ID: 1149938369

View in Genome Browser
Species Human (GRCh38)
Location 17:60833166-60833188
Sequence TTCTTTTAGAATATATAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1154
Summary {0: 1, 1: 0, 2: 7, 3: 104, 4: 1042}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149938369 Original CRISPR TTCTTTTAGAATATATAAAA TGG (reversed) Intronic
900961354 1:5923019-5923041 TTCTTTTAGGATATATTCCAGGG - Intronic
901675870 1:10884144-10884166 TTCTTTTAAAAAAAATGAAATGG - Intergenic
902949554 1:19871413-19871435 TTATTTTAAAATATAAAACAAGG - Intergenic
903869134 1:26419706-26419728 TTCTTTAATCATCTATAAAATGG - Intronic
904017158 1:27430797-27430819 TTTTTTTTAAATATATAAAGAGG - Intronic
905046417 1:35006478-35006500 TTATCTCAGAAAATATAAAATGG - Intronic
905130370 1:35750971-35750993 TTATATTAAAATATATAAACAGG + Intronic
906740307 1:48175462-48175484 TTATTTTAGAATAGACATAAAGG - Intergenic
906921133 1:50065476-50065498 TTTTATTATAATCTATAAAATGG + Intronic
908058398 1:60318288-60318310 TTCATTCAGAATTTATAATATGG + Intergenic
908108266 1:60868473-60868495 TTATTTTAAAATATGTAATATGG + Intronic
908400006 1:63762913-63762935 CTATTTTAAAATATATAAATGGG + Intergenic
909037964 1:70616185-70616207 AACTTATAAAATATATAAAATGG + Intergenic
909457220 1:75863440-75863462 TTCATTAAAAAAATATAAAATGG + Intronic
909648497 1:77944841-77944863 TTATTTTTTAATATAAAAAATGG - Intronic
909746160 1:79099795-79099817 TTCTTTTGGAATGGAGAAAATGG + Intergenic
909786355 1:79618793-79618815 ATCTTTTAGACTATTTAATATGG - Intergenic
909831326 1:80194359-80194381 ATATCTTAAAATATATAAAATGG + Intergenic
909950106 1:81709083-81709105 TCTTTTTAGAATATAAAATAAGG - Intronic
909953952 1:81754328-81754350 TCTTTTTTTAATATATAAAATGG + Intronic
910148297 1:84108770-84108792 TTTTGTCAGAATATATAATATGG - Intronic
910156788 1:84228392-84228414 CTCTTTTATAATCTGTAAAATGG + Intronic
910376700 1:86579866-86579888 ATTTTTGAGAATAAATAAAAAGG + Intronic
910598079 1:89001027-89001049 TTCTTTCAGAAAATATAAAAGGG - Intergenic
911224536 1:95290816-95290838 GTCTTTTAGAATGAAAAAAATGG - Intergenic
911321523 1:96418738-96418760 TTCTGTTAGAATGGATAAACAGG - Intergenic
911336116 1:96582610-96582632 TTACTTTAGAAACTATAAAAAGG + Intergenic
911517841 1:98889755-98889777 TTCTTTTAGAATATCAATTAAGG - Intergenic
911690687 1:100830515-100830537 TCATTTTAGAATATGTAAAAGGG - Intergenic
911751073 1:101498946-101498968 AACTTTCAGAATATATAAAGGGG + Intergenic
911878892 1:103207999-103208021 TTCTGTTAGAATAAATAAGGAGG - Intergenic
912361031 1:109095292-109095314 TAAATTTAGAAAATATAAAAAGG - Exonic
912426366 1:109595816-109595838 TTTTTTTTGAACATGTAAAAAGG - Exonic
912882519 1:113430480-113430502 TTTTTTTAGAATATGAAAAGAGG + Intronic
913008741 1:114661498-114661520 TTCTTTGAAAATATTTGAAAGGG + Intronic
913096075 1:115516576-115516598 TTTTTTTTTAATTTATAAAAGGG + Intergenic
913196027 1:116456711-116456733 TTATTTTAAAAAATAAAAAAAGG + Intergenic
913426846 1:118740999-118741021 TTCTATGAGAATGCATAAAATGG + Intergenic
915398598 1:155605875-155605897 TTCTTGTGGAAAATAGAAAAGGG + Intergenic
916703826 1:167325952-167325974 CTCTTTTAGAAAATAAAAAAAGG + Intronic
916709715 1:167393132-167393154 TTCTTTTTAAAAATATCAAAGGG + Intronic
916711779 1:167417039-167417061 TTCCTTTAGAAAATAAAAGAAGG - Exonic
916805096 1:168251350-168251372 TTCTGTTAAAATAGATAATAAGG + Exonic
917169122 1:172150042-172150064 ATCTTCTAGTATATACAAAAGGG + Intronic
917686353 1:177419972-177419994 TTCCTTTAGACAACATAAAAAGG - Intergenic
918512326 1:185324962-185324984 TTGTTTTCTAATATTTAAAATGG + Intergenic
918558591 1:185836434-185836456 TTATTATATAATAAATAAAAAGG - Intronic
918659015 1:187066221-187066243 TTCTTTTAGAAACAAAAAAAAGG + Intergenic
918733898 1:188034286-188034308 TTCTTTTATACTATCAAAAAAGG + Intergenic
918878956 1:190088872-190088894 TTCTTTTAGAAAATATATAGTGG + Intergenic
918902857 1:190447117-190447139 TTATTTGTGAATATGTAAAATGG + Intronic
919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG + Intergenic
919375520 1:196789104-196789126 CTCTTTGTGAATATATAAAGAGG - Intronic
919385200 1:196913628-196913650 ATCTTTGTGAATATATAAAGAGG - Intronic
919610268 1:199737030-199737052 TCTCTTTAGAAGATATAAAATGG + Intergenic
919680955 1:200434308-200434330 CTCTTTTCTTATATATAAAAGGG - Intergenic
920905133 1:210157074-210157096 TTCTTTAAGAAAATTTAAAGTGG - Intronic
921497848 1:215862637-215862659 ATTTTATATAATATATAAAAGGG - Intronic
921498532 1:215870844-215870866 TTCTTTTATCATTTATTAAATGG - Intronic
921639440 1:217534502-217534524 TTCATTTTGAATATGAAAAATGG - Intronic
921978465 1:221228402-221228424 TTCTTTTAGGATGTATAAAAGGG + Intergenic
922086995 1:222359202-222359224 TGATTTAAAAATATATAAAAAGG + Intergenic
922299942 1:224290052-224290074 TACTTTTAGAGTAGATTAAATGG + Intronic
922553551 1:226515701-226515723 TTACTTTAGAAATTATAAAAAGG - Intergenic
923326245 1:232882750-232882772 TTCTTTTAAAAAATAGAATAAGG + Intergenic
923636297 1:235700437-235700459 TTCTCATAGAATATTTAAAGAGG + Intronic
923812022 1:237329333-237329355 TTTTTTTTAAATATAAAAAAAGG - Intronic
923907041 1:238396101-238396123 TTCTTTAAGAATATATACGTGGG - Intergenic
924358213 1:243206822-243206844 TTCTTGTACAATATGTAAAGTGG + Intronic
1063033878 10:2266338-2266360 TTCCTTTATAATAAATAAATTGG - Intergenic
1063274908 10:4555398-4555420 TTCTTTTATATTATATTGAAGGG + Intergenic
1063292819 10:4767993-4768015 CTCTTTTAGGATAAACAAAAAGG + Intergenic
1063833671 10:9986754-9986776 TTCATTTAAAATATATTCAAAGG - Intergenic
1064235605 10:13571440-13571462 TTCTTCCAGAAAATATAAGAGGG - Intergenic
1064480677 10:15737410-15737432 TTCTTTTAGAATTTTAATAAGGG - Intergenic
1065403960 10:25341816-25341838 TTTTTTCAGAATACATATAAAGG - Intronic
1066099404 10:32104338-32104360 TTCTTTTACAACATTAAAAATGG + Intergenic
1066622543 10:37373784-37373806 TTCATTTAAAATATATAGACTGG - Intronic
1066815371 10:39402181-39402203 TTTTTTTAGAATTTACAAAGTGG + Intergenic
1067774381 10:49151999-49152021 TTATTTAAAAATATATAAAGAGG + Intergenic
1067964866 10:50899731-50899753 TTCTTTTATATTTAATAAAATGG + Intergenic
1068248934 10:54410587-54410609 TTCTTTTGGAATAAATTACATGG + Intronic
1068313490 10:55310417-55310439 TTCTTTTAGAAATGAAAAAAAGG - Intronic
1068327205 10:55508294-55508316 TTCTAATAGAATATATGAAAGGG - Intronic
1068364818 10:56033866-56033888 TTTTTTTAAAATATAGATAATGG - Intergenic
1068893012 10:62168100-62168122 TTTTTGTACAATTTATAAAATGG + Intergenic
1069976623 10:72218516-72218538 TTATTTTTTCATATATAAAATGG + Intronic
1070971459 10:80570790-80570812 TATTTTTATAATATAAAAAATGG - Intronic
1071253779 10:83848065-83848087 TTCTTTGATCATATATAAATGGG - Intergenic
1072028764 10:91495785-91495807 TAATTTTAAAATAAATAAAATGG + Intronic
1072274290 10:93807424-93807446 TTGTTTTAAAATATTTAAACCGG + Intergenic
1072308595 10:94132584-94132606 TTCTTTAAGAGAATATAAAAAGG + Intronic
1072830580 10:98653671-98653693 TTATTATAGCATATATATAAGGG - Intronic
1073164528 10:101433361-101433383 AGCTGTAAGAATATATAAAAGGG + Intronic
1073871765 10:107872693-107872715 TGCTTCTAGAATAAATAAATTGG + Intergenic
1075314396 10:121440498-121440520 GTCTTTTAAAATATATTAAAAGG + Intergenic
