ID: 1149923783

View in Genome Browser
Species Human (GRCh38)
Location 17:60682329-60682351
Sequence CTGAATCAGAATAAGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 434}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149923783 Original CRISPR CTGAATCAGAATAAGGAGAG TGG Intronic
900780478 1:4614575-4614597 CTGAATCTGAATGAAGAGCGAGG - Intergenic
902593689 1:17493591-17493613 CTGGATCAGAGTGAGCAGAGGGG - Intergenic
902950216 1:19876634-19876656 ATGGATCAGAGTAAGGAGAGAGG - Intergenic
905036931 1:34924767-34924789 CTGAAACAGCAAAAGGGGAGAGG + Intronic
905081554 1:35326574-35326596 CTGAATTGGAATAAGGGGATTGG - Intronic
905313836 1:37068559-37068581 CTGAATCTGAATAGGGAATGTGG - Intergenic
905828848 1:41048134-41048156 CTGAAACAGAATCAGGACACAGG + Intronic
905950353 1:41945654-41945676 CAGAATCAGAACATGGAGATTGG + Intronic
906455329 1:45991324-45991346 CTGAAGAAGAATAAGGTTAGAGG - Intronic
906507334 1:46389961-46389983 CAGAATCAGAACATGGAGATTGG - Intergenic
907405243 1:54250049-54250071 CTGTATCTGACTCAGGAGAGGGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907602565 1:55785624-55785646 CAGAATCAGAACATGGAGATTGG - Intergenic
907771303 1:57467175-57467197 CTGAATCAGAATCTCTAGAGTGG + Intronic
908111107 1:60898397-60898419 CTTAAGAAGAATAAGGACAGTGG + Intronic
908428623 1:64033944-64033966 CTGAATCACAGTAAAGAGATGGG - Intronic
909791069 1:79679397-79679419 CTGAATCACAAGAAGAAGAATGG - Intergenic
910356542 1:86363074-86363096 TTGAATCAGGATAATGACAGTGG + Intronic
910500704 1:87886987-87887009 CTGAATAAGAGGAGGGAGAGAGG - Intergenic
910590998 1:88928014-88928036 CAGAATCAGAACATGGAGATTGG + Intergenic
911603262 1:99869989-99870011 CAGAATCAGAATCAGGAGTTTGG - Intronic
912171715 1:107108404-107108426 CTGAAACCGAGTAAGGATAGTGG - Intergenic
912357838 1:109070104-109070126 CTGAAACAGAAAAAGGACATTGG - Intronic
912555552 1:110513645-110513667 CTGACAGAGAAAAAGGAGAGAGG - Intergenic
913177564 1:116288851-116288873 TTGAATCAGAATCTCGAGAGTGG + Intergenic
914060590 1:144205352-144205374 CAGAATGGGAATTAGGAGAGAGG + Intergenic
914118560 1:144761017-144761039 CAGAATGGGAATTAGGAGAGAGG - Intergenic
915927858 1:160037932-160037954 CTGAATGAAAATGAGGAGTGGGG - Exonic
916452877 1:164937999-164938021 AAGAATGAGAATATGGAGAGTGG - Intergenic
918579143 1:186104702-186104724 CTGAATCAGACTAAGGATTGAGG - Intronic
918749021 1:188247203-188247225 CTGAAACAGAAAAAGGACATTGG - Intergenic
920277745 1:204820292-204820314 CTGAGTCTGAATAAGAAAAGGGG + Intergenic
920425246 1:205869838-205869860 CAGAATCAGAACATGGAGATTGG - Intergenic
920492152 1:206424783-206424805 CAGAAACATTATAAGGAGAGAGG + Intronic
921662245 1:217817956-217817978 CTGAATGAGAATAATGACTGGGG - Intronic
922043366 1:221919007-221919029 CTGAAGCAAAATTAGGAGAGTGG - Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922684724 1:227630313-227630335 CAGAATCAGAACATGGAGATTGG - Intronic
923357520 1:233175013-233175035 ATGAATCAGAATATGGGCAGAGG + Intronic
923456727 1:234171165-234171187 CTGAATCAGAAGCTGGAGTGGGG + Intronic
923766533 1:236897191-236897213 GTGAATGAGAATAAAGTGAGGGG + Intronic
924055172 1:240118003-240118025 CTGAATGAGATGAAGGAGTGAGG + Intronic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1063185844 10:3650582-3650604 TCGAATTAGAATAAGGACAGTGG - Intergenic
1063859601 10:10293297-10293319 GTGAATCAGAATAAAGATTGGGG + Intergenic
1064486482 10:15797689-15797711 ATGTATCAGAAAAAGGAAAGAGG - Intronic
1064575788 10:16745098-16745120 CTGAAACAGTCTAAGCAGAGAGG - Intronic
1065199647 10:23300743-23300765 CAGAATCAGAACATGGAGATTGG - Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065949173 10:30636318-30636340 CAGAATCAGAATTAGGGGTGTGG + Intergenic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1067540602 10:47149372-47149394 CTGAAACAGAAAAAGGACACTGG + Intergenic
1068386146 10:56330318-56330340 CTGCACCAGAATATGGGGAGCGG + Intergenic
1068625845 10:59245595-59245617 CTGAGTAAGAATAAGAAAAGTGG - Exonic
