ID: 1149936104

View in Genome Browser
Species Human (GRCh38)
Location 17:60808859-60808881
Sequence TATGCTGCTCCTTCTCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149936104_1149936106 -8 Left 1149936104 17:60808859-60808881 CCTCATGGAGAAGGAGCAGCATA 0: 1
1: 0
2: 3
3: 22
4: 211
Right 1149936106 17:60808874-60808896 GCAGCATAGGTTAGATCTTAAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1149936104_1149936108 -2 Left 1149936104 17:60808859-60808881 CCTCATGGAGAAGGAGCAGCATA 0: 1
1: 0
2: 3
3: 22
4: 211
Right 1149936108 17:60808880-60808902 TAGGTTAGATCTTAAGGAATGGG 0: 1
1: 0
2: 0
3: 12
4: 134
1149936104_1149936107 -3 Left 1149936104 17:60808859-60808881 CCTCATGGAGAAGGAGCAGCATA 0: 1
1: 0
2: 3
3: 22
4: 211
Right 1149936107 17:60808879-60808901 ATAGGTTAGATCTTAAGGAATGG 0: 1
1: 0
2: 0
3: 13
4: 141
1149936104_1149936109 21 Left 1149936104 17:60808859-60808881 CCTCATGGAGAAGGAGCAGCATA 0: 1
1: 0
2: 3
3: 22
4: 211
Right 1149936109 17:60808903-60808925 AAATATTGCAGCAGATGAGAAGG 0: 1
1: 0
2: 1
3: 45
4: 306
1149936104_1149936110 30 Left 1149936104 17:60808859-60808881 CCTCATGGAGAAGGAGCAGCATA 0: 1
1: 0
2: 3
3: 22
4: 211
Right 1149936110 17:60808912-60808934 AGCAGATGAGAAGGACTGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149936104 Original CRISPR TATGCTGCTCCTTCTCCATG AGG (reversed) Intronic
901952421 1:12759559-12759581 TGTGTGGCTCCTTCTGCATGAGG - Intronic
902504479 1:16930324-16930346 TCTGCTGCTCCTCCTCCAGCCGG - Exonic
902559354 1:17267364-17267386 ATTGCAGCTCATTCTCCATGGGG - Intronic
902990360 1:20183465-20183487 TCTGCTGCTCCTTCACCAGGGGG + Intergenic
903277155 1:22229428-22229450 CATGCTGTTCCTTCTACAGGCGG - Intergenic
904065234 1:27744758-27744780 TATACTGCTCCTTCTCCTGGTGG - Exonic
904534210 1:31188451-31188473 GCTCCTGCACCTTCTCCATGTGG + Intronic
904807039 1:33139607-33139629 TATGCTTATCATTCTCCACGTGG + Intergenic
905035809 1:34917854-34917876 CATGATGCTCCTTCTCTCTGGGG + Intronic
905632216 1:39525149-39525171 TGTGCTGCTCCTTCTCCCAGAGG - Intronic
905665524 1:39761039-39761061 TGTGCTGCTCCTTCCCCCAGAGG + Intronic
907797695 1:57733868-57733890 TGTGCTGCTTCTTCTTCAGGAGG - Intronic
907853469 1:58278932-58278954 AATCCTTCTCCTTCTCCAGGAGG - Intronic
910746896 1:90583862-90583884 TCTGGTGCTCCTACCCCATGGGG + Intergenic
911423866 1:97681284-97681306 TATGCTGTTCTTTGTCCTTGAGG - Intronic
912960417 1:114191054-114191076 TATGCTATGTCTTCTCCATGAGG + Intergenic
914878620 1:151530605-151530627 TCTGCTGCTCCTGCCCCAGGCGG - Exonic
916575122 1:166060168-166060190 CTTCCTCCTCCTTCTCCATGTGG - Intronic
918377413 1:183923092-183923114 TTTGCTGCTCCTTCTGCACTTGG - Intronic
918377653 1:183925155-183925177 TTTGCTGCTCCTTCTGCACTTGG + Intronic
921379751 1:214512340-214512362 AATCCTGCTGCTTCTCCATGTGG + Intronic
921482524 1:215679309-215679331 TTTGCCACTCCTTCTCCAAGAGG - Intronic
922207058 1:223457002-223457024 TTTGCCACTCCCTCTCCATGTGG + Intergenic
922722826 1:227907317-227907339 TAGGATGCTCCTTGTCCATGTGG - Intergenic