1075817083 10:125272782-125272804 TTCATTTAGAAGAGAAAAAAAGG - Intergenic
1076387596 10:130068293-130068315 TTCTTTGACCATATTTAAAATGG - Intergenic
1076939071 10:133589598-133589620 TTATTTTACAATAATTAAAAAGG - Intergenic
1077957988 11:7041723-7041745 TGTTTTGAGAATATATAAAAAGG + Intronic
1079209211 11:18446058-18446080 TTCTTACAGAATTTATAAACAGG - Intronic
1079855337 11:25595769-25595791 GTATTTTAGAAAAAATAAAATGG - Intergenic
1080101907 11:28469006-28469028 TTCTTTTAAAATCTTTTAAAAGG - Intergenic
1080147957 11:29010834-29010856 TACTTTAAGAACATATAACAGGG + Intergenic
1080252113 11:30245183-30245205 TTATTTAAGAAAATAAAAAAGGG - Intergenic
1080356447 11:31452565-31452587 TTCCTGTAGAATATACAGAAAGG + Intronic
1080714404 11:34784868-34784890 TTGCTTTAGAGGATATAAAAGGG - Intergenic
1080840622 11:35980428-35980450 TTCTGTTTATATATATAAAATGG + Intronic
1081074546 11:38653998-38654020 TTCTTTTCTAATATTTAAAATGG - Intergenic
1081130016 11:39367817-39367839 TTCTCTTTGACTATCTAAAATGG + Intergenic
1081229716 11:40570475-40570497 TGCTTTTAGACTATGTAAAATGG + Intronic
1081260609 11:40955467-40955489 ATTTTTTAGAAGATATAAAGTGG + Intronic
1081271616 11:41091499-41091521 TTCTTTTAGAATGAGGAAAAAGG + Intronic
1081406078 11:42699826-42699848 TTCTTTTTGTACCTATAAAAGGG + Intergenic
1081561683 11:44223171-44223193 TTGTTTTTGGAAATATAAAATGG + Intronic
1082233003 11:49792117-49792139 TTCTTTTAAGACATATAAAAGGG + Intergenic
1082683110 11:56203827-56203849 ATGTTTCAAAATATATAAAATGG + Intergenic
1082685916 11:56239385-56239407 TTCTGTTAGAATATAGCAAATGG + Intergenic
1082713319 11:56581804-56581826 TTATTTTAAAATATACAAATGGG + Intergenic
1082719872 11:56660996-56661018 ATTGATTAGAATATATAAAAAGG - Intergenic
1083086761 11:60155974-60155996 TTCTTTAAAAATAAAGAAAATGG + Intergenic
1083327627 11:61881008-61881030 TTTTTTTAAAGTAAATAAAATGG + Intronic
1085293016 11:75413555-75413577 CTCTTTAAGAATATACAAGAAGG - Intronic
1085436759 11:76511386-76511408 TTCTTAAAGCACATATAAAAAGG - Intronic
1085643066 11:78205582-78205604 TTTTTTTTTAATCTATAAAATGG + Intronic
1085926596 11:81031218-81031240 TTATTAGATAATATATAAAATGG - Intergenic
1086274406 11:85108550-85108572 ATCTTATAGAATAAAAAAAATGG - Intronic
1086684970 11:89722439-89722461 TTCTTAAAGAATATTTAATATGG - Intergenic
1086819981 11:91423968-91423990 GTTTTTTAGAAGAAATAAAAAGG - Intergenic
1086858685 11:91898692-91898714 TCCGTTTAGAATATTTATAAAGG + Intergenic
1087163566 11:94974906-94974928 ATCTTTTAAAATTAATAAAATGG + Intronic
1087297445 11:96393339-96393361 TTATTTTAATACATATAAAAAGG + Intronic
1087808797 11:102586871-102586893 TTCTTTGAGAAAATAAACAAAGG - Intronic
1087855100 11:103082547-103082569 TTCTTAGAGAATATAAAACATGG + Intronic
1087925993 11:103919366-103919388 TTTATTGAGAATATAAAAAAAGG + Intronic
1088132434 11:106509691-106509713 TTCTGTTGGAATATATTAATAGG + Intergenic
1088169331 11:106977930-106977952 TTCTTTTAGAATACATTGCATGG + Intronic
1088472526 11:110201703-110201725 ATGTGTTAGAATATATAATAAGG + Intronic
1088475513 11:110234484-110234506 TTCATGTTGAATATATAAACAGG + Intronic
1088904554 11:114144510-114144532 TTCTTTTACAAAAAAGAAAAGGG + Intronic
1088982164 11:114873750-114873772 GGCTCTTAGAATAGATAAAATGG + Intergenic
1088999047 11:115033845-115033867 TTATTTTTGATTATGTAAAAGGG - Intergenic
1089067786 11:115675040-115675062 TTCTTCTAGATTATCTTAAAAGG - Intergenic
1089355742 11:117851665-117851687 TTCTTTAGGAATAAAGAAAATGG - Intronic
1089413870 11:118270373-118270395 TTCTTCAAAAAGATATAAAATGG + Intergenic
1090112199 11:123925056-123925078 TTATTTTCCAATATATTAAATGG + Intergenic
1090313320 11:125762881-125762903 TTCTTTTAGAATTTATTATCTGG + Intergenic
1090497458 11:127228230-127228252 GTCATTTACATTATATAAAAAGG + Intergenic
1090962589 11:131570441-131570463 TGCTTTTAGAACAAATTAAAAGG + Intronic
1090994871 11:131857002-131857024 TACTTTAAGATTATATAAAAAGG - Intronic
1091520705 12:1238823-1238845 ATCTTTTAGTTTATATAAAAAGG - Intronic
1092555058 12:9550023-9550045 TTTTTTTAGAACAAAAAAAATGG - Intergenic
1093746462 12:22747409-22747431 TACTTTAAGAAGGTATAAAAGGG - Intergenic
1093825584 12:23683308-23683330 ATTTTTTAAAAAATATAAAATGG - Intronic
1093864925 12:24214871-24214893 TCATTTTAGAGTACATAAAATGG + Intergenic
1093977928 12:25443276-25443298 TTCTTTTAGAATTTTTATAGAGG + Intronic
1094015821 12:25862876-25862898 TTTTTTGAGAATATAAAAATTGG - Intergenic
1094071240 12:26415880-26415902 TACTTCTGGAATATGTAAAATGG + Intronic
1094446199 12:30533298-30533320 TACTTATAAAATATATGAAAGGG - Intergenic
1094517038 12:31140652-31140674 TTTTTTTAGAACAAAAAAAATGG + Intergenic
1094541675 12:31368028-31368050 CCCTTTTAGAATAAATAAAGCGG + Intergenic
1095067428 12:37795571-37795593 TTTTTGTAGAATATGTAAAGGGG + Intergenic
1095075357 12:37914864-37914886 TTCTTATAGAATCTGTAAAGGGG - Intergenic
1095127293 12:38495247-38495269 TTCTTTGAGAAGATAAAATATGG + Intergenic
1095311977 12:40709772-40709794 TTCTTTTAGCATTCATACAATGG + Intronic
1095357642 12:41294850-41294872 TCCTTTTAGAATTTATGATAAGG - Intronic
1095528777 12:43159871-43159893 TTCTTTTGGCAAATATAATATGG - Intergenic
1095548103 12:43396504-43396526 TTTTTATAGAATAAATCAAAAGG + Intronic
1095683669 12:45007820-45007842 TTATTTTAGATTATCTAACAGGG + Intergenic
1095694604 12:45130242-45130264 TTCTTTTTTAAAAAATAAAAAGG - Intergenic
1095864307 12:46954982-46955004 TTGTTTTAAAATAAATACAAAGG + Intergenic
1096297268 12:50394255-50394277 TTTTAAAAGAATATATAAAATGG + Intronic
1096949560 12:55452448-55452470 TTCTTGTACAATATATCAATGGG + Exonic
1097298521 12:57993315-57993337 CTCTTTTAAAATAAATAGAAAGG + Intergenic
1097573552 12:61361592-61361614 TTATTTCAGAATATATAACTAGG + Intergenic
1097649506 12:62279575-62279597 CTCTTGTAGACTATATAATATGG - Intronic
1097694226 12:62761457-62761479 TTCTTGTAGAAAATATAAACAGG - Intronic
1098182044 12:67857685-67857707 TTCTTGTAGAATATTTTCAAGGG - Intergenic
1098539435 12:71637552-71637574 TTCTTAAAGAATATCTATAAAGG + Intronic
1098708438 12:73721993-73722015 CTCAATTAGAATGTATAAAAAGG + Intergenic
1098740964 12:74172613-74172635 TTTCTCTATAATATATAAAAGGG - Intergenic
1098837078 12:75436592-75436614 TTCTTTAAGAAGATTAAAAATGG + Intergenic
1099051106 12:77782388-77782410 TTCTTTTAAAAAATTAAAAATGG + Intergenic
1099117021 12:78640056-78640078 TTTCTTTAAAAAATATAAAAAGG - Intergenic
1099154078 12:79152605-79152627 TTCTCATAGAATAGATATAATGG - Intronic
1099356938 12:81649143-81649165 CACTGTTAGAATAAATAAAAAGG + Intronic
1099599521 12:84715223-84715245 TTTATTTAGGATATGTAAAATGG + Intergenic
1099620539 12:84997586-84997608 TTCTTTTACAAAATAAGAAATGG - Intergenic
1099669365 12:85670551-85670573 TTCTTGTAAGATAAATAAAAAGG + Intergenic
1099684906 12:85872330-85872352 TTCATTTTAAATATATAACATGG - Intergenic
1099763504 12:86951332-86951354 TCGTTTTAGAATATAGCAAAGGG + Intergenic
1099870133 12:88337198-88337220 ACCTATTAGAATATATGAAATGG - Intergenic
1100292198 12:93227054-93227076 TTCTTTAACAAAATAAAAAAAGG - Intergenic
1100527214 12:95431044-95431066 TACTTTTATCATATGTAAAATGG + Intergenic
1101138001 12:101765393-101765415 TTCTTTTAAAAAAAATAATAGGG + Intronic
1101267869 12:103110744-103110766 TCCTTCTAGATTATAGAAAAAGG + Intergenic