1070005756 10:72422481-72422503 CAGAAGCAGAGAAAGGAGAGAGG - Intronic
1072378111 10:94838195-94838217 CAGAATCAGAACATGGAGATTGG - Intronic
1072471959 10:95721281-95721303 CAGAATCAGAACATGGAGATTGG - Intronic
1073534685 10:104266293-104266315 CTGAATGAGAACAAGCAGACAGG + Intronic
1073744348 10:106448533-106448555 CTTAACTAGAATAAGCAGAGTGG - Intergenic
1073750396 10:106519758-106519780 CTGATTCAGAATTTGGACAGGGG + Intergenic
1076175097 10:128362334-128362356 CTGACTCTGAACAAGGAGAGAGG + Intergenic
1076431479 10:130406764-130406786 CTGATTCAAAAGAAGGAAAGAGG + Intergenic
1077451205 11:2647023-2647045 CTGAATAAGAATAGTGAAAGTGG + Intronic
1077759260 11:5073399-5073421 GTGAATCAGGATATGGAGAAAGG - Intergenic
1078279506 11:9885968-9885990 CTGTCTCAGAATTAGAAGAGAGG + Intronic
1079601355 11:22316003-22316025 CAGAATCAGAACATGGAGATTGG - Intergenic
1080072298 11:28104359-28104381 CTGAAGCAGAATAATGAAATGGG - Intronic
1080552534 11:33386116-33386138 CTGAATAGAAATAGGGAGAGTGG + Intergenic
1080849838 11:36058640-36058662 ATGGATTAGAATAGGGAGAGTGG - Intronic
1081070536 11:38604586-38604608 CAGAATCAGAACATGGAGATTGG + Intergenic
1081531346 11:43961737-43961759 CTGCATCAGAAAGAGGAGAGAGG - Intergenic
1081634829 11:44714152-44714174 CTGGAGCAGAATAAGCAGATGGG + Intergenic
1081657493 11:44867182-44867204 CTGAATCAGAAACTTGAGAGTGG + Intronic
1081819958 11:45983144-45983166 CAGAACCAGAATCAGGAGCGTGG + Intronic
1085462390 11:76701990-76702012 CTGGATCAGAACGAGGAGAAGGG + Intergenic
1085490607 11:76913407-76913429 TTGAATCGGAATAGTGAGAGAGG + Intronic
1086003328 11:82005483-82005505 CTGAATCAGCAAAAAGAAAGAGG - Intergenic
1087157370 11:94918675-94918697 CTGAATCAAAATGAGGACTGTGG - Intergenic
1088069774 11:105767909-105767931 CTGATTCAGATTAAAGCGAGAGG - Intronic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1089277978 11:117352365-117352387 CTGACTCTGAATAAAGAGAAAGG - Intronic
1089414542 11:118276351-118276373 CTGAATCAGAACAGGAAGAGGGG + Intergenic
1091131940 11:133153712-133153734 TTTAAACAGAATAAGGAGATGGG - Intronic
1091765456 12:3117390-3117412 CAGAAACAGAACAAGGGGAGGGG + Intronic
1092294041 12:7184039-7184061 CAGAATCAGAACATGGAGATTGG + Intergenic
1092469490 12:8765301-8765323 CAGAATCAGAACATGGAGATTGG - Intronic
1092553700 12:9531937-9531959 AGGAATCAGAATAAGGATACTGG - Intergenic
1092899212 12:13043122-13043144 CTTAAACAAAACAAGGAGAGTGG + Intergenic
1093677011 12:21954322-21954344 TTGAATAGGAATAATGAGAGTGG + Intergenic
1093917250 12:24818521-24818543 CTGAATCAGAATCTGGGGATGGG + Intronic
1094518399 12:31158686-31158708 AGGAATCAGAATAAGGATACTGG + Intergenic
1095138935 12:38639323-38639345 CAGAATCAGAACATGGAGATTGG + Intergenic
1095191099 12:39258926-39258948 CTGAATTAGAACAAGGAGTCTGG + Intergenic
1095283889 12:40387103-40387125 CAGAATCAGAACATGGAGATTGG + Intergenic
1095899999 12:47318294-47318316 CTGAATCTGAATGAGAAGATAGG - Intergenic
1096352108 12:50909103-50909125 CAGAATCAGAACATGGAGATTGG - Intergenic
1096476145 12:51910431-51910453 CTGAATCAGAGTCTGGAGTGAGG + Intronic
1096494818 12:52033848-52033870 CTGGCCCTGAATAAGGAGAGGGG - Intronic
1097149698 12:56967577-56967599 CAGAATCAGAACATGGAGATTGG - Intergenic
1097377302 12:58856170-58856192 CAGAATCAGAACATGGAGATTGG - Intergenic
1097390104 12:59000506-59000528 CTGAATAGGAATAGTGAGAGTGG - Intergenic
1099569288 12:84295240-84295262 CTGAGTCAAAATAGGAAGAGTGG - Intergenic
1099572727 12:84345323-84345345 TTGAATCAGAGTGATGAGAGTGG + Intergenic
1101484037 12:105132909-105132931 CTGAACCAGAATAGGAACAGTGG - Intronic
1102776007 12:115519676-115519698 ATAACTTAGAATAAGGAGAGAGG - Intergenic
1103189518 12:118989205-118989227 CTGCATCAGAGTCAGGAAAGAGG - Intronic
1103803012 12:123551710-123551732 CAGAATCAGAACATGGAGATTGG + Intergenic
1104267703 12:127251929-127251951 CTGAAGGACAATAAGCAGAGAGG - Intergenic
1104756258 12:131271088-131271110 CTGAAGCAAAATAAACAGAGGGG - Intergenic
1104777520 12:131399937-131399959 CTGAAGCAAAATAAACAGAGGGG + Intergenic