922755528 1:228094601-228094623 GCTGCTGCTCTCTCTCCATGTGG + Intronic
1062987513 10:1783010-1783032 CATTCTGCTCCTTCTCCAGGAGG + Intergenic
1063066663 10:2616656-2616678 TATGCTGATCTTTCTCCTTATGG - Intergenic
1064144436 10:12816269-12816291 TATTCGGGTCCTTCTCCATCAGG - Exonic
1066533132 10:36362300-36362322 GTTGCTTCTCCTTCTCCATGTGG + Intergenic
1066758826 10:38736466-38736488 TCTGCTTCTCCTGCTCCCTGAGG + Intergenic
1068480713 10:57585361-57585383 TTTCCTTCTCCTTCTCCCTGTGG - Intergenic
1070388191 10:75946104-75946126 GATGGTGCTCCTTCTCCAGCTGG - Intronic
1070794990 10:79211240-79211262 TAAGCTGCTCCTGCTCCCAGTGG - Intronic
1071262367 10:83932355-83932377 GATGCTGATCTTTCTCCAAGTGG - Intergenic
1072825383 10:98600591-98600613 TTTTTTCCTCCTTCTCCATGAGG - Intronic
1073590819 10:104756089-104756111 TATGTGGCTCCTCATCCATGTGG + Intronic
1075296945 10:121285821-121285843 TATTATGCTACTTTTCCATGGGG - Intergenic
1078582176 11:12547160-12547182 CATGCTGCCACTCCTCCATGGGG + Intergenic
1078643431 11:13116678-13116700 TATGCCGTTCCTTCTGCCTGGGG + Intergenic
1079178968 11:18171687-18171709 TTTGCCTCTCCTTCTCTATGTGG + Intronic
1085045576 11:73351076-73351098 GCTGCTGCTCCTGCTCCTTGTGG + Intronic
1085817464 11:79755244-79755266 CATGCTGTTCCTTCTGCCTGGGG + Intergenic
1089505046 11:118957138-118957160 AAAGCTGCCCCTTCTCCTTGGGG + Intronic
1093500106 12:19802142-19802164 TATGCTGGTCGCTCTCCATCGGG + Intergenic
1093724958 12:22494530-22494552 TTTGCTGATCCTCCTCCCTGTGG - Intronic
1094646293 12:32327898-32327920 TTTGCAACTCCTTCTCCATGTGG - Exonic
1096866287 12:54565575-54565597 CCTGCTGCACCATCTCCATGTGG - Intronic
1097484789 12:60182569-60182591 TATGGTGGTCCTTCTCCATGAGG + Intergenic
1097859086 12:64500203-64500225 TATACTACTCTGTCTCCATGTGG + Intronic
1099591728 12:84600619-84600641 AATGCTGCTCCTTACCCAAGTGG - Intergenic
1102648042 12:114416305-114416327 ATTGCTGCTGCTTCACCATGTGG - Intergenic
1103641371 12:122355228-122355250 TGTGCTGCTGCTTCTCCTTCAGG + Exonic
1106731085 13:32542058-32542080 TGTTCTGCTCCTTCTCCTTTAGG + Intergenic
1108213605 13:48161905-48161927 TGGGCTTCACCTTCTCCATGGGG - Intergenic
1109556763 13:63986512-63986534 TATTCTGCTCCTTCTTCAGTGGG + Intergenic
1109602822 13:64655513-64655535 AATGCTGGTCCTTTTCCATTTGG + Intergenic
1109935883 13:69283690-69283712 TTTGCTGTTACTTCTCCCTGCGG + Intergenic
1109943808 13:69406166-69406188 TAATCTGATCCTGCTCCATGAGG + Intergenic
1110293908 13:73840320-73840342 CATGCTTCTCCTTCTCCATTTGG + Intronic
1111398367 13:87698651-87698673 TGTGCTGCTCCTTCTGAAAGCGG - Intergenic
1112966457 13:105202502-105202524 TATTCTGGTCATGCTCCATGAGG - Intergenic
1113640147 13:111951536-111951558 AATCCTGCTGCTTCTCCATGGGG - Intergenic
1118502391 14:66373992-66374014 AATGCTGCTCCTTTTGCCTGGGG + Intergenic
1120642025 14:87026710-87026732 GATGCTGATCCTTCACCATAGGG - Intergenic
1121742533 14:96264249-96264271 CATCCTGCTCCTCCCCCATGAGG + Exonic
1123442254 15:20301163-20301185 TCTGCTTCTCCTACTCCCTGAGG + Intergenic