1101463931 12:104927770-104927792 TTCTTTCAGAATTTCTAAAGGGG + Intronic
1101773666 12:107774906-107774928 TTCTTTCAGAAGATAACAAAGGG - Exonic
1102126624 12:110487485-110487507 TTCTTTTAGAATATATTTTGTGG + Intronic
1102543233 12:113637492-113637514 TTCTTTTTTAATATATGAGAAGG + Intergenic
1102847690 12:116204869-116204891 CCCTTTCAGAATTTATAAAATGG + Intronic
1103549987 12:121729794-121729816 GTCTTTTAAAATATAGAAAGCGG + Intronic
1104069508 12:125331714-125331736 TCGTTTTTGAATCTATAAAATGG + Intronic
1105653918 13:22413285-22413307 CTCTTTTAGAATATTTTAAATGG + Intergenic
1105980126 13:25511288-25511310 TTATTTTAAAATATATAGAGAGG - Intronic
1106066405 13:26355757-26355779 TTCTTTTAGAGATCATAAAAAGG - Intronic
1106921882 13:34572921-34572943 TTCTTTTTTAATGTTTAAAATGG - Intergenic
1107081739 13:36382075-36382097 TTCTTTTTTAAGATACAAAAAGG + Intergenic
1107611920 13:42123276-42123298 TTTTTTTAGAAAATATGAACAGG - Intronic
1107715552 13:43195979-43196001 TTCTTTGACAATATAAAAGAAGG + Intergenic
1107996562 13:45866620-45866642 TCCTTTTAAAATAGACAAAAAGG + Intergenic
1108033860 13:46266217-46266239 TTCTCTTTGAATAAATAATAAGG + Intronic
1108194649 13:47980678-47980700 TTCTTTTAAAATATATTACAAGG + Intronic
1108407312 13:50118172-50118194 TCATTTTAGAAAATATACAAAGG + Intronic
1108859988 13:54844408-54844430 TTCTTTAAGAAAAAATAAAATGG + Intergenic
1108946324 13:56029270-56029292 TTCTTTGAAAATATTTAAACTGG - Intergenic
1108954807 13:56139687-56139709 TTCTTTTAAAATATGTAGACAGG + Intergenic
1109088423 13:58007044-58007066 TTATTTTTGAATAAATTAAAAGG + Intergenic
1109134441 13:58628715-58628737 TTCTTTGAAAATATTTATAATGG - Intergenic
1109159406 13:58953718-58953740 TTCTTTTTTAAAAAATAAAATGG - Intergenic
1109257937 13:60106474-60106496 TTCTTCAATAATATACAAAAAGG + Intronic
1109271432 13:60260301-60260323 CTCATTTAAAAAATATAAAAAGG - Intergenic
1109421985 13:62125840-62125862 TTCTTTCAAAATATAGAAAAGGG - Intergenic
1109549719 13:63877958-63877980 TTATTTTAAAACTTATAAAATGG + Intergenic
1109684731 13:65802978-65803000 TTCTTTAAAAAAATATTAAAAGG + Intergenic
1110045238 13:70819876-70819898 TTCTTTTAATATATTTAGAATGG - Intergenic
1110102268 13:71623479-71623501 TTTATTTTGAATATAAAAAAAGG - Intronic
1110315826 13:74105110-74105132 TTCTTTTAGTAAATAAAACAGGG + Intronic
1110317280 13:74124852-74124874 TTCTATTAAAAAATATAAACTGG + Intronic
1110327550 13:74234855-74234877 TTTATTTAAAATTTATAAAAAGG + Intergenic
1110648188 13:77913875-77913897 TTATTTTAGGATATATAGGAAGG + Intronic
1110937532 13:81310460-81310482 ATCTTTAAGAATATATAAACTGG + Intergenic
1110950105 13:81475516-81475538 TTCATATAAAATATATATAAAGG + Intergenic
1111047421 13:82832570-82832592 TTCCTTTTAAGTATATAAAAAGG + Intergenic
1111133472 13:84006476-84006498 TACAATTAAAATATATAAAATGG - Intergenic
1111177172 13:84610286-84610308 TTATTTTAGAAAATGAAAAAAGG - Intergenic
1111683561 13:91473702-91473724 TTCTTAGAGTATAAATAAAATGG - Intronic
1111757280 13:92414552-92414574 TGCTTTGAGAGTATATAACAGGG + Intronic
1112526416 13:100151844-100151866 TGCCATTAAAATATATAAAAAGG + Intronic
1112538075 13:100280723-100280745 TTCATTTCAAATATATTAAATGG + Intronic
1112758359 13:102665976-102665998 TTCTTTTGAAAAATATGAAAAGG - Intronic
1112852442 13:103723249-103723271 TTTTTAAAAAATATATAAAATGG + Intergenic
1113220585 13:108097067-108097089 TGCTTATTGAAAATATAAAAGGG - Intergenic
1113584188 13:111452085-111452107 TTCTTTTGGAATTTATAAGTAGG - Intergenic
1113712772 13:112480362-112480384 TTCTTTTAGAAAAAGAAAAAGGG - Intergenic
1114356532 14:21915685-21915707 TTCTTTTATACTATTTAACAAGG - Intergenic
1114851885 14:26392060-26392082 TTGTTTTGAAATATCTAAAATGG - Intergenic
1115224371 14:31087910-31087932 TTCCTTTTGAAAATATTAAATGG + Intronic
1115608067 14:35025281-35025303 TTCTTTTAGAAGCTATTCAATGG - Intronic
1116180800 14:41530828-41530850 TTCTTTTAGACTAAAGAACAAGG - Intergenic
1116310163 14:43314942-43314964 TTTTCTTAAAAAATATAAAATGG + Intergenic
1116342572 14:43743583-43743605 TTCTTTAAGTATATATGAGAAGG - Intergenic
1116443694 14:44984218-44984240 ATCTTTTAGAAGAAATAAAGCGG + Intronic
1116503630 14:45651068-45651090 ATCTTTCAGAAAATAAAAAATGG - Intergenic
1116538204 14:46062990-46063012 CTTTTGTAGAATATATACAATGG + Intergenic
1116600967 14:46922080-46922102 TTTTTTTAGCATGGATAAAAAGG + Intronic
1117256409 14:53982554-53982576 ATCTTTTAGGAAATATAAAGTGG - Intergenic
1117549656 14:56821548-56821570 TTATTTTCGAAAATGTAAAAAGG + Intergenic
1117567731 14:57012728-57012750 TTATTTTTGCATATATAAAATGG + Intergenic
1117625884 14:57637669-57637691 GTAATTTAGAATATGTAAAATGG - Intronic
1117776792 14:59190997-59191019 TTCATTAGGAATCTATAAAAAGG - Intronic
1117862954 14:60112029-60112051 TTATTTCAGAAGATATGAAAGGG + Intronic
1118201862 14:63681817-63681839 TTTTCTTAGGAGATATAAAATGG - Intergenic
1118310380 14:64688019-64688041 TAATATTTGAATATATAAAATGG + Intergenic
1118946451 14:70392303-70392325 TGCTTCTACAATATCTAAAAGGG - Intronic
1119071289 14:71587362-71587384 TTTTTTTAGAATATAAATTATGG + Intronic
1119343480 14:73901570-73901592 TTCTTATTGTATCTATAAAACGG + Intronic
1119947036 14:78705713-78705735 TACCTTTGGAATAAATAAAATGG + Intronic
1120085772 14:80271023-80271045 TTGTTCTATAATATATGAAATGG - Intronic
1120288755 14:82539629-82539651 TTCATATAGAAAATAGAAAATGG + Intergenic
1120308386 14:82799566-82799588 TTCTTTTAAAATAAAAAAGAGGG - Intergenic
1120771401 14:88384322-88384344 TTTTTTTAAAAAATAAAAAAAGG + Intergenic
1121060548 14:90904585-90904607 TTATTTTAATATATATACAATGG - Intronic
1121891694 14:97599637-97599659 TTCTTTTAGAATTTCTATATAGG - Intergenic
1122039073 14:98969614-98969636 TCCTGTAAGAATACATAAAAGGG - Intergenic
1122162091 14:99792392-99792414 ATAAATTAGAATATATAAAATGG - Intronic
1122449027 14:101788739-101788761 TTATTTTAGTATATATACAGAGG - Intronic
1122582487 14:102779365-102779387 TTCTTTTGGAATTAATAAGATGG + Intronic
1122845236 14:104491651-104491673 TTCTTTTAAAATATAGATACAGG - Intronic
1124712205 15:32023315-32023337 CACTTTCAGAATATAAAAAATGG + Intergenic
1125084263 15:35712285-35712307 TTTTTTTCTAATACATAAAATGG - Intergenic
1125103668 15:35945790-35945812 TGCTTTTAGTACATATTAAAGGG - Intergenic
1125164916 15:36691534-36691556 TTCTGTTAGATTATAGAAAAAGG + Intronic
1125245944 15:37639737-37639759 TTCTTTCAAAACATATAAAATGG + Intergenic
1125461324 15:39909420-39909442 TGCTTTTAGAATTTATGAGAGGG - Intronic
1126067342 15:44836245-44836267 TTCTTCTGGAATGTATAATATGG - Intergenic
1126092538 15:45064633-45064655 TTCTTCTGGAATGTATAATATGG + Intronic
1126226462 15:46276111-46276133 CTCTTTTATGATCTATAAAATGG + Intergenic
1126368003 15:47915903-47915925 TTCTTTTCAAGTACATAAAATGG - Intergenic
1126490848 15:49233991-49234013 CTCTTTTAAAATATATTAAGTGG - Intronic
1126516281 15:49541928-49541950 TGATTTTAGAATTTAAAAAATGG - Intronic
1126616803 15:50591126-50591148 TTCTCTGTGAATATATAAATAGG + Intronic
1126875468 15:53036497-53036519 TTCCTTTAGATTAAATCAAAAGG + Intergenic
1126913135 15:53436094-53436116 GTGATTTAGAAGATATAAAAAGG + Intergenic
1126961996 15:54007084-54007106 TTCTTTCAAAATACATAAAAGGG - Intergenic
1127007145 15:54583501-54583523 TTCTTCTATTATATGTAAAATGG - Intronic
