ID: 1149930594

View in Genome Browser
Species Human (GRCh38)
Location 17:60750843-60750865
Sequence CAGTGGATAAGGAACAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149930594_1149930598 0 Left 1149930594 17:60750843-60750865 CCCTTCTTGTTCCTTATCCACTG 0: 1
1: 0
2: 1
3: 28
4: 346
Right 1149930598 17:60750866-60750888 TCAGTAGTGCATGCTCCCATAGG 0: 1
1: 0
2: 0
3: 14
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149930594 Original CRISPR CAGTGGATAAGGAACAAGAA GGG (reversed) Intronic
903006359 1:20301448-20301470 CACTGGAGAAGGAAGAGGAAAGG + Intronic
905705611 1:40054744-40054766 CAGTGGCTGAAGCACAAGAATGG - Intronic
905808947 1:40898111-40898133 CAATGGATAAGGTACAACACTGG + Intergenic
905812878 1:40925888-40925910 CAGAGGCTAAGGGACGAGAATGG + Intergenic
905900093 1:41575618-41575640 GAGTGGAGAAGGAAGAAGAGAGG - Exonic
906942641 1:50269003-50269025 CAGTGGATATGAAGCAACAATGG + Intergenic
907651750 1:56302029-56302051 CAGAGGAAAAGGGGCAAGAATGG - Intergenic
909200337 1:72684155-72684177 CTCTGGACAGGGAACAAGAAAGG - Intergenic
909343757 1:74561420-74561442 CAGGGTATAAGAAACAAGAATGG - Intergenic
910440204 1:87243966-87243988 AAGTGAAGAAGGAACAGGAAGGG - Intergenic
910755701 1:90688310-90688332 GATAGGATAAGGATCAAGAAAGG - Intergenic
911340149 1:96626336-96626358 GAGTGGAGAAGTAAAAAGAATGG - Intergenic
911706583 1:101020757-101020779 TGGTGGATAAGGAAAAGGAAAGG - Intronic
911816618 1:102360296-102360318 CAGTAGATAAGTAATAAAAATGG - Intergenic
912611091 1:111045038-111045060 AATTGGCTAAGGGACAAGAAAGG - Intergenic
913537385 1:119786103-119786125 CAGAGGACAAGGAAAAAGCATGG - Intergenic
914682839 1:149951508-149951530 CAGTGGATAATGAAGTGGAAAGG - Intronic
914801574 1:150966289-150966311 CTGTGGAAAAGGGACAAGAAGGG + Intronic
914985080 1:152449598-152449620 CACTGGATCAGGAACAAGCCAGG - Intergenic
915299266 1:154942648-154942670 GAGTGGGTAAGGAACAGGAGGGG + Intergenic
915730783 1:158052679-158052701 CAGAGGATAAGGCAGGAGAATGG + Intronic
915839892 1:159205298-159205320 CAGTGGAAAAGGACAAAGCAGGG - Exonic
916353880 1:163882855-163882877 GATTGGATATGGAGCAAGAAGGG - Intergenic
916449926 1:164911048-164911070 CAGAATCTAAGGAACAAGAAGGG + Intergenic
917133241 1:171763493-171763515 CCCTGGAGAAGGAACAGGAATGG + Intergenic
919072842 1:192777611-192777633 CAGTGGATAAGTAGCAGCAAAGG + Intergenic
919099956 1:193083048-193083070 AAGTGAATAAGAATCAAGAATGG - Intronic
921136239 1:212261666-212261688 CAGCTGATATGGAAAAAGAAGGG - Intergenic
922743162 1:228027587-228027609 AAGTGGGTAAGGGACATGAATGG - Intronic
923629473 1:235640397-235640419 CAGGGGATGAGGCCCAAGAAGGG + Intronic
923949434 1:238931618-238931640 AAGTAGATAATGAACAAAAATGG - Intergenic
924616436 1:245615704-245615726 CAGTGGATGAGAACAAAGAAGGG + Intronic
1064510480 10:16084437-16084459 CGGGGGAAAAGGAAAAAGAAAGG - Intergenic
1065468607 10:26053096-26053118 GAGTGGGAAAGTAACAAGAATGG + Intronic
1066576312 10:36829183-36829205 CAGTTAATTAGAAACAAGAAAGG + Intergenic
1068330636 10:55562237-55562259 CAGTAAATAAGGGACAACAATGG - Intronic
1069180022 10:65347312-65347334 CAGAGGAGGAGGAAGAAGAAAGG + Intergenic
1069538151 10:69270963-69270985 CATTGGGTGAGGAAGAAGAATGG - Intronic
1069700608 10:70422170-70422192 CAGAGGGTAAGGAATATGAATGG - Exonic
1070849179 10:79549722-79549744 CAGTGGAGGAGAAACAAGTATGG - Intergenic