1124198869 15:27659219-27659241 TATGCTGCCTCTTCTCCCTCCGG + Intergenic
1124911848 15:33928844-33928866 TATGTTGATTCTTGTCCATGAGG - Intronic
1125208074 15:37177743-37177765 GATCCTGCTACTCCTCCATGTGG + Intergenic
1125277261 15:38006149-38006171 TACTCTGCTGCTTCCCCATGTGG - Intergenic
1126449570 15:48791032-48791054 TTTCCTGCTGCTTCTCCATTTGG - Intronic
1127805583 15:62517001-62517023 ATTGCTGCTCCGTCACCATGTGG + Intronic
1128268051 15:66284417-66284439 TTTGCTGCTCATCTTCCATGTGG - Intergenic
1129006774 15:72380438-72380460 TATGGTCCTCCATATCCATGGGG - Intergenic
1129907295 15:79197422-79197444 CCTGCTGCTCCTCTTCCATGAGG - Intergenic
1130297116 15:82655351-82655373 TATACTGCTTCTTTTCCTTGAGG + Intergenic
1131237709 15:90711240-90711262 CCTGGTGCTTCTTCTCCATGTGG + Intergenic
1131418317 15:92280255-92280277 TAGCCTGCTGATTCTCCATGTGG - Intergenic
1131661324 15:94521051-94521073 CATGCAGCTCCTTCTGCACGGGG - Intergenic
1132252925 15:100348146-100348168 TATGCTGCTGCCTCTTCATTTGG - Intergenic
1136344026 16:29663734-29663756 CACGCTTCTCCTTCTCCTTGGGG + Exonic
1137315266 16:47313174-47313196 TATGATGCTCCTTTTCCATAAGG + Intronic
1138678819 16:58670698-58670720 TCTGCTGCTCCTTGACTATGAGG - Intronic
1139745716 16:69072833-69072855 TATTCTGCTCTTTCTCCGTGTGG - Intronic
1142585545 17:970617-970639 GCTGCTCCTCCTCCTCCATGCGG + Intronic
1143121655 17:4611504-4611526 TATGCTCCTTCTTCTACATTAGG + Intergenic
1143166553 17:4899917-4899939 TGCTCTGCTCCTTCTCCAGGTGG + Exonic
1146480542 17:33201700-33201722 TCTGCTGCTGCTGCTCTATGTGG + Intronic
1146673277 17:34756580-34756602 TGTCCTACTCCTACTCCATGAGG + Intergenic
1147382524 17:40063817-40063839 TCTGGTGCCCCTTCTCCATCTGG + Intronic
1147455693 17:40536774-40536796 CATGCTCATCCTTCTCCCTGAGG + Intergenic
1147898366 17:43767335-43767357 TGTGCAGCTCTTTCTCCAGGTGG - Exonic
1149085102 17:52707398-52707420 TCTGCTGCTAATTTTCCATGTGG - Intergenic
1149626217 17:58082880-58082902 TATGCCTCTCCCTCTCCATAGGG + Intergenic
1149936104 17:60808859-60808881 TATGCTGCTCCTTCTCCATGAGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1150929933 17:69573487-69573509 TACTCTACCCCTTCTCCATGGGG - Intergenic
1151271297 17:72998209-72998231 GATGGTGGTCCTTATCCATGGGG - Intronic
1151578341 17:74963850-74963872 TCTGCTTCTCCTTCTCCGAGTGG + Exonic
1152481061 17:80553229-80553251 TGTGCTGCTCCTTCTCCTGCAGG + Intronic
1152768061 17:82151605-82151627 TGAGCTGCTCTTTCTCCAGGCGG + Intronic
1153976654 18:10274066-10274088 TGTGTTGCTCCTTCTGCCTGAGG - Intergenic
1154415859 18:14174881-14174903 TCTGCTGCTCCTGCTCCCCGAGG - Intergenic
1155201325 18:23520339-23520361 TGTGCTGCCCTTTCACCATGTGG + Intronic
1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG + Intergenic
1156637859 18:39052633-39052655 TCTGCTGCTGCTGCTGCATGTGG - Intergenic
1156874078 18:41985005-41985027 AGTGCTGCTCCCTCTCCAAGTGG - Intronic
1156970387 18:43147138-43147160 TATGCAGTTCCATATCCATGAGG - Intergenic
1157079538 18:44507898-44507920 TTTTCTGCTCTTTCTCCATTGGG - Intergenic