1127110187 15:55660723-55660745 TTTTATTAGCACATATAAAAAGG + Intronic
1127379417 15:58418340-58418362 TTCCATTAGAATATGTAAACTGG - Intronic
1128499239 15:68215749-68215771 TTCCTTTAGAATATATCATATGG - Intronic
1128591653 15:68903286-68903308 GTGTTTTAGAAAATATACAAAGG - Intronic
1129415830 15:75378865-75378887 TTATTTAAGAAAATATAATAGGG + Intronic
1129645884 15:77432129-77432151 TTCTCTGAGAATATATCCAAGGG - Intronic
1130308026 15:82728010-82728032 TTCTTACAGAATATTTAATAAGG + Intergenic
1130814909 15:87421116-87421138 TTCTTTTCTAATCCATAAAAGGG + Intergenic
1131504703 15:93006614-93006636 TTATTTTTAAATATGTAAAATGG - Intronic
1131822786 15:96290041-96290063 CTCTTTTTTAATCTATAAAATGG + Intergenic
1133545366 16:6801282-6801304 GTCCTTTAGAACATATAAATGGG + Intronic
1133848538 16:9479937-9479959 TCCTTTTAGAAAATATCACATGG - Intergenic
1133999165 16:10769280-10769302 TTTCTTTAGAACATATATAAAGG + Exonic
1134113002 16:11527571-11527593 GTCTTTTAAAATAAATGAAATGG - Intergenic
1134176294 16:12009116-12009138 TTATTTTAAAATTTAAAAAATGG - Intronic
1134327903 16:13223813-13223835 TTCTTTGACAATATTTATAAAGG - Intronic
1134333178 16:13269217-13269239 TCCTTTTAGACTATATAGCATGG + Intergenic
1135619260 16:23940498-23940520 TAGTGTTAGGATATATAAAAAGG + Intronic
1137050194 16:35704254-35704276 TTTTTGTAGAATCTATGAAAAGG + Intergenic
1137072712 16:35919600-35919622 TTTTTATAGAATCTAAAAAAAGG - Intergenic
1137451481 16:48578366-48578388 TTCTTTGAGAAAACATCAAATGG - Intronic
1137840291 16:51635101-51635123 TTATTTTGAAATATGTAAAAGGG + Intergenic
1138234112 16:55365837-55365859 TTCTGTAAGAATTTAGAAAATGG - Intergenic
1138240152 16:55421087-55421109 TCCTTTTCGAATCCATAAAATGG - Intronic
1138826355 16:60325219-60325241 TTCTATAAAAATATATAAATTGG + Intergenic
1138958791 16:62004892-62004914 CTCTTTTAAATTTTATAAAAGGG - Intronic
1138993533 16:62420708-62420730 TTCATTTTGAATAAATATAAAGG + Intergenic
1139032274 16:62899493-62899515 TTTTCTTAGAATATACAGAAAGG + Intergenic
1139896697 16:70293526-70293548 TACTTTTAGCATCTATAAAATGG + Intronic
1140169991 16:72594684-72594706 TTCTTTCAGAAAAAATGAAATGG + Intergenic
1140184426 16:72754649-72754671 TTGTTTTAGAATAGAGGAAATGG + Intergenic
1140194107 16:72842992-72843014 GTGTTTTAGAAAATATAAAAAGG + Intronic
1140578176 16:76197675-76197697 TTCTCTTAGAGTTTTTAAAAAGG - Intergenic
1140626182 16:76797148-76797170 TTCTTTTACAAAGTATGAAAAGG - Intergenic
1141210537 16:81975374-81975396 TTCTTTAAGAATACTGAAAATGG - Intergenic
1145290298 17:21539339-21539361 TGCTTTTAAAAAACATAAAAGGG + Intronic
1145363968 17:22238374-22238396 TTTTTTTAGAATCTATGAAGGGG - Intergenic
1145878888 17:28339924-28339946 TACTTTTAAAATATTTAAATAGG + Intronic
1146248131 17:31309491-31309513 TTCTTATAGATTACAAAAAAAGG + Intronic
1146304526 17:31720866-31720888 GTCTTTTAAAATATATAATAGGG + Intergenic
1146711139 17:35042516-35042538 TTATTTTAGAATAAATAATTCGG + Intronic
1146861325 17:36301888-36301910 ATTTTTTCAAATATATAAAAAGG - Intronic
1147091657 17:38105992-38106014 ATTTTTTCAAATATATAAAAAGG - Intergenic
1147105555 17:38214513-38214535 ATTTTTTCAAATATATAAAAAGG + Intergenic
1149295960 17:55263218-55263240 TTTTTTTAAAAAATAAAAAAGGG - Intergenic
1149726616 17:58901370-58901392 TTCTATTAAAAAATAAAAAATGG + Intronic
1149903916 17:60507522-60507544 TTCATTTAGAAAATATTTAAGGG - Intronic
1149938369 17:60833166-60833188 TTCTTTTAGAATATATAAAATGG - Intronic
1150184810 17:63169524-63169546 TGCTTTAAGAATTTTTAAAATGG + Intronic
1150505555 17:65694677-65694699 ATCTTTTAGAATATAAAACCAGG - Intronic
1150960249 17:69904717-69904739 TTCTAATAGAGTAAATAAAATGG - Intergenic
1150972089 17:70040146-70040168 TTCTTTTAACATATATTAATTGG + Intergenic
1151092989 17:71463718-71463740 TTATTTTAATAAATATAAAAAGG - Intergenic
1151110214 17:71667660-71667682 TTCTTTTTTTAAATATAAAAAGG + Intergenic
1151126172 17:71847007-71847029 TTTCTTTAGAAAATAAAAAATGG - Intergenic
1151914794 17:77109749-77109771 TCCTTTTAGAACATATGGAACGG - Intronic
1152012681 17:77728020-77728042 TGCTTTGAAAATAAATAAAATGG - Intergenic
1153031994 18:722747-722769 CCCTTTTAGAATACATTAAATGG - Exonic
1153069807 18:1092155-1092177 TTCTTTAAGAAGAGAAAAAATGG - Intergenic
1153543673 18:6184611-6184633 TTCTTTTAGAATACAAAAACAGG + Intronic
1153669460 18:7396717-7396739 TTATTGTAGAATATTTAAACAGG + Intergenic
1154203257 18:12314869-12314891 TGCTTTTAATATATTTAAAAGGG + Intronic
1155114050 18:22747296-22747318 CTCTTTTAAAAAATATGAAAAGG + Intergenic
1155401516 18:25444894-25444916 ATCTTTAAGAATATATACAAAGG + Intergenic
1155552849 18:26984169-26984191 AACTTTTCCAATATATAAAATGG + Intronic
1156174691 18:34530021-34530043 TTCTATGAGATTATATACAAAGG + Intronic
1156198761 18:34806651-34806673 TGCTTTTAGAAGATTTAAAGGGG - Intronic
1156736038 18:40261488-40261510 TTCTTATAAAAAATAGAAAAAGG + Intergenic
1156739583 18:40307751-40307773 TTCATTTAAAATATGTGAAAGGG + Intergenic
1156800328 18:41104868-41104890 ATTTTTTAGAAAATAAAAAAAGG + Intergenic
1156991127 18:43408775-43408797 TTCTTTTTGAACATAGAATATGG - Intergenic
1157267452 18:46239608-46239630 TTCTTTTAAAAAATATAAATTGG + Intronic
1157275392 18:46307063-46307085 TTATTTTATTAGATATAAAAAGG - Intergenic
1158495109 18:57948405-57948427 TTGTTATATAATATGTAAAAGGG + Intergenic
1158602352 18:58865326-58865348 TTCTTTTAGAAGCTACTAAAGGG + Exonic
1159173837 18:64809196-64809218 TTCATTTAAAATATATATGATGG - Intergenic
1159521740 18:69533765-69533787 ATCATTTAGAAATTATAAAAAGG - Intronic
1159681034 18:71352454-71352476 TTTTTTTAGAAGATCTAAAATGG + Intergenic
1159728356 18:71992761-71992783 TTCTTTTTGAAAAATTAAAAAGG + Intergenic
1159729100 18:72002905-72002927 TTCTTTAATAATATTTAAAGTGG + Intergenic
1159757851 18:72388312-72388334 TCCTTTTAAAATATATAATTGGG + Intergenic
1159826042 18:73211707-73211729 CTCTTTTAAAAAATTTAAAAAGG + Intronic
1159931795 18:74319742-74319764 TTCCTTTAAAATAAAAAAAAAGG - Intronic
1160088005 18:75797390-75797412 TTTTGTTAAAATATATAAGATGG - Intergenic
1160110414 18:76024434-76024456 TTCTTTAAGAATATAAACTATGG + Intergenic
1160279769 18:77477390-77477412 TACATTTGGATTATATAAAATGG - Intergenic
1160546574 18:79660900-79660922 TTCTTTTTAAAAATATAAATGGG - Intergenic
1161611438 19:5245289-5245311 GTCTTTAAAAATAAATAAAATGG - Intronic
1163168481 19:15514021-15514043 TTCTTAAAGAATATTTAAAATGG + Intronic
1164349045 19:27310209-27310231 TTTTTGTAGAATCTACAAAATGG + Intergenic
1164409101 19:27983025-27983047 TTCTCTTTGAAAACATAAAAGGG - Intergenic
1164846324 19:31436140-31436162 TTCTTTCAGAAAATACAAAGAGG + Intergenic
1166255050 19:41598136-41598158 TTATATAATAATATATAAAATGG - Intronic
1166332472 19:42087097-42087119 TTTTTTTCCAACATATAAAAAGG + Intronic
1168263829 19:55210232-55210254 TTCTCTTAGCATATTTACAAGGG - Intergenic
925561768 2:5203725-5203747 TTCATTTCAAATAAATAAAAAGG + Intergenic
926256716 2:11209015-11209037 ATCTTGTAGAATATAAATAAAGG - Intronic
926348243 2:11969268-11969290 TTCTTTTATGATGTTTAAAATGG + Intergenic
926352385 2:12008002-12008024 ATTTTTTAGAAAATATAAAAAGG + Intergenic
926427202 2:12749688-12749710 TTCTTATACAATATGTAAAGTGG - Intergenic
926430595 2:12781737-12781759 TAGTTTTAAAATATATAACATGG + Intergenic