1070924676 10:80211368-80211390 CAGTGGAGGAGAAACAAGTATGG + Intergenic
1071019142 10:81031198-81031220 CAGTGAAAAAGGACAAAGAAGGG + Intergenic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071842993 10:89492373-89492395 CAGTTTTTTAGGAACAAGAATGG + Intronic
1073651961 10:105370482-105370504 AAGTGGAGAAGGAACAAAAAAGG - Intergenic
1075864501 10:125706003-125706025 CAGTGGAAGAGGATCAGGAAGGG - Intergenic
1076022418 10:127084976-127084998 CAGAGGACAACGAACAAGACAGG - Intronic
1076186408 10:128453040-128453062 CAGTGGTGATGGAAAAAGAATGG + Intergenic
1076558724 10:131347070-131347092 GAGGGGAGAAGGAAGAAGAAAGG - Intergenic
1078255224 11:9653127-9653149 CAGTGGAGAATTAAGAAGAAAGG - Intergenic
1080699068 11:34628953-34628975 CAGTGTAAAAGGAACATGCAGGG - Intronic
1082022032 11:47542600-47542622 AAGTGGCTGAGGCACAAGAATGG - Intronic
1082075221 11:47971030-47971052 AAGAGGCTAAGGCACAAGAATGG - Intergenic
1083777627 11:64902037-64902059 CAGAGGAGAAGGAAGATGAAAGG - Exonic
1084203650 11:67578291-67578313 CCGTGGATCAAGACCAAGAAAGG + Intergenic
1085487411 11:76877763-76877785 CAGAGGAAAAGGAAGAAGATGGG - Intronic
1085899635 11:80683584-80683606 CAATGGAGATGGAATAAGAATGG + Intergenic
1086192868 11:84101143-84101165 CAGTTTATAAGGCACATGAAGGG + Intronic
1086985964 11:93249561-93249583 CAGTGGTCAAGGAACAAGCAGGG - Intergenic
1087356466 11:97100135-97100157 CAGTAAAAAAGGACCAAGAAGGG + Intergenic
1087899943 11:103628984-103629006 CAGAGGGTAAGGAACATGAATGG + Intergenic
1088028946 11:105222597-105222619 CAGTAAATAAGGAAGAAAAATGG + Intergenic
1089135552 11:116246277-116246299 GAGTGGAGAGGGGACAAGAAAGG - Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089666158 11:120021284-120021306 CAGTGGAAAAGGAACCAGAGAGG + Intergenic
1090182255 11:124710472-124710494 GAGTGGCTAAGGCAGAAGAATGG + Intergenic
1090984185 11:131751084-131751106 CAGGGGATAGGCAATAAGAAGGG - Intronic
1091155288 11:133366369-133366391 CAGGGGATCAGGAAAAAGAAGGG + Intronic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093742942 12:22708719-22708741 GAGTTGAGAAGGTACAAGAAAGG + Intergenic
1094001617 12:25701171-25701193 GAGTGGCTGAGGCACAAGAAGGG + Intergenic
1094445750 12:30527899-30527921 CAGTGTATAAGGATCAAAACTGG - Intergenic
1097008957 12:55939013-55939035 CAGGGAAGAAGGTACAAGAAGGG - Intronic
1097355894 12:58601434-58601456 TAGTGTAGAAGGCACAAGAAAGG + Intronic
1100695593 12:97089277-97089299 GAGTGGATAAAGAACATTAATGG - Intergenic
1100932167 12:99621641-99621663 CAGTAGAAAAGGAGAAAGAAGGG + Intronic
1101686633 12:107030189-107030211 CAATGAAGAAGGAACAAGAATGG + Intronic
1101884379 12:108648871-108648893 CCGTGGGTAAGGAAGAAGAAAGG + Intronic
1102594704 12:113983595-113983617 CAGTGGTTCAGGAACCAGGATGG - Intergenic
1103237878 12:119389118-119389140 CAGTTCAGAAGGGACAAGAAAGG + Intronic
1104411557 12:128562474-128562496 CATTGGAGATGGAACAAGCAGGG - Intronic
1104566063 12:129885104-129885126 CAGGGGATGAGGAAAAAGAGAGG + Intronic
1105771296 13:23614615-23614637 CAGTGGCTTAAGAGCAAGAAGGG - Intronic
1107336004 13:39355771-39355793 CAGTGAACAAGGACAAAGAAGGG + Intronic
1107956161 13:45514263-45514285 GGGTGGCTAAGGCACAAGAATGG - Intronic
1108375719 13:49812183-49812205 CAGTGGAAAAGCAACAAAAATGG + Intergenic
1108713205 13:53054501-53054523 CAATGGTTCATGAACAAGAAGGG - Intergenic
1108949920 13:56078833-56078855 CTGTGGAGAGGGAACAGGAAAGG - Intergenic