1157434438 18:47656554-47656576 CATGCTGCTCCTTCTGTCTGGGG - Intergenic
1159732786 18:72052164-72052186 GGTGCTGCTCATTCTTCATGTGG - Intergenic
1165153551 19:33774431-33774453 GATGCTGCTGATTCTCCACGTGG + Intergenic
1166186334 19:41141549-41141571 CTTGCTGTTCCTTCTCCCTGAGG - Intergenic
1166817243 19:45553705-45553727 CACGCTGCTCCTCCTCCTTGTGG + Intronic
1167810861 19:51829012-51829034 TATGCTGCTCTTGTTACATGGGG + Intergenic
1168697080 19:58409540-58409562 TATGCTCATCCTTCTCCCTTAGG - Intronic
925248686 2:2410010-2410032 TATTTTTCTCCTTTTCCATGTGG - Intergenic
926149262 2:10415626-10415648 CATGTGGCTCCTTCACCATGCGG - Intronic
926295641 2:11566678-11566700 TCTGTGGCTCCTTCTGCATGGGG + Intronic
926749753 2:16189336-16189358 CATGCTGCTCCTTCTGCCTGGGG - Intergenic
926775954 2:16423528-16423550 TAATCTGCCCTTTCTCCATGAGG + Intergenic
927305249 2:21564002-21564024 GATGCTGTTCCTTCTCTCTGGGG + Intergenic
929582175 2:43088429-43088451 TGGGCTCCTCCTTCTCCATGTGG + Intergenic
929608311 2:43250755-43250777 TATCCTGCTCCATCCCCATGAGG - Intronic
930015227 2:46965439-46965461 CCTGCTCCTCCTTCTCCATCTGG - Intronic
930411427 2:51030387-51030409 TGTGCTGCTGCTTCTCCATGGGG + Intronic
933861213 2:86470346-86470368 TCTGTTGCTCCTTATCCTTGCGG - Exonic
934238030 2:90248262-90248284 TCTGCTTCTCCTGCTCCCTGAGG + Intergenic
934769316 2:96897969-96897991 GCTTCTGCTCCTGCTCCATGGGG + Intronic
935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG + Intergenic
935636960 2:105256381-105256403 CCTGCTGCTCCTTCTGCCTGGGG + Intergenic
937577693 2:123444068-123444090 TTTCCAGCTCCTTCTTCATGAGG - Intergenic
937660955 2:124429102-124429124 TATGCTGCTTTTTCCTCATGAGG - Intronic
937683363 2:124668285-124668307 TATGGATCTCCTTCTCCCTGAGG + Intronic
939345866 2:140965390-140965412 TATTTTGCTCATCCTCCATGTGG - Intronic
942087316 2:172455468-172455490 CTTGCTGGCCCTTCTCCATGGGG - Intronic
943419361 2:187651325-187651347 TATGCTACACATTCTCCATCTGG - Intergenic
944622768 2:201533982-201534004 TATCCTTCTCCTTCTCCATGGGG - Intronic
948734836 2:239995362-239995384 GATGGTGCTGCTGCTCCATGGGG - Intronic
1169549884 20:6691805-6691827 TTTGCTGATTATTCTCCATGTGG + Intergenic
1171356021 20:24546054-24546076 GCTGCTGCTGCTTCTACATGCGG + Intronic
1172867967 20:38114134-38114156 TATGTTGCTCCTTCCTCATGAGG - Intronic
1173817471 20:45998963-45998985 GATGCTGGTACTTCCCCATGTGG - Intergenic
1174078100 20:47952339-47952361 GAGGCTGCTCCTTCCCCATCGGG - Intergenic
1174140023 20:48406148-48406170 GAGGCTGCTCCTTCCCCATTGGG + Intergenic
1175577786 20:60075531-60075553 TATGCTCCAACTTCTCGATGGGG - Intergenic
1176218021 20:63957368-63957390 TATGCTGGTCCCTCTCACTGAGG + Exonic
1181363127 22:22354105-22354127 GAGGCTGCTCCTTGGCCATGGGG + Intergenic
1181365938 22:22377181-22377203 GAGGCTGCTCCTTGGCCATGGGG + Intergenic
1181443805 22:22953073-22953095 AATGCTGCTGCTTCTCTGTGTGG - Intergenic
1185024076 22:48397507-48397529 TGTGCTTCCCCTTCTCCCTGTGG - Intergenic
949847084 3:8382705-8382727 TATTCTGCTCCTTCTGGGTGGGG + Intergenic