926734058 2:16059014-16059036 TACTATTAGAATATCTAAGAAGG + Intergenic
927059972 2:19407876-19407898 ATCTTTGAGAACATATAAAAAGG + Intergenic
927124203 2:19998453-19998475 TTACTTTAAAATATATAAATAGG + Intronic
927278039 2:21278502-21278524 TTCTTAAAGAATACATAGAAAGG - Intergenic
927355039 2:22163267-22163289 TTCTCTGAGAATACACAAAAGGG - Intergenic
927392079 2:22606995-22607017 ATATTTTAGAATATTTTAAAAGG + Intergenic
927545802 2:23951754-23951776 TTCTTTTTTAAGAAATAAAATGG - Intronic
928156958 2:28885661-28885683 TTCTTTTAGATGAGAGAAAATGG - Intergenic
928641497 2:33304159-33304181 TTCTTTTGGAATATATAATCAGG + Intronic
928692075 2:33810436-33810458 TTATTTTAAGATATATCAAATGG - Intergenic
928848612 2:35712738-35712760 ATCTTTTAGAATATTAAAAATGG - Intergenic
928930049 2:36615156-36615178 AACCTTTAAAATATATAAAAAGG + Intronic
929012048 2:37454540-37454562 TTCTGTTAAAAGAAATAAAATGG + Intergenic
929184129 2:39075449-39075471 TTCTTTTAGAGGAGAAAAAAAGG - Intronic
929300465 2:40298616-40298638 TTCTTTCAAAATAGATTAAATGG - Intronic
929359756 2:41073290-41073312 TTCTTTTAGAATAGATCTGAAGG + Intergenic
929373213 2:41252140-41252162 TTCATTTATAATATGTATAATGG - Intergenic
929702785 2:44178953-44178975 TTCTTTTAAAAAATATTAAATGG + Intronic
930336135 2:50048205-50048227 GTATTTTAAAATATATACAAAGG - Intronic
930393644 2:50792414-50792436 TTCCTTCAAAATATATTAAATGG - Intronic
930783510 2:55247719-55247741 TTCTTTTCCAAGATATATAAAGG - Intronic
930854586 2:55999733-55999755 TTTTTTTAGTATATAGAAATTGG + Intergenic
930990865 2:57652158-57652180 TGCTTTTACAAAAAATAAAAAGG - Intergenic
931020210 2:58035913-58035935 TTCTTTTGAACTATATAAATGGG + Intronic
931096391 2:58945452-58945474 AGCTTTTTGAATATATAGAACGG + Intergenic
931622686 2:64227095-64227117 TTTTTTAAAAATAAATAAAAAGG + Intergenic
931768449 2:65477357-65477379 ATCTTTTAAAATATAGACAAAGG - Intergenic
932195752 2:69781860-69781882 TTATTTTAGAACATTTAAAAAGG + Intronic
932919882 2:75899881-75899903 TTCTTTTAGAATTGAAAAGAAGG + Intergenic
932953159 2:76317577-76317599 TTCTATTAGAAAATAGTAAAAGG + Intergenic
932988453 2:76757036-76757058 TTATTTTAGAAAATCTTAAAAGG + Intronic
933057387 2:77688968-77688990 TTTTTTTAGAAGACTTAAAAAGG - Intergenic
933338032 2:80984988-80985010 TTCTTTTAGAGTATCTGGAAAGG - Intergenic
933357526 2:81231088-81231110 TTCTTCTAGAATCTACAGAATGG - Intergenic
933404974 2:81846320-81846342 TGCTTCTAGAATATAGAAAAAGG - Intergenic
933463690 2:82622829-82622851 ACCTTTGAGAATATATAAAGAGG + Intergenic
933509909 2:83227238-83227260 GTCTATTACCATATATAAAAGGG - Intergenic
933567116 2:83963804-83963826 TGTTTTTAGAAAATATCAAAAGG - Intergenic
933683405 2:85123527-85123549 TTATTTTTAAATAAATAAAATGG + Intergenic
933877770 2:86636032-86636054 TCCATTTAGGATATAAAAAATGG - Intronic
933883132 2:86691494-86691516 TTATGTTAGAATAGAAAAAAAGG + Intronic
933927525 2:87110158-87110180 TTTTTTTAGAAGACTTAAAAAGG - Intergenic
934154817 2:89187355-89187377 TTCTTTTAGACATTATAAAAAGG - Intergenic
934212501 2:89995366-89995388 TTCTTTTAAACATTATAAAAAGG + Intergenic
934710982 2:96513836-96513858 TTGTTTTAGAATTAACAAAACGG - Intergenic
935185073 2:100724374-100724396 TTAGTTCAGAATCTATAAAAGGG + Intergenic
935348753 2:102135052-102135074 TTCTTGGAGAATAAACAAAAAGG + Intronic
936005121 2:108879687-108879709 TTCTTTTTTGATCTATAAAATGG - Intronic
936393345 2:112096553-112096575 TAGTTTTAAAATTTATAAAATGG + Intronic
936835021 2:116699226-116699248 TTCTTTGAGAAAAGAAAAAAAGG - Intergenic
937282307 2:120727505-120727527 TTCTTTCACAATACATATAAAGG + Intergenic
937360628 2:121227379-121227401 TATTTTTAAAATATATAAACAGG + Intronic
937545374 2:123011219-123011241 TTCTTTGAGAATTTTTAAGATGG - Intergenic
937720740 2:125092230-125092252 TTCTATTATAAAATGTAAAAAGG - Intergenic
937925434 2:127164221-127164243 TTCTTTGAGATTATATATTATGG + Intergenic
938323068 2:130378150-130378172 TTATTTTAGAATATACAAAATGG + Intergenic
938671646 2:133592029-133592051 TTCTTTTTAAAAATATAAATAGG + Intergenic
939154582 2:138508971-138508993 CTCTTTTAGAACATATAAGCAGG - Intronic
939262237 2:139825181-139825203 TACCTTAAGAATATTTAAAATGG - Intergenic
939344027 2:140939668-140939690 TTCTTTTAGGCTATCTGAAAAGG - Intronic
939639298 2:144619669-144619691 TTATTTTTGAATAAATAGAAGGG + Intergenic
939714340 2:145564572-145564594 CTTTTTTATTATATATAAAATGG - Intergenic
939960208 2:148559619-148559641 TTCTTTAAGAATATTTATATGGG - Intergenic
940015522 2:149100364-149100386 TGCTTTTAGAAGATCCAAAAGGG - Intronic
940061595 2:149576888-149576910 TTCTTCTATAATCTGTAAAAGGG + Intronic
940230788 2:151449378-151449400 TCCTTTTACACTATATAAATTGG - Intronic
940259820 2:151767893-151767915 TACTTTTAAAATATATCACAGGG - Intergenic
940384993 2:153060068-153060090 TTTTTTTAAAAATTATAAAAAGG + Intergenic
940806115 2:158188380-158188402 TATTTTTAGATTATATAAAGTGG - Intronic
940973124 2:159915206-159915228 TGCTTTTCTTATATATAAAATGG + Intergenic
941038566 2:160595028-160595050 TTCTTTTATAATGTAAACAATGG + Intergenic
941057347 2:160803845-160803867 TTCTTTGATAATCTATAAGAAGG - Intergenic
941080802 2:161058364-161058386 TTCCTTGAGAATATATGAAAAGG + Intergenic
941173221 2:162164810-162164832 TTCTTTTACATTATAAAACAAGG - Intergenic
941253464 2:163197460-163197482 TATTTTTAAAATATTTAAAATGG + Intergenic
941321775 2:164064485-164064507 ATATTTTGGAAAATATAAAAAGG + Intergenic
941478958 2:165982673-165982695 TTCTTTTACAATTTCTAAATGGG + Intergenic
941575476 2:167224601-167224623 TTATTTTAGAAGAAATTAAATGG - Intronic
941671349 2:168296943-168296965 TGCTTTAAGAAAATATATAATGG - Intergenic
941694847 2:168540043-168540065 TTCCTTTAGCATATTTGAAATGG + Intronic
942076575 2:172361706-172361728 TCCATCTAGAATATATAAAAAGG + Intergenic
942160511 2:173181086-173181108 TTGCTTAAGAATATATAAAAGGG + Intronic
942254960 2:174087325-174087347 TAGTTTTAGAATATACAATAGGG - Intronic
942681174 2:178479841-178479863 TTTATTTAGAATATAAAACATGG - Intergenic
942727004 2:179020688-179020710 TCATTTTAGTATATATAATAAGG - Intronic
942889960 2:180977848-180977870 TTATTTCATAAAATATAAAAAGG - Intronic
943031853 2:182694972-182694994 TTATTTTATAATCTAAAAAATGG + Intergenic
943482110 2:188432139-188432161 TTCTTAAAAAATTTATAAAATGG - Intronic
943751642 2:191515413-191515435 TTTTTTTATTATATAAAAAAGGG - Intergenic
943996507 2:194773017-194773039 TTCTTTAAGAATAGACTAAATGG + Intergenic
944027466 2:195188520-195188542 TTCTTGTAAAACATAGAAAATGG - Intergenic
944032770 2:195257362-195257384 TTCTATGAGGATTTATAAAATGG + Intergenic
944334743 2:198518972-198518994 ATCTTTTAAAATATATTAACGGG + Intronic
944442429 2:199755954-199755976 TTATTTTAGAACATGTAAAGTGG - Intergenic
944546624 2:200805235-200805257 TGCTATTAGAATATGGAAAAGGG - Intergenic
945411051 2:209507300-209507322 TTGTTTTAGAATATAAACATAGG + Intronic
945451144 2:209997572-209997594 TACTTTTAAAATACATATAAAGG - Exonic
945584681 2:211644801-211644823 TTCATTTAGCAAATTTAAAAGGG - Intronic
945735020 2:213588248-213588270 CTCTGTTAGAAAAGATAAAAAGG - Intronic
947446353 2:230166385-230166407 TTATTCCAGAATATATTAAAAGG + Intergenic
948609271 2:239156456-239156478 TTCTTTTGAAATAAATAATAAGG + Intronic
1168858986 20:1031559-1031581 TATTTTATGAATATATAAAATGG + Intergenic