1108966129 13:56304416-56304438 CAGTGGATATTGATCCAGAATGG + Intergenic
1109347907 13:61139363-61139385 GAGTGGATCAGGAAAAATAATGG - Intergenic
1109482134 13:62969737-62969759 CCATGGACAAGGAACAAGATGGG - Intergenic
1109627464 13:64994209-64994231 AAATGAATAAGGAACAAGAGAGG + Intergenic
1111893428 13:94111632-94111654 AAGTACATAAGGAAGAAGAAAGG - Intronic
1112525387 13:100141842-100141864 GAGTGGATCAGGGAAAAGAAAGG + Intronic
1113437170 13:110302165-110302187 CAGAGGATAAAGAAGAGGAAAGG + Intronic
1114221929 14:20704443-20704465 CTGTGTGTAAGGAAAAAGAATGG - Intergenic
1114462010 14:22892484-22892506 AGGAGGATGAGGAACAAGAAAGG + Intergenic
1114694212 14:24611821-24611843 CAAATGATAAGGAACTAGAAAGG - Intergenic
1115307633 14:31948680-31948702 CAGGGGAGTAGGATCAAGAAGGG - Intronic
1115737983 14:36355503-36355525 CAGAGGATCAGGAAAAATAATGG + Intergenic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118229941 14:63938482-63938504 CAGTGGAGAAGGAGCAGAAAGGG + Intronic
1118270376 14:64338041-64338063 CACTGGAGAAGGAATAAGATGGG - Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119723683 14:76908843-76908865 CAGTGGCAAGGGAACATGAATGG + Intergenic
1120393267 14:83935408-83935430 TTGTGGAAAAGGAACCAGAAAGG + Intergenic
1120545922 14:85811269-85811291 GAGTGAATAAGGGAAAAGAAAGG + Intergenic
1120686496 14:87543858-87543880 AAGTAGATAAAGAAGAAGAAAGG + Intergenic
1121014362 14:90539346-90539368 CACTGGATCAGGACCAGGAAGGG - Exonic
1122009331 14:98732792-98732814 AAGAGGATCAGGAATAAGAAAGG - Intergenic
1122436361 14:101703361-101703383 CAGTGTAGAAGGACAAAGAATGG + Intergenic
1124805729 15:32880519-32880541 CAGTGGAGAAGGAAGGTGAATGG - Intronic
1127360395 15:58240136-58240158 CAGTTGAGAAGGAGCCAGAAAGG - Intronic
1127520404 15:59738011-59738033 AAGGGGAAAAGGAACAAGATGGG + Intergenic
1127593890 15:60457973-60457995 CAATGAATATGTAACAAGAATGG - Intronic
1127619511 15:60720015-60720037 GACTGGAAAAGGAACAATAAAGG - Intronic
1128466124 15:67913852-67913874 CAGGGGTTAAGGAAAGAGAATGG + Intergenic
1131531196 15:93193557-93193579 CAGAGCAGAAGGAAGAAGAAAGG - Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1133785841 16:8972562-8972584 GAGTGGATAAGGGAAAACAATGG - Intergenic
1134193513 16:12140456-12140478 CCGTGGAGCAGGAACAAGGATGG + Intronic
1135891826 16:26364344-26364366 CTGAGGATGAGAAACAAGAAGGG - Intergenic
1137637964 16:50003639-50003661 AAGTGGATATGGAAGAACAAAGG + Intergenic
1138789136 16:59881594-59881616 GAGTGGATCTGGAAGAAGAATGG + Intergenic
1138817873 16:60223078-60223100 CAGTGGATAAATACTAAGAAAGG - Intergenic
1139207563 16:65043987-65044009 AAGTGGATAATGCACAAGGAAGG + Intronic
1140238063 16:73176408-73176430 GAGGTGATAAGGAACAAAAATGG - Intergenic
1143613606 17:8036188-8036210 CAATGGATAAGAATTAAGAACGG + Intergenic
1143769430 17:9158590-9158612 CAGTGGACCAGGAGCCAGAAGGG + Intronic
1143975049 17:10823441-10823463 CAATGCAGAAGGAACAAGGATGG + Exonic
1144930439 17:18854837-18854859 CAATGGGTAATGAGCAAGAAAGG - Intronic
1146596856 17:34176928-34176950 AACTGGAACAGGAACAAGAAAGG + Intergenic
1148849046 17:50545628-50545650 CAGTGGAGAATGAACTGGAAAGG - Intronic
1149605245 17:57920053-57920075 CTGTGGATCAGGAATAAGAATGG - Intronic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1151517472 17:74605682-74605704 GAGTGGATGAGGAATAAGACTGG + Intergenic