1105690383 13:22831608-22831630 CTGAATGAGGATAAGGAGTTTGG - Intergenic
1105855897 13:24371544-24371566 CTGGAGCAGAGTAAGGAGAATGG - Intergenic
1106406351 13:29478147-29478169 CTGAAGGAGACTAAGGAGACAGG + Intronic
1106649660 13:31676651-31676673 CTGAATCAGGATCAGGTGAAAGG - Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1107852615 13:44586469-44586491 CTGGATAAAAATAAGTAGAGGGG + Intergenic
1107922518 13:45224282-45224304 CTAAATCAGAAGGAAGAGAGAGG - Intronic
1108876643 13:55057196-55057218 CAGAATCAGAACATGGAGATTGG + Intergenic
1109606762 13:64706759-64706781 CAGAATCAGAATATGGAGATTGG - Intergenic
1109922719 13:69090126-69090148 ATGAGACAGAATATGGAGAGTGG + Intergenic
1109931715 13:69225045-69225067 CAGAATCAGAACATGGAGATTGG + Intergenic
1111138509 13:84084252-84084274 ATGAATCAGAATTAGGAGACAGG + Intergenic
1111578695 13:90194004-90194026 CTGAATAAGAAAAAGAATAGCGG - Intergenic
1111808748 13:93070923-93070945 CTGAATAGGAATGATGAGAGAGG + Intergenic
1112333479 13:98495137-98495159 CTGCTTCAAAATAAGGAAAGTGG - Intronic
1112493485 13:99887242-99887264 CTGAATCAGAACAATGGGCGGGG - Intronic
1112634154 13:101196607-101196629 CTGTTTCAGTATGAGGAGAGGGG + Intronic
1115088097 14:29541475-29541497 ATGAATAAGAATAATGATAGTGG + Intergenic
1119921547 14:78451004-78451026 TTGCATCAGAATAAGGAATGAGG + Intronic
1120741877 14:88117732-88117754 CTGAAACAGAATGGGGGGAGAGG + Intergenic
1123574324 15:21651728-21651750 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1123610939 15:22094315-22094337 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1124432999 15:29623134-29623156 CTGAAACACAATAAAAAGAGTGG + Intergenic
1125064896 15:35470466-35470488 CTGAAACAGGATAAGAAAAGGGG + Intronic
1125156400 15:36591685-36591707 CTGAATCTGAATAATAAGAGAGG - Intronic
1126926168 15:53589048-53589070 CTGTAACTGAATAAGGAGTGAGG + Intronic
1127074332 15:55311017-55311039 CAGAATCAGGATATGGAGATTGG - Intronic
1128229734 15:66026060-66026082 CTGAATCACAATCTGGAGCGGGG - Intronic
1128617010 15:69118103-69118125 CTGAATCAGAATCTGGAGGAGGG + Intergenic
1129088191 15:73119597-73119619 CTGCAGGAGAAAAAGGAGAGTGG - Intronic
1129239113 15:74241215-74241237 CTCAGTCAGAGGAAGGAGAGGGG + Intronic
1132171454 15:99660946-99660968 CTGAAGAAGAACAAGGTGAGAGG + Intronic
1202983188 15_KI270727v1_random:386071-386093 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1132513782 16:356736-356758 CTGCATCAGTGTAAGGGGAGCGG + Intergenic
1133404779 16:5514762-5514784 GGGAATCAGAAGAGGGAGAGAGG + Intergenic
1135224701 16:20645743-20645765 CAGAATCAGAACATGGAGATTGG + Intronic
1135501708 16:23001422-23001444 CTGAATCAGAATCTCAAGAGTGG - Intergenic
1138353405 16:56358803-56358825 TTAAATCGGAACAAGGAGAGTGG + Intergenic
1138756561 16:59493511-59493533 CTGAAGCAGAAGAGGAAGAGAGG - Intergenic
1139712973 16:68790557-68790579 CTCAAAAAGAATAAGGAGAATGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141412126 16:83842557-83842579 CTGAAACAAAGTAAGGAGGGTGG - Intergenic
1141854995 16:86674703-86674725 CTGCAACAGAATAAGCAAAGGGG - Intergenic
1141856926 16:86688549-86688571 CTGAATAAGAGTAGGGAGAGTGG - Intergenic
1143308096 17:5964684-5964706 TTGAATAAGAATAAGGTTAGGGG - Intronic
1146982925 17:37183100-37183122 CTGAATCAAAATAAGAAAATGGG + Intronic
1147269577 17:39258950-39258972 CTGAAAGAGAATAAGGGGAAAGG + Intergenic
1148022867 17:44565200-44565222 CTGAATCAGGAGATAGAGAGAGG + Intergenic
1148953300 17:51333416-51333438 CTGTATCAGACTATGGAGGGAGG - Intergenic
1149199505 17:54166311-54166333 CTTGATCAGAATATGGAGAAAGG + Intergenic
1149274126 17:55015279-55015301 CAGAATCAGAACATGGAGATTGG - Intronic
1149355353 17:55834020-55834042 GTGAATTAGAATAATGAAAGAGG + Intronic
1149923783 17:60682329-60682351 CTGAATCAGAATAAGGAGAGTGG + Intronic
1150038488 17:61831228-61831250 CTGAATTAGAGTGATGAGAGTGG - Intronic
1150329249 17:64281970-64281992 CAGAAGCAGAATAAGGGCAGGGG - Intergenic
1150335761 17:64329580-64329602 CTGAAACAGACTAGGGAGCGGGG + Intronic