1168987841 20:2065592-2065614 TTGTTTTAGAAATTAAAAAAAGG + Intergenic
1169363526 20:4972013-4972035 TTCTTTTACTATTTATTAAACGG + Intronic
1169670813 20:8099731-8099753 ATCTATTAGAATTTTTAAAATGG + Intergenic
1170134821 20:13061355-13061377 TTCATTGAGAAAATAGAAAAAGG + Intronic
1170167213 20:13374175-13374197 TTCTTTGAGCATATTTATAATGG + Intergenic
1170196987 20:13699407-13699429 TTCTTTAATAACATAGAAAATGG + Intergenic
1170343201 20:15352571-15352593 TTATTTAAAAATATGTAAAATGG - Intronic
1170354141 20:15473867-15473889 TTCTTTTAGCTGATAGAAAACGG - Intronic
1170523062 20:17208302-17208324 TAATTTTAGCATATGTAAAATGG + Intergenic
1170676839 20:18490035-18490057 GTATTTTAGAATATCTAGAAGGG - Intronic
1170837632 20:19898138-19898160 TGCTTTTTGAAAATATGAAAAGG - Intronic
1170851702 20:20010634-20010656 TTCTTTCAGATTATATGGAAAGG - Intergenic
1170944232 20:20876355-20876377 TTCTTTCAATATAGATAAAATGG - Intergenic
1170968694 20:21099657-21099679 TTCTTTTTTTATATATATAAGGG + Intergenic
1171040712 20:21760053-21760075 TTCTTTTATAATAAATTAAGTGG + Intergenic
1171081669 20:22192723-22192745 TTCTTTAAGAATGTTTAATATGG - Intergenic
1171122523 20:22579126-22579148 TTCTGTCCGAATACATAAAAAGG - Intergenic
1171192372 20:23167834-23167856 TTATTTTAGTATATATAAAGTGG - Intergenic
1171311162 20:24145711-24145733 CTTTTTTAGAAAAAATAAAAAGG - Intergenic
1171509141 20:25666107-25666129 TTGGTTTAGTATATATAGAAAGG + Intergenic
1171969705 20:31556342-31556364 TTCTTTTAAAAAATATAGACGGG - Intronic
1173073074 20:39788374-39788396 TTCTTTTCTAATTTGTAAAATGG - Intergenic
1173452896 20:43180805-43180827 ATATATTAGAATATATAATAGGG - Intronic
1173765973 20:45609672-45609694 GTCTTTTAGAACATGAAAAATGG - Intronic
1174658007 20:52187809-52187831 TTCTTTTATCAAAGATAAAAGGG + Intronic
1174795582 20:53519742-53519764 TTTTTTTAAAAGATATCAAAGGG + Intergenic
1175040332 20:56043645-56043667 TTCTTTTAGAATAATTGAAATGG - Intergenic
1175451108 20:59069107-59069129 TTCTTTTAAAAGATAAAACAAGG + Intergenic
1175572393 20:60033952-60033974 TTCTATGAGAATTTATAGAAGGG - Intronic
1176949512 21:15028818-15028840 TTCTTTTAAAAAATATACATTGG + Intronic
1176974963 21:15310031-15310053 TTATTTTAGAATAGACAAAGGGG - Intergenic
1177098606 21:16870760-16870782 TTCTTTTAAAATAGGTAAAGAGG + Intergenic
1177452694 21:21291889-21291911 TTCTTTTAGGAAAAAAAAAAAGG + Intronic
1177504672 21:22004833-22004855 TTGTTTTCGCATATGTAAAATGG + Intergenic
1177583874 21:23064239-23064261 ATCTTTTAAAATATAAACAAAGG - Intergenic
1177634296 21:23767341-23767363 TTGCTTTGGAATATTTAAAAGGG + Intergenic
1177642612 21:23863064-23863086 TTCTCATAGCATATGTAAAAAGG + Intergenic
1177703236 21:24665829-24665851 TTGATGTAGAATATCTAAAAAGG + Intergenic
1177723882 21:24942655-24942677 TTCTTTTCAAATTTAAAAAAAGG + Intergenic
1177823549 21:26058412-26058434 TTCTTTTAGAAAGGAAAAAATGG + Intronic
1177925196 21:27205533-27205555 TAATTTTAGAATATTTTAAAAGG + Intergenic
1177968139 21:27755194-27755216 TTCTTAAAGCATATAAAAAATGG - Intergenic
1178014216 21:28324740-28324762 TTCTTTTAGAATATATCTGCCGG + Intergenic
1178050350 21:28740153-28740175 TCCTTTTAGTATATTTATAATGG + Intergenic
1178192533 21:30301190-30301212 TTCTTTTGGAAAATAGTAAAGGG + Intergenic
1178640418 21:34340882-34340904 TTTTTTTAGAAAAGAGAAAATGG + Intergenic
1179513906 21:41893169-41893191 TTTTTTTAAAAGAAATAAAATGG + Intronic
1180556260 22:16579272-16579294 TTCTTTTCTCATCTATAAAATGG - Intergenic
1180599065 22:17002281-17002303 TTCTTTAAGAATGTTGAAAACGG - Intronic
1182163487 22:28147857-28147879 TCCATTGAGAATATATGAAAAGG - Intronic
1182179488 22:28331337-28331359 TTCATTTGGAATATGGAAAAAGG - Intronic
1182640639 22:31764194-31764216 TTCTTTTAAAATCTTTAAATTGG - Intronic
1184172346 22:42767256-42767278 TTTTTTTTAAATATATATAATGG + Intergenic
1184931543 22:47684932-47684954 CTGTTTTTGAATATATAATACGG + Intergenic
1185036629 22:48481559-48481581 TTCTGTAAGATTATAAAAAATGG - Intergenic
1203295319 22_KI270736v1_random:37554-37576 CTCTTTTAGAAGAAATAAACTGG - Intergenic
949129136 3:480139-480161 TTCTTCTAAAAAATAAAAAAAGG - Intergenic
949230252 3:1742575-1742597 TTCTCTTAAAAAATAAAAAAAGG + Intergenic
949541169 3:5033317-5033339 ATCTTGAAGAATATATAATATGG + Intergenic
949651176 3:6161355-6161377 TACTTTTAAAATATATACATTGG + Intergenic
949793940 3:7825234-7825256 TTCATTTAAAAGATATAAATTGG + Intergenic
950921866 3:16703068-16703090 TTATTTTTGTATATAGAAAAAGG - Intergenic
951228914 3:20153840-20153862 TTCTATCAGCATAAATAAAATGG + Exonic
951370591 3:21841995-21842017 TATTTGTATAATATATAAAATGG + Intronic
951942831 3:28100073-28100095 TTCTTTGAATATATTTAAAATGG + Intergenic
951968086 3:28411248-28411270 TTCTTTTAAAATGTATTAATTGG - Intronic
952015627 3:28953198-28953220 TTCATTTAGACTATGCAAAAGGG + Intergenic
952068516 3:29602964-29602986 TTCTATGAGAACAGATAAAAAGG - Intronic
952116904 3:30193417-30193439 TTTTCTTAGAATTTATAATAAGG - Intergenic
952165897 3:30748269-30748291 TTCCTTTAGACTATTTTAAATGG + Intronic
952336886 3:32411338-32411360 ATTTTTGTGAATATATAAAAAGG + Intronic
952620321 3:35330737-35330759 AACTTTTAAAATATTTAAAAGGG - Intergenic
952781420 3:37103472-37103494 GTCTTTGGGAATATAAAAAAAGG - Intronic
953151737 3:40331302-40331324 TTCTTTAGGAATGTATAAAGAGG + Intergenic
953400937 3:42616233-42616255 GTCCTTTTGAATAAATAAAAAGG + Intronic
953481053 3:43252613-43252635 TTCTTTAAAACTTTATAAAATGG + Intergenic
953710222 3:45263730-45263752 CTCTTTTACCATATATGAAATGG + Intergenic
954052152 3:47988694-47988716 TTCTATTTGAATTTAAAAAATGG + Intronic
955285313 3:57634977-57634999 TTCATGTAAATTATATAAAATGG + Intronic
955377452 3:58410069-58410091 TTCTTTAAGAATAAAAGAAAAGG - Exonic
955651508 3:61199192-61199214 TTCATTGAGAATAAAGAAAATGG + Intronic
955779702 3:62471448-62471470 TTCACTGAGAATATAAAAAAAGG - Intronic
956007007 3:64791047-64791069 TTGTTTTAAACTTTATAAAAAGG - Intergenic
956268145 3:67421341-67421363 TTGTTTTGGGAAATATAAAAAGG - Intronic
956580909 3:70812221-70812243 TTCTTTGAGAAGTTTTAAAAGGG + Intergenic
956629518 3:71301963-71301985 TTGTTTTAGTATTTATAAATTGG - Intronic
957153532 3:76517972-76517994 TTTTTTTTTAATATAAAAAAAGG - Intronic
957333427 3:78795613-78795635 TTCTTTTAAGACATATAAAAGGG + Intronic
957347749 3:78983707-78983729 TGATTTTAAAATAAATAAAAAGG + Intronic
957400825 3:79711034-79711056 TTATTATAGAAAATATAGAAAGG - Intronic
957466918 3:80605548-80605570 TCATTTTAGAATGTCTAAAATGG - Intergenic
957598144 3:82295032-82295054 CACTATTAGGATATATAAAATGG - Intergenic
957679570 3:83416249-83416271 TGCTTTTAGAAGTGATAAAAAGG - Intergenic
957836624 3:85601531-85601553 ATCTTTGAGTATATCTAAAATGG - Intronic
957840830 3:85666913-85666935 TTATTTTAGAATATATGTACAGG - Intronic
957854218 3:85853244-85853266 CTCTTTTAATATATATACAATGG - Intronic
957893747 3:86391626-86391648 TTTTTTTCTAATACATAAAAAGG - Intergenic
957926147 3:86814546-86814568 TTCTTTGACAATTTATAAAATGG - Intergenic
958199549 3:90292816-90292838 TTCTTCTAGAATCTGTAAAGAGG - Intergenic
958258296 3:91350562-91350584 TTCATTTACAATGTATAGAATGG + Intergenic
958658502 3:97034933-97034955 TTCTTTTGAAAGAAATAAAATGG + Intronic
958784002 3:98577043-98577065 TTCTTGAAGAAGATTTAAAATGG + Intronic