1152510417 17:80783129-80783151 CAGTGGAGAAGGGACAGGCAAGG + Intronic
1153176573 18:2380533-2380555 CAGTGGATGAAGAAAAAAAATGG + Intergenic
1154088644 18:11334924-11334946 CAATGGAGAAGGAATAAGTAAGG - Intergenic
1154506858 18:15049344-15049366 CAGTGCACAAGGAACAAGACAGG + Intergenic
1155038042 18:22041929-22041951 CAGTTGATCAGGATCAAGGAGGG - Intergenic
1155326284 18:24668085-24668107 CAAAGGATAAGGAATAAAAATGG - Intergenic
1155530225 18:26759166-26759188 CAGTGGAAGAGGAACAAGTCTGG + Intergenic
1156536837 18:37872429-37872451 GAGGGGGTAAAGAACAAGAAGGG + Intergenic
1157191076 18:45582173-45582195 CAGGAGATGATGAACAAGAAGGG + Intronic
1158743275 18:60167901-60167923 CCCTGGAGAAGGAACAAGGATGG - Intergenic
1159448962 18:68575845-68575867 CACTGGATAGGAAAGAAGAAAGG - Intergenic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1160005638 18:75067249-75067271 CAGTGGATGTGGAAGAAGCAGGG + Intergenic
1163451633 19:17380885-17380907 CAGTTGACAAGGAAAAATAAAGG + Intergenic
1164202637 19:23031250-23031272 CATAGGATAAGGGAGAAGAAGGG + Intergenic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1164906853 19:31974862-31974884 CAGTAGACAAAGAACAAGGAGGG + Intergenic
1166402955 19:42497237-42497259 CAGAGGAGAAGGAGCAGGAATGG - Intergenic
1167406106 19:49309869-49309891 GAGGGGATAAGGAAGAAGAGGGG - Intronic
1167566313 19:50259353-50259375 CAGCGCAGAAGGAACAAGAGTGG - Intronic
1168115139 19:54218143-54218165 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168120836 19:54251835-54251857 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168124414 19:54275732-54275754 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168177571 19:54635806-54635828 CAGAGGATGAGGAGCAGGAAGGG - Intronic
1168181853 19:54666946-54666968 CAGAGGATGAGGAGCAGGAAGGG - Intronic
926897439 2:17709711-17709733 CAGAGAATAAAGAAAAAGAAGGG + Intronic
926902115 2:17763519-17763541 CAGTGGATTAGGAGGAAGCAGGG - Intronic
926935388 2:18082618-18082640 CAGGGAACAAGGAACAAGGAAGG - Intronic
927062133 2:19433389-19433411 CTTTGGATAAGGAACAATTAAGG - Intergenic
927349591 2:22093784-22093806 CAGTAAAAAAGGAAAAAGAAGGG - Intergenic
929083341 2:38143473-38143495 CAGTGGACACTGAAAAAGAAAGG - Intergenic
930364278 2:50419560-50419582 CAGTGGGAAAGAAAAAAGAAAGG + Intronic
930462508 2:51700841-51700863 TAGTGCTTAAGGGACAAGAAAGG - Intergenic
931046095 2:58355160-58355182 CAGAGATTAAGTAACAAGAAGGG + Intergenic
932449480 2:71800407-71800429 CAGTGGAAAAGGAAGAGAAAAGG - Intergenic
932810973 2:74826015-74826037 GAGTGGACAAGGAGCAGGAAGGG + Intergenic
933859724 2:86453840-86453862 AAATGGATAATGACCAAGAATGG - Intronic
933893003 2:86788559-86788581 CCCTGGATAAGGAAAAAGAAGGG + Exonic
935237331 2:101150274-101150296 CAGTAGAACAGGAACAAGACAGG + Intronic
935944108 2:108270398-108270420 CAGAAGATAAGGATCAAGAAGGG + Intergenic
937540669 2:122948473-122948495 CAGTGTATGAAGAACAGGAAAGG + Intergenic
937783040 2:125861192-125861214 CAGTGGAGAAGGAAAAAAACTGG - Intergenic
937977599 2:127591267-127591289 CAGCAGTTAAGGAACAAGATAGG - Intronic
938242072 2:129750399-129750421 CAGTCAAAAAGGAAAAAGAAGGG + Intergenic
938994806 2:136667028-136667050 GAGTGGATAATGAATTAGAAGGG - Intergenic
939548022 2:143577727-143577749 CTGTGGCTAAGGAAATAGAATGG + Intronic
940211398 2:151259532-151259554 CAGAGGCTGAGGAACCAGAATGG + Intronic