1150678255 17:67263413-67263435 CTGTAGCTGAATAGGGAGAGAGG - Intergenic
1151409877 17:73915546-73915568 CTGAAAAAGAAAAAGGAAAGGGG + Intergenic
1151525442 17:74663115-74663137 CTGGATCAGAATTAGGAAATTGG + Intergenic
1151891673 17:76954586-76954608 ATGAAAGAGAAAAAGGAGAGGGG + Intergenic
1153401506 18:4688157-4688179 CAGAATCAGAACATGGAGATTGG + Intergenic
1156413693 18:36864046-36864068 GTGAGTAAGAATAATGAGAGAGG + Intronic
1156890353 18:42183923-42183945 CTGACTCAGCATAATGGGAGGGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157941320 18:51931900-51931922 CTGAATCTGAATATTGAGAACGG + Intergenic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158716286 18:59882484-59882506 CTGAGTTGAAATAAGGAGAGGGG + Intergenic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1167140186 19:47645076-47645098 CAGAGCCAGAATACGGAGAGTGG - Intronic
1167241659 19:48347300-48347322 CTGAATTAGTGGAAGGAGAGAGG + Intronic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
1168384940 19:55955274-55955296 CTGAAACAGCAAATGGAGAGAGG + Exonic
926798388 2:16637803-16637825 CTGCATCAGTAAAATGAGAGTGG - Intronic
927100906 2:19787130-19787152 CCGAATCACAAGCAGGAGAGAGG + Intergenic
928441986 2:31299928-31299950 CTTAATTAGAATAACGAAAGTGG + Intergenic
928476414 2:31631856-31631878 CAGAATCAGAACAAGGAGATTGG + Intergenic
928677013 2:33660283-33660305 CAGAATCAGAACATGGAGATTGG + Intergenic
929046249 2:37793418-37793440 ATGCCTCATAATAAGGAGAGGGG + Intergenic
929286463 2:40140548-40140570 CTGAATCAGAAATTGGGGAGGGG + Intronic
929903654 2:46027398-46027420 CTGAATGAGGATGGGGAGAGAGG + Intronic
930023620 2:47016312-47016334 GTGAATCAGCATCAGGAGACTGG + Intronic
930723701 2:54662715-54662737 CTGAGTCAAAATAATGTGAGTGG - Intronic
931164536 2:59732860-59732882 CTGGAAGAGAATAAGGAGACAGG - Intergenic
931590532 2:63878245-63878267 TTGAAGCAGAATTATGAGAGTGG + Intronic
932330169 2:70894273-70894295 CTGGGCCAGAATAGGGAGAGAGG - Intergenic
932512561 2:72309045-72309067 CTCAAGCAGAATTATGAGAGAGG + Intronic
932696821 2:73964136-73964158 TTGCTTCAGAATAATGAGAGTGG - Intergenic
932701072 2:73991990-73992012 CTGAAGCAGAGTCAGGAGTGTGG + Intronic
932717626 2:74113399-74113421 TTGAATAAGAGTAATGAGAGTGG - Intergenic
932917633 2:75875184-75875206 CAGAATCAGAACATGGAGATTGG + Intergenic
933175296 2:79167028-79167050 CAGAATCAGAACATGGAGAATGG - Intergenic
933214222 2:79608860-79608882 CTGAATAAAATCAAGGAGAGTGG - Intronic
933871356 2:86568436-86568458 CAGTATCAGAATTAGAAGAGTGG + Intronic
934672103 2:96220816-96220838 CAGAATCAGAATATGGAGATTGG - Intergenic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
935974784 2:108567398-108567420 CTGAACTAGAATAAGCAGGGTGG + Intronic
936387341 2:112042010-112042032 CAGAATCAGAACATGGAGATTGG - Intergenic
937454307 2:122028017-122028039 CTGCATCAGAATCAGCTGAGGGG + Intergenic
937853716 2:126657630-126657652 CTGAATTGGAATAATGACAGTGG - Intronic
938389027 2:130890075-130890097 CTCAAGCTGAATAAGGAAAGTGG - Intronic
939192098 2:138929133-138929155 ATGTCTCAGAGTAAGGAGAGGGG - Intergenic
939249638 2:139667336-139667358 CTGATTCAGCAGAGGGAGAGAGG - Intergenic
939387547 2:141520193-141520215 CTAAATAAGAATAAGGCAAGTGG + Intronic
942224796 2:173805586-173805608 CAGAATCAGAATCAGCAGGGTGG - Intergenic
942580457 2:177411439-177411461 CAGAATCAGAACATGGAGATTGG - Intronic
942830766 2:180235777-180235799 CAGAATCAGAACATGGAGATTGG + Intergenic
943550081 2:189327502-189327524 CTGAAGAAGAATTAGAAGAGGGG + Intergenic
945181425 2:207095479-207095501 CTACTTCAGAATACGGAGAGAGG + Intronic
945396067 2:209319997-209320019 TTTAATCAGAATGAGAAGAGAGG + Intergenic
946743201 2:222820157-222820179 ATGAAGAAGAATAAGGACAGAGG - Intergenic
946896473 2:224329153-224329175 CTGAATTAGAATAAGTGTAGGGG + Intergenic
947094662 2:226552125-226552147 CTGAATTAGAACAAGGAAACAGG + Intergenic
948046347 2:234948289-234948311 CTGACTCAGAATGCAGAGAGAGG - Intergenic
948090395 2:235288740-235288762 CTGAGACAGAATTAGGAGATTGG - Intergenic