950831022 3:15876485-15876507 TAGGCTTCTCTCTCTCCATGTGG - Intergenic
954046911 3:47939790-47939812 TTTCATGCTCCTTCTCCAGGAGG - Intronic
954655701 3:52192858-52192880 TGTGCTGCTGCTGCTCCTTGGGG - Intergenic
954994790 3:54871643-54871665 AATGCAGGTCCTTCTCCACGAGG - Intronic
955079855 3:55648667-55648689 TCTGATGGTCTTTCTCCATGGGG - Intronic
957409404 3:79818148-79818170 GATGCTGTTATTTCTCCATGGGG - Intergenic
957530101 3:81429916-81429938 CATTCTGCCCCTTCACCATGAGG - Intergenic
959566655 3:107839407-107839429 TTTGCTGCTCATTCTGCATAGGG - Intergenic
961559455 3:127718535-127718557 TTTGGTGCTCCTTCCCCATCAGG - Intronic
961715123 3:128852709-128852731 GAGCCTCCTCCTTCTCCATGTGG + Intergenic
962044313 3:131739421-131739443 CATGCTGCTGCTTCCCCCTGTGG + Intronic
963729063 3:148953606-148953628 CTCGCTGCTCATTCTCCATGAGG + Intergenic
964503592 3:157374713-157374735 TTTGGTACTACTTCTCCATGAGG - Intronic
964909450 3:161760727-161760749 TTTGCTGCAGCTTCTACATGAGG - Intergenic
964987839 3:162766359-162766381 TCTGGTGGTCTTTCTCCATGTGG + Intergenic
965215958 3:165865136-165865158 CAGGCTGCTCCTCCTCCATTGGG + Intergenic
966544176 3:181126114-181126136 AATTATGCTCCTTTTCCATGAGG + Intergenic
967622966 3:191656609-191656631 GATACTGTGCCTTCTCCATGAGG + Intergenic
967835213 3:193956640-193956662 GTTGCTGCTCCTCCACCATGTGG + Intergenic
969687234 4:8682471-8682493 GGTGCTGCTGCTTCTCAATGTGG - Intergenic
969933866 4:10661578-10661600 TGTGCTAGTCATTCTCCATGAGG - Intronic
974549520 4:63352948-63352970 TATGCTGATCCAACTCTATGTGG + Intergenic
976201194 4:82580565-82580587 TATGGTGCACCTTCTCCAGGAGG + Intergenic
978375964 4:108076066-108076088 CATGCTACTCCATCTGCATGTGG + Intronic
979772187 4:124541067-124541089 TAAGTTTCTCCTTCTCTATGTGG - Intergenic
980105884 4:128588101-128588123 CACCCTGCTTCTTCTCCATGTGG + Intergenic
982116033 4:152099112-152099134 GCTGCTGCTCATTCTCCAGGAGG - Intergenic
983499348 4:168481333-168481355 TATGATTCTCTTTCTCAATGAGG + Intronic
984552733 4:181180340-181180362 CATGCTGATCCTTCTACTTGTGG + Intergenic
985325730 4:188767658-188767680 TATTCTGCTCCTCTGCCATGTGG - Intergenic
986068476 5:4259196-4259218 CCTGCTGCTGCTTCTCCATGTGG - Intergenic
986634594 5:9808903-9808925 CCTGCTCCTCCTGCTCCATGGGG - Intergenic
988922679 5:35958790-35958812 TATTCTGCTCCTTCTGGCTGAGG - Intronic
989491083 5:42055690-42055712 TATGCTACTTCTTCTCCAGAAGG + Intergenic
990811411 5:59728520-59728542 CCAGCTGCTCTTTCTCCATGTGG + Intronic
993451884 5:88081762-88081784 TCTGCTTCTCCTTCTCCATCTGG + Intergenic
999598568 5:153234306-153234328 TTTCCTCCTCCTTCTCCATTGGG - Intergenic
1002847205 6:957376-957398 GATGCTGTTCCTGCTCTATGCGG - Intergenic
1003728130 6:8789877-8789899 TATTCTGCTCCAGCTCCCTGGGG - Intergenic
1005418596 6:25626922-25626944 AAACCTGCTGCTTCTCCATGTGG - Intergenic
1008098787 6:47369144-47369166 TATGATTCTCCTTCTCCCTGAGG + Intergenic
1008755001 6:54784172-54784194 TTTGCTGGTCCTTCTCAATGGGG - Intergenic