940545311 2:155075836-155075858 CATTGGTTAAGGTACAAAAAAGG + Intergenic
940765295 2:157783763-157783785 CAGTGGATGAGGAACAGAATAGG - Intronic
943701655 2:190994337-190994359 CAGGTGATGAGGAACCAGAATGG + Intronic
944592882 2:201234250-201234272 CAGTGTACAGGGAACAATAATGG - Intronic
944789237 2:203107662-203107684 CACTGGATAAGAAGCAAGAGAGG - Exonic
944945433 2:204678501-204678523 CAGTGGAAAAGGAGCTAGAGCGG + Intronic
946813501 2:223551768-223551790 AAGTGCATGGGGAACAAGAAAGG + Intergenic
947576812 2:231281662-231281684 CAGTGGATATGGAAAAAGAGGGG + Intronic
948328514 2:237146090-237146112 CAGTGGCAAATGAACAAGAAAGG + Intergenic
948353765 2:237361062-237361084 CAATGGGTAAGGATCAAGGAGGG + Intronic
1169712586 20:8581447-8581469 CAGGTTATAAGGAACAAGTATGG + Intronic
1170444338 20:16409796-16409818 CACTGGAAAAGGACCAAGATGGG + Intronic
1170447270 20:16441258-16441280 CCGTGGGTGAGAAACAAGAACGG - Intronic
1170449305 20:16465893-16465915 CACGGGATATGGAACAAGACAGG - Intronic
1170786000 20:19468207-19468229 CAGTGGATACTGAACAAGATAGG + Intronic
1171023674 20:21609542-21609564 CAGAGGAGAAGGATCAAGGAGGG + Intergenic
1171428947 20:25066904-25066926 GAGTGGGGAAGGAACAAGCAAGG + Intergenic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1174091035 20:48047789-48047811 CAGTTAATAAGGAAGAAGGAAGG + Intergenic
1174161746 20:48555959-48555981 CAGAGGAGAAGGAACCAAAATGG - Intergenic
1175233250 20:57489692-57489714 CAGAGGCTGAGGCACAAGAATGG - Intergenic
1176791016 21:13319756-13319778 CAGTGCACAAGGAACAAGACAGG - Intergenic
1177039667 21:16092674-16092696 AAGAGAAAAAGGAACAAGAATGG - Intergenic
1177048606 21:16203041-16203063 GAGTGGATGAGAAACAAGGATGG - Intergenic
1178319407 21:31593891-31593913 ATGTGGAAAAGGAAAAAGAAAGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1184730096 22:46367093-46367115 CAGTGGAAAAGGAGGACGAAGGG + Exonic
949208036 3:1464294-1464316 CAGTTGATAACGGAAAAGAAAGG + Intergenic
950541335 3:13615065-13615087 CAGTGGCTACAGCACAAGAAGGG - Intronic
950789561 3:15461565-15461587 CAGTGGGAAAGGATCAGGAAAGG + Intronic
951069246 3:18306981-18307003 CAATGGAAGAGGAAAAAGAAGGG + Intronic
951340229 3:21477048-21477070 TAGTGTATTAGGCACAAGAAAGG - Intronic
952032383 3:29159495-29159517 CAGCTTATAAGGAAGAAGAAAGG + Intergenic
954096017 3:48328806-48328828 CAGGCAATAAGAAACAAGAAGGG + Intergenic
954366787 3:50150696-50150718 CAGTGCAGAAGGATGAAGAAGGG + Intergenic
955310561 3:57882363-57882385 AAGGGGATAGGGAACAATAAAGG + Intronic
957315593 3:78571830-78571852 GAGTGGATAAGAAAGATGAAAGG - Intergenic
957983104 3:87537927-87537949 CAGGGGAAAAGCATCAAGAAAGG - Intergenic
959494184 3:107030350-107030372 AAGTGGATGACGAACAAGGAAGG + Intergenic
961639508 3:128356296-128356318 CAGTGGCCAAGAAACAAAAAAGG - Intronic
961893858 3:130151581-130151603 CACTGGCTAAGGGAGAAGAAAGG + Intergenic
962164762 3:133037835-133037857 CAGTGGAAGAAGGACAAGAAAGG + Intergenic
962748413 3:138414873-138414895 CAGTTTATAAGGAATAAAAATGG - Intergenic
963034697 3:141015779-141015801 CAGTGGAAAAAGAAAACGAACGG + Intergenic
963716971 3:148813843-148813865 AAGTGGAGAAGGAAGAAGACTGG + Intronic
964230487 3:154461310-154461332 GTGTGGATAAGGATAAAGAAGGG - Intergenic
965883374 3:173413859-173413881 CCCTGGAAAAAGAACAAGAAAGG + Intronic
966133370 3:176670209-176670231 GAGTGAATAAGGAAGAAGAGGGG - Intergenic