948206507 2:236165252-236165274 GTGAATAATAAAAAGGAGAGAGG - Exonic
948337992 2:237226115-237226137 CTGAAACAGAAAAAGGACATTGG - Intergenic
1168839018 20:897131-897153 CTGAGTCTGAAAAAGGAGATGGG - Intronic
1169649583 20:7852106-7852128 ATGAATCAGAAAAAGAAAAGAGG + Intergenic
1169814018 20:9638059-9638081 CTGAATCAGAATACCTAGGGTGG + Intronic
1169975099 20:11316419-11316441 CTGAATCAGCATCACCAGAGTGG - Intergenic
1171769983 20:29314834-29314856 GGGAAGTAGAATAAGGAGAGGGG + Intergenic
1171877194 20:30587607-30587629 CTGAAAAAAAATAAAGAGAGTGG - Intergenic
1172324462 20:34023765-34023787 CTGATTGGGAATAAGGAGACTGG - Intronic
1172324509 20:34024046-34024068 CTGATTGGGAATAAGGAGACTGG + Intronic
1172633951 20:36396844-36396866 ATGATTCAGAAGAGGGAGAGTGG + Intronic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173504961 20:43579607-43579629 CTGAAGCAGAGTGAGGGGAGGGG + Intronic
1175463018 20:59168628-59168650 CTGAATGAGAGTGATGAGAGTGG + Intergenic
1177040679 21:16106447-16106469 CAGAATCAGATTGAAGAGAGTGG + Intergenic
1179072428 21:38084251-38084273 CTGGATCAGAAAAAGGACCGTGG - Intronic
1179259164 21:39743144-39743166 CAGAATCAGAACATGGAGATTGG - Intergenic
1179311082 21:40196666-40196688 ATGAAACAGAAGAAAGAGAGGGG - Intronic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182041181 22:27240014-27240036 CTTAATCAGAAGAAGGTGAGAGG - Intergenic
1184452163 22:44589714-44589736 CCTAATCAGAAGGAGGAGAGAGG + Intergenic
1184782915 22:46658086-46658108 CTGACTCAGAAACAGCAGAGGGG - Intronic
949476429 3:4450606-4450628 CTTAAGCACAATAAGGATAGGGG - Intronic
951040838 3:17987511-17987533 TGGAATCAGAAAGAGGAGAGAGG - Intronic
951200717 3:19873296-19873318 CAGAATCAGAACATGGAGATTGG - Intergenic
952271085 3:31832040-31832062 CTGTAAGAGAATAATGAGAGAGG + Intronic
952472092 3:33666003-33666025 CTGACTTAGGATAAGGATAGAGG + Intronic
952735445 3:36686731-36686753 TTGAAACAGAATGATGAGAGGGG - Intergenic
953468202 3:43143341-43143363 CTGAAGAAGACTAAGGAGTGGGG + Intergenic
954096465 3:48332565-48332587 CAGAATCAGAATGTGGAGATTGG - Intergenic
955781912 3:62493775-62493797 CTGATTCAGATTAATGGGAGAGG + Intronic
955783539 3:62511630-62511652 ATGAATTAGAATAAGCAAAGGGG - Intronic
957000311 3:74876704-74876726 CAGAATCAGAACATGGAGACTGG - Intergenic
957183511 3:76912107-76912129 CTGAATCAGCATAAGAAAATGGG - Intronic
957639123 3:82827614-82827636 ATGAAGCAGAAGAAAGAGAGGGG - Intergenic
957915125 3:86678712-86678734 TTGAATCAGAATGGTGAGAGTGG + Intergenic
958016294 3:87943103-87943125 CAGAATCAGAACATGGAGATTGG - Intergenic
958629834 3:96671147-96671169 CAGAATCAGAACATGGAGATAGG - Intergenic
959654582 3:108787580-108787602 CTGAATGAGATTAATGAAAGTGG - Intergenic
960671228 3:120157032-120157054 ATAAATCAGCATAAGGAGATGGG - Intergenic
962501496 3:135998301-135998323 CTGAATCAGACTGAGGAGTCAGG - Intronic
963187915 3:142439377-142439399 CAGAATCAGAACATGGAGATTGG + Intronic
964165774 3:153703765-153703787 CTCCATCAGATTAAGCAGAGTGG - Intergenic
964460228 3:156916793-156916815 TTGAATAAGAGTAATGAGAGAGG + Intronic
965054827 3:163698800-163698822 CAGAATCAGAACATGGAGATTGG - Intergenic
965525342 3:169710717-169710739 CTGAATAGGAGTAATGAGAGTGG + Intergenic
965825124 3:172722319-172722341 CAGAATCAGAACACGGAGATTGG + Intergenic
966030313 3:175338419-175338441 TTGCATGAGAATAAGGAGATAGG + Intronic
966230762 3:177648980-177649002 CTGGATTAGGAAAAGGAGAGGGG + Intergenic
966353466 3:179055946-179055968 CAGAATCAGAACATGGAGATTGG + Intronic
966815061 3:183883788-183883810 CCAAATCACAATCAGGAGAGGGG - Intronic
967017308 3:185493962-185493984 CTGAATCAGAATCTTGGGAGTGG - Intronic
967623531 3:191661709-191661731 CAGAATCAGAACATGGAGATTGG + Intergenic
968391209 4:194416-194438 CAGAATCAGAACATGGAGATTGG - Intergenic
970459045 4:16254629-16254651 CTAAATCAGAATAATGAAAATGG - Intergenic
972781378 4:42289656-42289678 CAGAATCAGAACATGGAGATTGG - Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
974520435 4:62975129-62975151 CAGAATCAGAACATGGAGATTGG + Intergenic