958791993 3:98662453-98662475 TTATTTTAAAATTTACAAAATGG + Intergenic
958926965 3:100169278-100169300 TTTTTGTAGAATAAACAAAAAGG + Intronic
959084501 3:101836661-101836683 TACTTTAAGAAAAGATAAAAGGG - Intronic
959205073 3:103297458-103297480 TTCTTTTAGACTCTGTTAAACGG - Intergenic
959324178 3:104914892-104914914 TTCTTCAAAAATATATAACAGGG + Intergenic
959360550 3:105385233-105385255 TTATTTTAGTATATGTAAATAGG + Intronic
959381859 3:105650754-105650776 TTATTTTAAAATATATAATCTGG - Intergenic
959529827 3:107421795-107421817 TTCTTGTAAAATGTATAAATGGG - Intergenic
959783625 3:110266730-110266752 TCCTATTAGAATGTATTAAAAGG - Intergenic
960028695 3:113036270-113036292 TTCTGGTAAAATATATAACATGG + Intergenic
960096267 3:113693121-113693143 TCTTTTTATAATATATAACATGG + Intronic
960213541 3:115000795-115000817 TTCTTTAAAAATATATAATGAGG - Intronic
960779827 3:121307370-121307392 TTCTTTAAGCATATTTATAATGG - Intronic
960896042 3:122506448-122506470 TTCTATTAAAATATTTTAAACGG - Intronic
961267636 3:125657901-125657923 TTTTTGTAGAATATATGAAATGG - Intergenic
961498299 3:127310685-127310707 TCCGTTTAGAATATTTATAAAGG + Intergenic
962072574 3:132046912-132046934 TGCTGTTAGTATATATAGAAAGG + Intronic
962223801 3:133587235-133587257 ATTTTTTAAAATAAATAAAATGG + Intronic
962333861 3:134507519-134507541 TTCTTTAAGAAAATGTAAAAGGG + Intronic
962375418 3:134854846-134854868 TTGTTTTACAATATGAAAAAAGG - Intronic
962464047 3:135640248-135640270 TTCTCTGAGAATCTCTAAAATGG - Intergenic
962598738 3:136974014-136974036 TCCATTTAAAAGATATAAAATGG - Intronic
963151412 3:142049240-142049262 GAATTCTAGAATATATAAAAAGG + Intronic
963266369 3:143244079-143244101 TTATTTTACAATATATAAACTGG - Intergenic
963511018 3:146249837-146249859 ATTTTTAAGAAGATATAAAAAGG - Intronic
963748814 3:149153023-149153045 TGCTTGTAGAGTACATAAAATGG - Intronic
963749852 3:149165367-149165389 TTGTTTTAAAATATTTTAAAAGG + Intronic
963852928 3:150225811-150225833 TTTTTTTTTAATATAAAAAATGG - Intergenic
964070639 3:152628505-152628527 TTCTCTTAGAATTTTTAAATGGG + Intergenic
964072693 3:152653936-152653958 GTCTTCTTGAAAATATAAAAGGG + Intergenic
964143282 3:153428237-153428259 TTCTTTTGGTATATACCAAAGGG + Intergenic
964353572 3:155827814-155827836 TTTTGGTACAATATATAAAATGG - Exonic
964617658 3:158686385-158686407 TTATTTTTTTATATATAAAATGG - Intronic
964934694 3:162068565-162068587 TGCTTTTTGAAAATATAAACAGG - Intergenic
964973830 3:162595816-162595838 TTCTTTTAAAATTTATTAAAAGG + Intergenic
965167850 3:165219661-165219683 TACCTTAAGAATATGTAAAATGG - Intergenic
965181502 3:165409375-165409397 TTTCTTAAGAATATATTAAAAGG + Intergenic
965449415 3:168819155-168819177 TAACTTTAGAATATCTAAAAAGG + Intergenic
965759326 3:172058498-172058520 ATCTTTTGGCTTATATAAAAAGG - Intronic
966268311 3:178073349-178073371 GTCTATTAGACTATATAAGAAGG + Intergenic
966370015 3:179241269-179241291 TTCTTTTCTCATCTATAAAATGG - Intronic
967368180 3:188711807-188711829 TTCTTTGAGAATTCAGAAAAAGG + Intronic
967558190 3:190884513-190884535 TTCTTTTACATTAAATTAAAAGG - Intronic
967618142 3:191598790-191598812 TACTTGTAGAAAACATAAAAAGG - Intergenic
967859150 3:194138627-194138649 TTCTTCCAGAATATGTAAAAAGG + Exonic
967960289 3:194915397-194915419 ATCTTTTAAAAAATATAAATTGG - Intergenic
968012688 3:195295575-195295597 TTTTCTTAGAATATGTAGAAGGG + Intronic
968068489 3:195771976-195771998 TTCTGTGAGAATATATGGAAAGG - Intronic
968197833 3:196723872-196723894 TTCATTGAGTAGATATAAAAAGG + Intronic
968751758 4:2393615-2393637 TTGTTTTTGACTCTATAAAAAGG + Intronic
970515188 4:16822230-16822252 TTCTTTTATCTGATATAAAATGG + Intronic
970733627 4:19139293-19139315 TTCTTAAAAAATACATAAAATGG - Intergenic
970734591 4:19151128-19151150 TAATTTTAGAGTATATAATAAGG - Intergenic
970785955 4:19796529-19796551 TTTTTTTTTAATAGATAAAATGG - Intergenic
970843845 4:20511727-20511749 TTCTTTTAGAAATAAAAAAATGG - Intronic
971079487 4:23193394-23193416 TTATCTTAGAACATATAAGAAGG + Intergenic
971084308 4:23253019-23253041 TTATGTTAGAATAGAAAAAAGGG + Intergenic
971563298 4:28109640-28109662 TCCTTTAAGAACATAAAAAAAGG + Intergenic
971609359 4:28702368-28702390 TTATTTTAGAAAATTTGAAATGG + Intergenic
972060141 4:34859466-34859488 TTTTTTTACATTGTATAAAAAGG - Intergenic
972090637 4:35277560-35277582 TTCATTTTTAATTTATAAAAAGG - Intergenic
972691036 4:41398431-41398453 TTGCTTTAAAATAAATAAAATGG - Intronic
972716223 4:41649087-41649109 TTCTTTTAAAAGATTTTAAAAGG + Intronic
972747566 4:41952908-41952930 ATATTTTAAAATATATAACATGG - Intronic
972893532 4:43590205-43590227 TGCTTTTAGAATGTATAATATGG - Intergenic
973019255 4:45179840-45179862 CTATTTTATAATATATAAAATGG - Intergenic
973043539 4:45505415-45505437 GTCTTTTAAAAATTATAAAATGG - Intergenic
973089233 4:46111580-46111602 TTATTTTAAACTATATGAAAAGG + Intronic
973093830 4:46172206-46172228 TTATTTTAAAAGATATAAAAAGG + Intergenic
973190119 4:47377032-47377054 TTCTTTCAGGATAAAAAAAAAGG + Intronic
973206525 4:47566443-47566465 TTATATTAGAATCTACAAAAAGG + Intronic
973262904 4:48182618-48182640 CTGGTTTACAATATATAAAATGG - Intronic
973544122 4:51963134-51963156 TTCTTTTGAAATAAATAATAAGG + Intergenic
973713574 4:53652771-53652793 TTATTTTTGAATATGTAAAGGGG + Intronic
974331886 4:60490255-60490277 TTCTATAAAAATAAATAAAATGG + Intergenic
974338375 4:60581299-60581321 TTATTTAAGCATATATCAAAGGG + Intergenic
974379120 4:61115811-61115833 TTGTTTTAGAACACTTAAAATGG + Intergenic
974390012 4:61254249-61254271 TTTTTTTAGAAGTTTTAAAATGG + Intronic
974392195 4:61285810-61285832 TCCTGTTAGAAAATTTAAAAAGG + Intronic
974435756 4:61855913-61855935 TTCATTAAGAATATTGAAAAAGG + Intronic
974485563 4:62500675-62500697 TTCATTGAGAATATATAAATAGG + Intergenic
974687798 4:65253266-65253288 TTCTTCTAGAGTGTATAATAAGG - Intergenic
974803381 4:66848047-66848069 GTATTTTAGAATACATAAAAAGG + Intergenic
974966124 4:68762245-68762267 ATCTTTGTGAATATGTAAAACGG + Intergenic
975403781 4:73966738-73966760 TTCTCTTAAAAGATATAGAATGG - Intergenic
975411103 4:74051162-74051184 TGCTCTTAAAATATATAGAATGG - Intergenic
976324433 4:83754896-83754918 TTCCTTGAGGATATATAGAAGGG + Intergenic
976510518 4:85903603-85903625 TTCTTTATATATATATAAAAAGG + Intronic
976628895 4:87217659-87217681 TTTTTTTGGAATATAGAGAAAGG + Intronic
976630626 4:87232083-87232105 TTCTTTATGAGTGTATAAAAAGG + Intronic
976732883 4:88282463-88282485 TGGTTTAAGAATATTTAAAAGGG - Intronic
977100086 4:92800114-92800136 TTCTTTATTAATATATAAAAAGG - Intronic
977160668 4:93630887-93630909 TGCTTTTAGAAGAAATATAAGGG - Intronic
977192001 4:94012653-94012675 TTTTTTTATACTATGTAAAATGG - Intergenic
977433586 4:96965007-96965029 TTCTTTGAGCATATTTATAATGG + Intergenic
977438056 4:97025740-97025762 TTCATATTGAATATAGAAAAAGG - Intergenic
977449170 4:97172796-97172818 TTTTTTCAGACTATACAAAATGG - Intergenic
977458011 4:97286785-97286807 TACTTTTTGAAAATATAAAAGGG - Intronic
977507486 4:97920855-97920877 GACTTTTAGAAAATAAAAAAAGG - Intronic
977524796 4:98130589-98130611 TTCTTTTTAAATATATGGAAAGG - Intronic
977727546 4:100314342-100314364 TTCTTTTAGGATTTAGCAAAGGG + Intergenic
977789442 4:101081788-101081810 TACTTTTAGAACATTTCAAAAGG - Intronic