967523388 3:190462529-190462551 ATGTGGAGAAGAAACAAGAATGG - Intergenic
968056873 3:195698433-195698455 CAGTGGAAGAGGAACAGGCATGG - Intergenic
970767202 4:19563958-19563980 CATTGCATAAGGAAACAGAAGGG - Intergenic
971543950 4:27860630-27860652 CAAAGGTTAAGGAAGAAGAAAGG - Intergenic
971739018 4:30497056-30497078 CTCTGGATAAGGAAATAGAATGG + Intergenic
971750442 4:30640281-30640303 CAGAGGATACGGAAAAAGCAAGG - Intergenic
973145011 4:46814286-46814308 CAGTGAATAAGGAAACAAAATGG - Intronic
973204922 4:47549739-47549761 GAGTGAAGAAGGATCAAGAAAGG + Intronic
974145680 4:57944411-57944433 CAGAGGAAAAGGAACAAACAGGG + Intergenic
975642993 4:76518913-76518935 CACTGGAAGTGGAACAAGAATGG + Intronic
977350546 4:95880018-95880040 CAGTGGGAGAGGAATAAGAATGG - Intergenic
978556201 4:109983188-109983210 CGGGGGATAAGGAACCAGTACGG - Intronic
978648230 4:110968008-110968030 CAGTAGAAAATGACCAAGAAAGG - Intergenic
979314432 4:119244838-119244860 CACTGTACATGGAACAAGAAAGG - Intronic
979502363 4:121455072-121455094 GGGTGGAAAAAGAACAAGAAAGG - Intergenic
981166165 4:141560250-141560272 CAGTGGAAAAGGCAGAAGAGGGG + Intergenic
981866677 4:149429242-149429264 CAGTGCATAAGGAAAGACAACGG + Intergenic
983493455 4:168416251-168416273 TATTGGATAAGGACAAAGAAAGG + Intronic
984499045 4:180535295-180535317 CAGTGGATATGGAGCATGAAAGG - Intergenic
985343722 4:188978422-188978444 CAGAGATTAAGGAACAAGATAGG + Intergenic
985854855 5:2416800-2416822 AGGTGGATAGGGAACCAGAAGGG - Intergenic
986242462 5:5973244-5973266 CAATAGATAAGGTACAAGACAGG + Intergenic
986242744 5:5976174-5976196 CACAGGATAAGCAACATGAAAGG + Intergenic
986265157 5:6184517-6184539 GATTGGAGAAGGAAGAAGAAGGG - Intergenic
986701300 5:10411810-10411832 CAGTGTGTCAGGAACTAGAATGG + Intronic
986808036 5:11327191-11327213 CAGTGGGAAAGGACAAAGAAGGG + Intronic
986841606 5:11704045-11704067 CAGAGGACAGGGAAAAAGAAAGG + Intronic
988714474 5:33811499-33811521 AAGAGGAAATGGAACAAGAAGGG + Intronic
989812533 5:45695716-45695738 CGGTGGAAAAGGAGCAGGAAAGG - Exonic
990688516 5:58335512-58335534 CAGTGGGTAAGAAAGAAGCAAGG - Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
990792657 5:59498665-59498687 CAGTAAAAAAGGACCAAGAAAGG + Intronic
991161296 5:63507097-63507119 CAGTGGATACGGCCCAAGGAGGG + Intergenic
992079647 5:73222977-73222999 CAGTGGCTGAGGAACCAGAAAGG + Intergenic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
993587883 5:89754829-89754851 CATTGTAAAAGGAACAAGATAGG - Intergenic
994030474 5:95136166-95136188 CAGTGGATAAGGTTGAAGAGAGG - Intronic
996383485 5:122885705-122885727 CAGTGGATTTGGAATAAGGATGG + Intronic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
997845160 5:137279279-137279301 CAGAGGAGAAGTAACAAGAAAGG + Intronic
997905771 5:137815405-137815427 CAGTGAATAAGGTACAAGCCCGG - Intergenic
999537001 5:152528676-152528698 TGGTGGATAAGGAGCCAGAAGGG + Intergenic
1000994577 5:167945933-167945955 GAGTGGAGGAGAAACAAGAAGGG - Intronic
1002254569 5:177949749-177949771 CAGAGGAAAAGGAGAAAGAATGG - Intergenic
1002483422 5:179518063-179518085 CAGAGGAAAAGGAGAAAGAATGG + Intergenic
1004402288 6:15299876-15299898 CAGTGGGTAAAGTACGAGAAAGG - Intronic
1005476908 6:26216919-26216941 CACTGAATAAAGAAAAAGAATGG - Intergenic
1005776225 6:29134139-29134161 GAGAGGCTAAGGCACAAGAATGG - Intergenic
1006298253 6:33179567-33179589 CAGTGGATGAGGATCAGGAGAGG - Intronic