975313849 4:72930413-72930435 CAGAATCAGAACATGGAGATTGG - Intergenic
976189810 4:82477136-82477158 CAGAATCAGAACATGGAGATTGG + Intergenic
976382750 4:84418873-84418895 CTGAACCAGATTAATGAGCGAGG - Intergenic
976464745 4:85354489-85354511 CAGAATCAGAACATGGAGATTGG - Intergenic
977182402 4:93893067-93893089 GTAAATCAGAATGAGGAGAAAGG + Intergenic
977336110 4:95701588-95701610 CTGAAGCAGAATAAGAAAGGAGG - Intergenic
977340889 4:95755921-95755943 ATTAATCAGAGCAAGGAGAGTGG - Intergenic
978086227 4:104658583-104658605 CTAAATTAGAAAGAGGAGAGAGG + Intergenic
978586835 4:110283074-110283096 CAGAATCAGAACATGGAGATTGG - Intergenic
978716516 4:111849995-111850017 GTGGATCAGAAATAGGAGAGTGG + Intergenic
979573510 4:122258087-122258109 CTGTGTCAGAATAAAGATAGTGG + Intronic
979944502 4:126811949-126811971 TTAAATTAGAATAAGAAGAGTGG + Intergenic
979993667 4:127405576-127405598 ATGAAGCAAAAAAAGGAGAGAGG - Intergenic
981507635 4:145520381-145520403 CTGAATCAGACTCTGGAGATGGG + Intronic
981849911 4:149218233-149218255 CAGACTCAGATTAAGGAAAGGGG - Intergenic
983321048 4:166197537-166197559 CATAATCAGAAAAAGGAGAGAGG - Intergenic
983351150 4:166590271-166590293 CAGAATCAGAATTATAAGAGTGG + Intergenic
983588319 4:169380145-169380167 CTCAATAAGAGTGAGGAGAGTGG - Intergenic
983667048 4:170194085-170194107 CAGAATCAGAACAAGGAGATTGG - Intergenic
984417722 4:179482456-179482478 CTGAACCAGAATAGGGTCAGAGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986299664 5:6467988-6468010 CTGGATGAGAGCAAGGAGAGAGG - Intronic
986392666 5:7300591-7300613 CTGAAGCAGAAGAAGCAGATGGG - Intergenic
986898273 5:12397788-12397810 CTGAATAAGAGTGATGAGAGTGG - Intergenic
987605258 5:20126126-20126148 ATGGAACAGAATAAGGAGCGCGG + Intronic
988012616 5:25509521-25509543 ATGAATTAGAAAAAGAAGAGAGG + Intergenic
989271514 5:39539049-39539071 CTGAAACAGAGTGAGAAGAGAGG + Intergenic
989305039 5:39945133-39945155 CTGACTCAGTATAAGGATTGTGG - Intergenic
989842759 5:46100890-46100912 CTGGATTAGAATAAGCAGATGGG + Intergenic
990798384 5:59570820-59570842 GTGGATCAGAATTAGAAGAGGGG + Intronic
990892216 5:60661838-60661860 CAGAATCAGAACATGGAGATTGG + Intronic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
991651224 5:68856249-68856271 CTGAATCAGAGTGGTGAGAGAGG + Intergenic
992122145 5:73605801-73605823 CTAAAACAGAAAAAGGAGACGGG - Intergenic
993040124 5:82804904-82804926 CAGAATGAAAAAAAGGAGAGGGG + Intergenic
993828111 5:92719043-92719065 TTTAATCAGAATAAAGATAGGGG - Intergenic
994049659 5:95348264-95348286 ATGAATTAGAATAAAGAAAGCGG - Intergenic
995013265 5:107281594-107281616 CCAAATCAGAATAAAAAGAGGGG - Intergenic
995465612 5:112447170-112447192 CAGAATCAGAACATGGAGATTGG + Intergenic
995653542 5:114399006-114399028 ATGAATCCGAATAGGAAGAGAGG - Intronic
995676255 5:114665590-114665612 AAGACTCAGAAAAAGGAGAGAGG - Intergenic
995843413 5:116467269-116467291 CAGAATGAGACTAAGAAGAGTGG + Intronic
995957135 5:117790913-117790935 TTGAATGAGAATAAAGAGATAGG + Intergenic
998530148 5:142876893-142876915 CTGAACCAGAATCAGAAGGGTGG + Intronic
998790628 5:145763012-145763034 CTGAATCAGAACTTGGGGAGTGG + Intronic
999831829 5:155327541-155327563 CAGAATCAGAATATTGAAAGTGG + Intergenic
999910557 5:156193755-156193777 ATGAATCAGAATAGGTACAGAGG - Intronic
1000509974 5:162168710-162168732 CTGAATAAGAGTGATGAGAGAGG - Intergenic
1000697777 5:164410135-164410157 ATGGATCAGAATAATAAGAGAGG + Intergenic
1001224623 5:169933120-169933142 CTGAAACAGGGTAAGGAGAAGGG + Intronic
1001457888 5:171880381-171880403 CTGAAGTAGAATAAAGACAGAGG - Intronic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1003022889 6:2527377-2527399 TTGAAGAAAAATAAGGAGAGAGG - Intergenic
1003328160 6:5108551-5108573 CTGAGTCAGAATCTGCAGAGAGG + Exonic
1003806340 6:9729459-9729481 ATGAATCAGGATAATGAGATAGG + Intronic
1003838425 6:10095245-10095267 CTTGATCAGAATAGAGAGAGAGG + Intronic
1004111462 6:12722720-12722742 CTAAAGCAGAATCATGAGAGAGG - Intronic