1011550760 6:88529281-88529303 CATCCTGCCCCTTCTCAATGGGG + Intergenic
1013835701 6:114332830-114332852 TATGCTGATCCCTCTCCCTAAGG - Intronic
1016504249 6:144760562-144760584 TTTGATGTTCCTTCTTCATGAGG - Intronic
1018099296 6:160421871-160421893 TATGTTGCTCCTTTGCCATTTGG + Intronic
1018937700 6:168284365-168284387 CATGCTCCTCCTTCTCCCTCTGG + Intergenic
1020383859 7:7576309-7576331 GATCCTGCTCAATCTCCATGAGG - Intronic
1020649666 7:10858725-10858747 TATGCTACTTTTTGTCCATGGGG - Intergenic
1020986112 7:15136560-15136582 TATTATGCTCCTTCTCCATTGGG + Intergenic
1022294955 7:29042163-29042185 TCTGCTGCTCCTCCTCCACATGG - Intronic
1025870734 7:65431592-65431614 TATGATTATCCTTCTGCATGTGG + Intergenic
1026338284 7:69413537-69413559 TATGCCACTCCGTCTCAATGTGG + Intergenic
1026344275 7:69460886-69460908 TATCATGCTCCTTATCCATAGGG - Intergenic
1027435947 7:78164409-78164431 TAGGCTGCTCCTGCCCCATAAGG - Intronic
1028148997 7:87350671-87350693 CATGCTCATCCTTCTCCTTGGGG - Intronic
1028625039 7:92868528-92868550 TAGGCTGCAGCTTCCCCATGTGG + Intergenic
1028670097 7:93392110-93392132 CATGGTGCTACTTCTTCATGTGG + Intergenic
1032506913 7:132442535-132442557 CAATCTGCTGCTTCTCCATGGGG + Intronic
1033065720 7:138152053-138152075 TATACTTCTACTTCTCCATTTGG - Intergenic
1033222231 7:139535827-139535849 TCTCCTGCTGCTTCTCTATGCGG - Intronic
1036709479 8:11068947-11068969 CAGGCTGCTCCTTTTCAATGGGG + Intronic
1037918200 8:22785546-22785568 GATCCTGCTCCTGCTCCCTGAGG + Intronic
1038183304 8:25248897-25248919 GGTGCTGTTCCTTCTCTATGAGG + Intronic
1038431567 8:27504539-27504561 AATGCTGGACCTTCACCATGTGG + Intronic
1038863703 8:31415491-31415513 AAGGTTGCTCCTTCTCCATAAGG - Intergenic
1039929348 8:41970208-41970230 GATGGTGCTATTTCTCCATGAGG - Intronic
1040802342 8:51357110-51357132 TATGTTGCTTGTTGTCCATGAGG - Intronic
1041169248 8:55124197-55124219 GACGCTGCTCACTCTCCATGTGG + Intronic
1041447155 8:57964933-57964955 TATCCAGATCCTTCTCCATCTGG - Intergenic
1044386863 8:91599238-91599260 AAAGCTCCTCCTTCTGCATGAGG - Intergenic
1045747884 8:105445469-105445491 CATGATGCTTCTTCTCAATGTGG + Intronic
1047448131 8:124937983-124938005 AATGCTGCTTTGTCTCCATGTGG + Intergenic
1049104597 8:140603974-140603996 CATGCAGCTCCTTCACCCTGAGG - Intronic
1052149002 9:25088974-25088996 AATACTGGTCCTTCTCTATGGGG + Intergenic
1054373515 9:64430645-64430667 TCATCTGCTCTTTCTCCATGAGG - Intergenic
1056214775 9:84396947-84396969 TCTGTTGCTCCTTGTCCATAGGG - Intergenic
1058018621 9:100066679-100066701 TAGGCTGCTTCTCCTCCCTGGGG + Intronic
1189500591 X:41552663-41552685 AAGGCTGCTGCTTCTCCATTTGG + Intronic
1190909246 X:54757061-54757083 CAGTCTGCTCCTTCTCCCTGAGG - Exonic
1192145217 X:68677670-68677692 AATGCTGCTCCTCCACCAAGTGG + Intronic
1195814022 X:108866115-108866137 GATGCTGCTGCTTCTTCAAGAGG - Intergenic
1196192118 X:112805776-112805798 TATCCTACTCCTTCTCCAGTAGG + Intronic
1198164329 X:134039251-134039273 TATGATTATCCTTCTGCATGTGG - Intergenic
1198517642 X:137425562-137425584 GTCTCTGCTCCTTCTCCATGCGG - Intergenic