1006391881 6:33763370-33763392 CAGAGGACAAGGAACAGGGAAGG + Intergenic
1007047256 6:38789473-38789495 CAGAAGATAAGGAACAAAAGAGG + Intronic
1008977526 6:57445522-57445544 CAGTGGCAAAGGAACAAAGATGG - Intronic
1009510246 6:64541650-64541672 CAGTGGATTAGGAAGGTGAATGG - Intronic
1009802008 6:68550204-68550226 CAGTGGTCAAGGATAAAGAAAGG + Intergenic
1011026300 6:82873117-82873139 CAGTAGCTAAGGAGCAGGAAGGG - Intergenic
1012137239 6:95573566-95573588 CAATGGATAGGAAACAAGAGGGG - Intergenic
1013029409 6:106317401-106317423 CAGTGGAAGAGGAAAAAAAAGGG - Intronic
1013068701 6:106708652-106708674 CAGAGGATGAGGAATGAGAATGG - Intergenic
1013566925 6:111374502-111374524 CAGTGGGTAGGGAAGCAGAAAGG + Exonic
1013953457 6:115813112-115813134 CAGTGGTTAAGGAAAATAAACGG + Intergenic
1013964354 6:115936698-115936720 AAGTCGATAAAGCACAAGAAAGG + Exonic
1014457161 6:121649115-121649137 CAGAGGATAAGAAAGAAGCAAGG + Intergenic
1015027909 6:128559195-128559217 TAGTGGATTAGGAAAAAAAAGGG - Intergenic
1016746103 6:147581930-147581952 CAGTGGATAAAGACACAGAAGGG + Intronic
1017971253 6:159314593-159314615 GAATGGATAAGGAACAAGCAGGG + Intergenic
1018486630 6:164246937-164246959 CAGAGGATAAGAAACGAGAGAGG - Intergenic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1019969141 7:4526131-4526153 CAGGGGAAGAGGAAGAAGAAAGG + Intergenic
1024904893 7:54366030-54366052 CAGTGTAAAAGGAAAAAGAGAGG - Intergenic
1025752584 7:64306599-64306621 CAGCGGATAAGGATAAAGAGAGG + Intergenic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027428532 7:78086123-78086145 CAGTTGACAAGGAAAAAGGAAGG - Intronic
1028562560 7:92191836-92191858 CAGTGAAAAAGGACGAAGAAGGG - Intergenic
1028646752 7:93106981-93107003 TCTTGGGTAAGGAACAAGAAGGG - Intronic
1031022136 7:116639557-116639579 CATTAAATAAGGAACTAGAAAGG - Intergenic
1031352153 7:120746646-120746668 CAGTGAATAAGGAAAAGCAAAGG - Intronic
1031541022 7:122994574-122994596 CAGTGGAAAAGGATAGAGAAAGG + Intergenic
1032216515 7:129961598-129961620 AAGGGGCTAAAGAACAAGAAGGG - Intergenic
1032766073 7:134995141-134995163 GAATGGATAAGGAGCAATAAAGG + Intronic
1033635714 7:143209752-143209774 AGGTGGATGAGGAACCAGAAGGG + Intergenic
1035330467 7:158093478-158093500 CAGTGAACAAGGAACAAGACTGG - Intronic
1037702615 8:21288675-21288697 CATTGGATAAGGAAAACAAATGG + Intergenic
1039235714 8:35500493-35500515 CAGTTGAATAGGAACATGAATGG - Intronic
1040420552 8:47236232-47236254 CAGTGGTTAAGGAAGAGGGAGGG + Intergenic
1040898737 8:52394966-52394988 AAGTGGATACGCACCAAGAAGGG + Intronic
1041552077 8:59114096-59114118 CAGTGGAACAGGAAGAAGTAGGG - Intronic
1041752504 8:61276287-61276309 CAGGGAATAAGAAATAAGAAGGG - Intronic
1042779756 8:72477943-72477965 CAGTGAAAAAGGAAAAACAAGGG + Intergenic
1044744092 8:95355507-95355529 AAGAGGAAAAGGAAAAAGAAGGG - Intergenic
1045425348 8:102060553-102060575 CAATGGAAAAGGAATAAGCATGG - Intronic
1045500172 8:102738697-102738719 CAGTGGAGAAGCAAGAAGGAGGG + Intergenic
1045737264 8:105310790-105310812 CAGTGGATAAGGAAACAGAATGG + Intronic
1046376429 8:113387701-113387723 AGGGGGATGAGGAACAAGAAGGG + Intronic
1046593272 8:116230648-116230670 CACTGGAGAATGAAAAAGAAAGG + Intergenic
1046599050 8:116296532-116296554 CTTTGGATAAGGAAAAACAAAGG + Intergenic
1046659699 8:116936477-116936499 AACTGGATAAGGAACAATACAGG - Intergenic
1047059141 8:121203546-121203568 GATTGGATAAAGAACATGAATGG + Intergenic