1004236789 6:13881488-13881510 CAGAATCAGAACATGGAGATTGG + Intergenic
1004319741 6:14622948-14622970 CTGAGTCAGAATCTCGAGAGAGG + Intergenic
1004578693 6:16925965-16925987 CTTTATCAGAAAGAGGAGAGAGG - Intergenic
1007771968 6:44199498-44199520 CTGAAGAAGAAAAAGAAGAGGGG - Intergenic
1007861295 6:44911828-44911850 TTGAATTAGAACATGGAGAGAGG + Intronic
1008157567 6:48035469-48035491 ATGAATCAGAAAAAGGGGATAGG + Intronic
1008364289 6:50658199-50658221 CTGAATCAGAATCAGGTATGGGG + Intergenic
1010036095 6:71327685-71327707 CTGAAAGAGAATAAGGCTAGTGG - Intergenic
1010309527 6:74368085-74368107 CTGATGGAGAACAAGGAGAGAGG - Intergenic
1010812076 6:80312463-80312485 TTGAATCAGAGTGATGAGAGAGG + Intronic
1010931424 6:81808357-81808379 CTGATTCAGAATAGGAAGAAAGG + Intergenic
1011189809 6:84717115-84717137 CAGAATCAGAACATGGAGATTGG - Intronic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1011539893 6:88418043-88418065 CAGAATCAGAACATGGAGATTGG - Intergenic
1012420277 6:99057235-99057257 CTGATTCAAAATATGGAGAAGGG + Intergenic
1012933862 6:105344958-105344980 CTCATTCAGAATAAGGAATGTGG + Intronic
1013022209 6:106231461-106231483 CAGAATCAGAACATGGAGATTGG + Intronic
1013128555 6:107209249-107209271 CTGAAGCAGAATAGGAAAAGAGG - Intronic
1013168175 6:107612541-107612563 CTGAACCAGAAACTGGAGAGTGG + Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1016072556 6:139757368-139757390 TTGAATCAGAATATGGAGGGTGG - Intergenic
1016246657 6:141989777-141989799 TTCCATCAGAATGAGGAGAGAGG - Intergenic
1016343284 6:143084837-143084859 CAGAATCAGAACATGGAGATTGG - Intronic
1016444749 6:144120200-144120222 CAGAATCAGAACATGGAGATTGG - Intergenic
1018435155 6:163752604-163752626 CTAAATCAGAATCAGAAGACGGG + Intergenic
1018545164 6:164927857-164927879 ATGAATCAGAATACAGGGAGAGG - Intergenic
1018588440 6:165389022-165389044 CCGAAACAGGGTAAGGAGAGCGG + Intronic
1018687485 6:166315270-166315292 CAGAATCAGAACATGGAGATTGG + Intergenic
1018761015 6:166894392-166894414 CAGAATCAGAACATGGAGATTGG + Intronic
1020522634 7:9212311-9212333 CTGAATTTGAACAAGGAGTGGGG - Intergenic
1021219400 7:17958645-17958667 GTGAATCAGAAAAGGTAGAGGGG - Intergenic
1021236135 7:18144475-18144497 CTGAATTAGAATAATAGGAGTGG - Intronic
1022871613 7:34486232-34486254 CTGATTCAGAATTTTGAGAGAGG - Intergenic
1023336607 7:39177215-39177237 CTGAATCATTAAAAGGAGGGTGG - Intronic
1023439326 7:40170102-40170124 CAGAATCAGAACATGGAGATTGG - Intronic
1026216146 7:68350876-68350898 TTGGATCAGTAGAAGGAGAGAGG + Intergenic
1028290158 7:89055780-89055802 ATCAATCAGAAAAAGGTGAGGGG + Intronic
1028446815 7:90933999-90934021 CTAAATAAGAATAAAGCGAGTGG - Intronic
1028588616 7:92474510-92474532 CAGAATCAGAACATGGAGATTGG - Intronic
1030297492 7:107943633-107943655 CTGAATCAGAATCTGGGGATGGG - Intronic
1030843522 7:114382958-114382980 CAGAATCAGAACATGGAGATTGG - Intronic
1031471494 7:122173788-122173810 CAGAATCAGAACATGGAGATTGG + Intergenic
1031549111 7:123086201-123086223 CAGTATCAGAAAAAGGAGAATGG + Intergenic
1031812862 7:126393587-126393609 ATAAAACAGAATAAGGGGAGAGG - Intergenic
1032426121 7:131823486-131823508 CAGAATCAGAACATGGAGATTGG - Intergenic
1034249162 7:149674542-149674564 CAGAATCAGAACACGGAGATTGG + Intergenic
1034445191 7:151110511-151110533 CTGGAACAGAATAAGGGGATTGG + Intronic
1034777265 7:153839793-153839815 CTGAATCAGAAACAGGGGGGCGG - Intergenic
1037087980 8:14876726-14876748 TTGAAACAGAATTAAGAGAGAGG + Intronic
1037575110 8:20195218-20195240 CTGAGGCAGAAGAAGGAAAGTGG - Intergenic
1039436360 8:37562051-37562073 TTGGAACAGGATAAGGAGAGAGG + Intergenic
1041663899 8:60424155-60424177 CAGAATCAGAACATGGAGATTGG - Intergenic
1041828681 8:62127428-62127450 CTGGAACAGAAAAAGGACAGTGG + Intergenic
1042056080 8:64766140-64766162 CAGAATCAGAACATGGAGATTGG + Intronic
1042339355 8:67662901-67662923 CTGAATCACACTGAGGTGAGGGG + Intronic
1042345192 8:67719822-67719844 TTGAATGAGAATAAGGAAAGGGG + Intronic
1044601683 8:94011648-94011670 CTGAATCAGAATGGAGAGAAGGG + Intergenic
1044791172 8:95848692-95848714 TTGAAACAGAATAATGAGACAGG - Intergenic
1044891879 8:96844826-96844848 CTGAGGGAGACTAAGGAGAGTGG - Intronic
1045174701 8:99709780-99709802 CTGAAACAGAAAAAGGACATTGG + Intronic
1045909876 8:107394517-107394539 CAGAGTCAGAATAAGGAGCTGGG + Intronic
1045959762 8:107953395-107953417 CTGAATCAAAACAAGGCCAGTGG + Intronic
1046152477 8:110246157-110246179 TTGAATAGGAATGAGGAGAGTGG + Intergenic
1046273909 8:111931762-111931784 CTGAATCAGAGTAACAGGAGAGG + Intergenic
1046643915 8:116764556-116764578 CTGATTCAGAATAAGTATTGAGG - Intronic
1047166681 8:122446955-122446977 ATTAATCAGAATAAGCACAGTGG - Intergenic
1047624214 8:126639457-126639479 CAGATTCAGAATAAGAAGAAAGG - Intergenic
1048103699 8:131383522-131383544 GTGAATCAGAATCAGGTGATTGG + Intergenic
1048329695 8:133463406-133463428 GTGAAACAGGATAAGGTGAGTGG - Exonic
1048383518 8:133889806-133889828 CTGAATGAGAAAGCGGAGAGGGG + Intergenic
1048720990 8:137324708-137324730 CTGAATCAGAATTTTGAAAGTGG - Intergenic
1048811735 8:138294231-138294253 GAGAATCAGAAAGAGGAGAGTGG + Intronic
1049224580 8:141443917-141443939 GTGAATTAGAATAAGCAGTGTGG - Intergenic
1049788271 8:144461706-144461728 CTGAAGAACAGTAAGGAGAGGGG - Intronic
1050614345 9:7386427-7386449 CAGAATCAGAACAAAGAGGGAGG + Intergenic
1052042634 9:23756867-23756889 CTGAATCAGAATCTGTAGTGGGG - Intronic
1052384107 9:27805135-27805157 CTAAATCAGAAAAAGCACAGAGG + Intergenic
1052529022 9:29657454-29657476 CAGAATCAGAACACGGAGATTGG - Intergenic
1052538546 9:29777888-29777910 CAGAATCAGAATATGGAGATTGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1055355707 9:75435129-75435151 CTGAGTCAGGATATTGAGAGTGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056115343 9:83435794-83435816 CTGAATCAGAATCTGGGGATGGG - Intronic
1056461522 9:86813799-86813821 CAAGAGCAGAATAAGGAGAGGGG - Intergenic
1056704726 9:88942211-88942233 CAGAATCAGAACACGGAGATTGG - Intergenic
1058282636 9:103134990-103135012 CTGAACCAGAATAGGTATAGAGG - Intergenic
1058520640 9:105811585-105811607 ATGACTCATAATAAGGCGAGGGG + Intergenic
1059770820 9:117423311-117423333 ATAAAACAGAATAATGAGAGAGG + Intergenic
1059933254 9:119282488-119282510 CTGAACGAGAAGAAGGACAGAGG + Intronic
1060962109 9:127688328-127688350 CTGACTCAGAATATGCAGGGCGG - Intronic
1186502885 X:10066184-10066206 CTGTATCAGGCTAAGGAGATTGG + Intronic
1187319140 X:18224919-18224941 GAGACTCAGAAAAAGGAGAGTGG - Intergenic
1187653615 X:21442342-21442364 CTGAATCAGAACAATGAGACAGG + Intronic
1187867297 X:23735342-23735364 CTTAATCAGTGTAAGAAGAGAGG + Intronic
1190106012 X:47561627-47561649 CTGATCCAGAATAAGGAAACCGG - Intronic
1191167119 X:57402781-57402803 CAGAATCAGAACATGGAGATTGG - Intronic
1191801165 X:65081318-65081340 CTGAATCAAAAGATGTAGAGAGG + Intergenic
1191857989 X:65643063-65643085 CTGACTCAGAAGAAGGGAAGAGG - Intronic
1191868816 X:65728042-65728064 TTGGATCAGAATAAGGACCGAGG + Intronic
1192227926 X:69242116-69242138 CCGAAGGAGTATAAGGAGAGTGG - Intergenic
1193171998 X:78347607-78347629 CAGAATCAGAACATGGAGATTGG - Intergenic
1193291087 X:79773564-79773586 CTGAATAAGAGTAGTGAGAGTGG + Intergenic
1193306681 X:79959240-79959262 CAGAATCAGAACATGGAGATTGG + Intergenic
1193920386 X:87417993-87418015 CTGAATAGGAGTAATGAGAGTGG + Intergenic
1194807762 X:98350723-98350745 CAGAATCAGAATCTGTAGAGTGG - Intergenic
1196235010 X:113269496-113269518 CTGAAACAGAAAAAGGACATGGG + Intergenic
1196567121 X:117221436-117221458 ATGAATAAGAAAAAGGAGAGGGG - Intergenic
1198817675 X:140609456-140609478 CTGAAGCAGAAGGAAGAGAGTGG - Intergenic
1199217547 X:145277620-145277642 GTGAAGCAGAACAAGAAGAGTGG - Intergenic
1199316576 X:146385545-146385567 ATGAAAAAGAAAAAGGAGAGTGG + Intergenic
1199505927 X:148561570-148561592 CTGCCTCAGAATCAGGAGTGGGG + Intronic
1199597871 X:149522348-149522370 GTGAGTCAGAATAGGGAGACAGG - Intronic
1199813414 X:151373473-151373495 CTGAGGGAGAATAAGGTGAGGGG + Intergenic
1200369706 X:155711535-155711557 CTAAATAAGAAAAAAGAGAGAGG - Intergenic