1048509245 8:135047437-135047459 AAGTGGCTGAGGCACAAGAATGG - Intergenic
1049093204 8:140532415-140532437 TGGTGGATAAGGAACATGACAGG - Exonic
1051191195 9:14515272-14515294 AAGTGGAGAAGGAAGAAAAAGGG + Intergenic
1051484566 9:17594031-17594053 CAGTAGATAATGAACCAGAGGGG - Intronic
1051538667 9:18189620-18189642 CCATGGATGAGGAATAAGAAGGG - Intergenic
1053618622 9:39794296-39794318 GAGTAGATAAGGGACAAGGAGGG - Intergenic
1053783606 9:41634841-41634863 TAGGGGAAAAGGAAAAAGAATGG - Intergenic
1053876797 9:42553658-42553680 GAGTAGATAAGGGACAAGGAGGG - Intergenic
1053895877 9:42741047-42741069 GAGTAGATAAGGGACAAGGAGGG + Intergenic
1054171560 9:61844983-61845005 TAGGGGAAAAGGAAAAAGAATGG - Intergenic
1054234900 9:62548064-62548086 GAGTAGATAAGGGACAAGGAGGG + Intergenic
1054265533 9:62913133-62913155 GAGTAGATAAGGGACAAGGAGGG + Intergenic
1054665974 9:67735829-67735851 TAGGGGAAAAGGAAAAAGAATGG + Intergenic
1055160794 9:73125512-73125534 AGGAGGAGAAGGAACAAGAAGGG + Intergenic
1055824471 9:80307018-80307040 CAGTGGATATGAAACAATGAAGG - Intergenic
1056396313 9:86184483-86184505 CAGAAGATAAGGAACATGGATGG + Intergenic
1056909355 9:90684193-90684215 CAGTGGATAAGCAGCAATTATGG + Intergenic
1058131782 9:101261848-101261870 CAGAGGATCAGGAAAAATAATGG + Intronic
1058443916 9:105036558-105036580 CAGTGGAAAAGGATAAACAAAGG + Intergenic
1058561490 9:106233400-106233422 GAGAGGAAAAGGAAGAAGAAAGG - Intergenic
1058613578 9:106801527-106801549 CAGTAGAAAATGAAGAAGAAAGG + Intergenic
1058673864 9:107383794-107383816 CATTCTATAATGAACAAGAAAGG + Intergenic
1059095716 9:111411621-111411643 CAGTAGATGAGGAAGAAAAAAGG + Intronic
1060038691 9:120281407-120281429 AAGTCTATAAGGAACAATAAGGG + Intergenic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188354764 X:29177134-29177156 CAGTGGAGAAGAAACAAATAAGG + Intronic
1188582650 X:31733999-31734021 CAGTGAATAAAGAACAAAAAAGG - Intronic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1190254416 X:48751885-48751907 CAGTGGATGGGGAAGAAGCACGG + Intergenic
1193214697 X:78850061-78850083 CAGTGGATAATGAATGTGAAAGG - Intergenic
1193665967 X:84317344-84317366 TAGTGGGGAAGGAATAAGAAAGG - Intergenic
1193856881 X:86613329-86613351 CAGATGAAAAGGAAAAAGAAAGG - Intronic
1194891002 X:99378594-99378616 CAGGGGATAGGGAAGAGGAAGGG - Intergenic
1195239008 X:102932465-102932487 CAGGTGATGAGGAACAAAAAAGG + Intergenic
1195335958 X:103854441-103854463 CAGTGGAGAATTAACAAGTAGGG + Intergenic
1195801411 X:108715993-108716015 CATGGGATAAGGAATAAGAGAGG - Intergenic
1196311943 X:114178662-114178684 CAGAGGAGAAGGAAGAAGAGGGG - Intergenic
1197143439 X:123142446-123142468 TAGTAGATAAGGAAACAGAAAGG + Intergenic
1197295664 X:124716441-124716463 CAGTGGATGAGGAAGGAGATTGG - Intronic
1197503403 X:127270489-127270511 AAGTGGAGAAAGAACAAGGAGGG - Intergenic
1198091293 X:133333054-133333076 GTGTGGACAATGAACAAGAAAGG + Intronic
1198295948 X:135286560-135286582 CAGGAGAGAAGCAACAAGAATGG + Exonic
1200275377 X:154727258-154727280 CCATGGAGAAGGAACAAGTAAGG - Intronic
1202161558 Y:21940494-21940516 CAGGGGATGAGGAACAATGAAGG + Intergenic
1202229798 Y:22645879-22645901 CAGGGGATGAGGAACAATGAAGG - Intergenic
1202313358 Y:23550286-23550308 CAGGGGATGAGGAACAATGAAGG + Intergenic
1202557445 Y:26120309-26120331 CAGGGGATGAGGAACAATGAAGG - Intergenic