977827272 4:101548265-101548287 TTATTTAAAAATATATAATAGGG + Intronic
977830369 4:101583901-101583923 TTCTTTTATAAAGCATAAAAAGG - Intronic
978087808 4:104675868-104675890 ATCTTTTAGAAAATATAAATAGG - Intergenic
978157205 4:105502892-105502914 TTATTTTAGAATAAATTTAAAGG + Intergenic
978349575 4:107807666-107807688 TTCTTTTAGTTCATCTAAAATGG - Intergenic
978374222 4:108058172-108058194 TACTTTTAAAAGATAAAAAAAGG - Intronic
978470992 4:109067328-109067350 TACTTTTTGAATGTATATAATGG + Intronic
978578453 4:110209410-110209432 TTCTTTTTAAATATAGAAAGTGG + Intergenic
978823372 4:112991854-112991876 TTTTTTTCCACTATATAAAAAGG + Intronic
979077727 4:116295911-116295933 TTTTATAAGTATATATAAAATGG + Intergenic
979243602 4:118472686-118472708 TTCTTGTACAATATGTAAAATGG - Intergenic
979362421 4:119780423-119780445 TTCTTATACAAAAAATAAAAAGG + Intergenic
979537343 4:121838239-121838261 TTCTTTCAAAGTACATAAAAGGG + Intronic
979557500 4:122066298-122066320 ATTTTTAAAAATATATAAAATGG + Intergenic
979874882 4:125876042-125876064 TTCTTTGAGCATCTTTAAAATGG - Intergenic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
979907317 4:126311610-126311632 TTATTTTAAAATATATTATACGG - Intergenic
979978056 4:127221334-127221356 TTCTTCTAAAAAATAAAAAACGG + Intergenic
980045835 4:127987407-127987429 TTCTTATAAAATACATAAGAGGG + Intronic
980181324 4:129405027-129405049 TTCTTTAAAAATAAATAAAAAGG - Intergenic
980228978 4:130023762-130023784 TTCTTTTAAAATAGCAAAAAAGG - Intergenic
980247086 4:130260705-130260727 TCTTGTGAGAATATATAAAAAGG + Intergenic
980378841 4:131983984-131984006 TTCTTTCGGCATTTATAAAATGG - Intergenic
980468957 4:133225214-133225236 TTCTTTTGAAAAAAATAAAAGGG - Intergenic
980474971 4:133301823-133301845 TTATTTTAGAACATATCATAAGG + Intergenic
980491738 4:133536368-133536390 TTATTTTATAGTATATAAATGGG + Intergenic
980552002 4:134350114-134350136 TATCTTTATAATATATAAAATGG - Intergenic
980627058 4:135386807-135386829 TTAATTTTGTATATATAAAATGG - Intergenic
980632953 4:135461104-135461126 TTATTTTTGAATATAAAATATGG + Intergenic
980701706 4:136441404-136441426 TTATTTTGGAATTTAAAAAATGG - Intergenic
981468896 4:145106893-145106915 TGTTTTTATAATGTATAAAATGG + Intronic
981631325 4:146822115-146822137 TTCTTTTAAAAAAAAAAAAAAGG + Intronic
981665696 4:147223646-147223668 TTGTTTAAGGATAAATAAAACGG - Intergenic
981866199 4:149422442-149422464 TTCCTTCAGAAAATATACAAAGG + Intergenic
981945561 4:150339551-150339573 ATTTTTTAGAATATAGAAAGAGG + Intronic
982152285 4:152473485-152473507 ATCTTTTAAAATATATATACAGG - Intronic
982232195 4:153219565-153219587 TTATTTTAGAATTTTAAAAATGG + Intronic
982268777 4:153565420-153565442 TTATTTTAGAAATTATAGAATGG + Intronic
982556434 4:156872186-156872208 TTATATTAGCATATATTAAATGG - Intronic
982618096 4:157667489-157667511 ATCTTCTGGAATATAAAAAAAGG + Intergenic
982622297 4:157723632-157723654 ATCTTTGTGAATACATAAAATGG - Intergenic
982638931 4:157932609-157932631 TTTTTTTAAAATATTTTAAAGGG + Intergenic
982666202 4:158267206-158267228 CTCTTTTAGAATATAGAAGCAGG - Intergenic
982926321 4:161340952-161340974 TTCTTTTTTAATTTATAAATTGG + Intergenic
983032131 4:162815714-162815736 TAATCTTAGAATAAATAAAAGGG + Intergenic
983050660 4:163043202-163043224 TTCTATTTGTATATATCAAAAGG - Intergenic
983146663 4:164224552-164224574 TTCTTTTAGAATAGATTATTAGG - Intronic
983152213 4:164298499-164298521 ATTGTTTAAAATATATAAAAGGG - Intronic
983467238 4:168109822-168109844 TGCTTTTAAAATATATTTAAAGG - Intronic
983660277 4:170124776-170124798 TTATTTAACAATATATAGAAGGG - Intergenic
983775819 4:171606059-171606081 TTCTTCCAGAAGATAAAAAAAGG - Intergenic
983799628 4:171910644-171910666 TTCTTTCAAAATCTATAAAATGG - Intronic
983813559 4:172094993-172095015 TTTTTTTTGAAAACATAAAAGGG - Intronic
983845978 4:172518470-172518492 TTTTTTTAGAATTTAGAGAACGG + Intronic
983968010 4:173837221-173837243 CTCTTTTCCAATTTATAAAATGG - Intergenic
983986380 4:174065032-174065054 TTCTTGTGGAATGCATAAAATGG - Intergenic
983999306 4:174221527-174221549 TTCTTTTTAAATGAATAAAAGGG + Intergenic
984080302 4:175240218-175240240 TTCATTTATAATATATACATTGG + Intergenic
984147800 4:176085356-176085378 CTCTTTGAGAATATAGTAAAAGG - Intronic
984447850 4:179859534-179859556 TTCTTTTAGAATGTGAAAAATGG - Intergenic
984556560 4:181220835-181220857 TTTTTTTACAATGTAGAAAATGG - Intergenic
984571591 4:181401461-181401483 CTCTTTTATAAAAAATAAAAAGG - Intergenic
985174478 4:187186924-187186946 TTCTTGTAGTATCTAAAAAATGG - Intergenic
985248709 4:188001752-188001774 TACTTGTAGAATGAATAAAAAGG + Intronic
985349168 4:189039282-189039304 TGGTTTTTGAATATAGAAAAAGG + Intergenic
985585363 5:729627-729649 TTCTTTTAGGTTGTATTAAATGG + Intronic
985598875 5:813954-813976 TTCTTTTAGGTTGTATTAAATGG + Intronic
985813101 5:2105035-2105057 TTCTTTTTGAATGTACAAAATGG + Intergenic
985918277 5:2945140-2945162 TTCTTTTTAAATAAATAAAAGGG - Intergenic
985959381 5:3288361-3288383 CTCTTTTAGTATATAAAAGAAGG - Intergenic
986511638 5:8513378-8513400 TTTTTTTCAAGTATATAAAAAGG - Intergenic
986596826 5:9431245-9431267 TTTTTTTAGTACATATAAATTGG - Intronic
986675875 5:10184849-10184871 TTCTTTTAAAAAATAAACAATGG - Intergenic
986855605 5:11865199-11865221 TTGTTTTTGAATGTGTAAAATGG + Intronic
986874153 5:12085523-12085545 GTTTGTTAGAATATATAAAAGGG + Intergenic
986909913 5:12543169-12543191 TTTTTTTAAAACATATAAATCGG - Intergenic
986982352 5:13463431-13463453 TTCTTCTAAAAAATATCAAATGG + Intergenic
987196081 5:15527721-15527743 TGCTTTTAGGACATATTAAAAGG + Intronic
987554360 5:19428042-19428064 TTCTTCCAGAATATATAAAACGG - Intergenic
987726122 5:21701848-21701870 TTCTTTTAATATATATCAACGGG + Intergenic
987866568 5:23547838-23547860 TTCTTTTAGAATGCCAAAAAAGG + Intergenic
987891640 5:23886488-23886510 TTGTTGTAGAATCTACAAAAGGG + Intergenic
988071660 5:26297386-26297408 TTTTATTAAAATATGTAAAAGGG - Intergenic
988184501 5:27842627-27842649 TTCTTTGAGTATAGGTAAAATGG - Intergenic
988355154 5:30163683-30163705 TTCTTCAAGAAGATATAAAATGG - Intergenic
988661464 5:33274357-33274379 ATCTTTTAAAAGATAAAAAATGG + Intergenic
988901124 5:35733463-35733485 TTTATTTAGAATATCAAAAAAGG + Intronic
989089593 5:37716249-37716271 TTCTTTTAGCATGTAGAATAAGG + Intronic
989114275 5:37937233-37937255 TTCTTGTTGAAGATATATAAAGG + Intergenic
989171729 5:38477354-38477376 TTCTTCTAGAATAAATAAGATGG + Exonic
989326019 5:40195835-40195857 TTCTTTAAGAAAAGAGAAAATGG - Intergenic
989359728 5:40586987-40587009 TTGTTTAAGAATACATAAATAGG + Intergenic
989647478 5:43651065-43651087 TTCTTTTATAATTTATTATAGGG + Intronic
989720179 5:44518173-44518195 TTCTTACAGAAAAAATAAAAAGG - Intergenic
989840252 5:46056549-46056571 TTTTTTTAGAATCTGTGAAAGGG + Intergenic
990445598 5:55890973-55890995 TTCTATTTCAATATAGAAAAGGG - Intronic
990549078 5:56854562-56854584 TTCTTTTATCATAAATAATAGGG - Intronic
990754878 5:59057366-59057388 TTGTTTTCTAATTTATAAAATGG + Intronic
990834605 5:60003146-60003168 TTCTTTTAGATATTATTAAATGG - Intronic
990962232 5:61406466-61406488 TCCTTAAAGAATATATTAAAAGG + Intronic
990996283 5:61735238-61735260 TGATTTTATAAAATATAAAATGG - Intronic
991070306 5:62471143-62471165 TTTTTTTAAAATAAATGAAATGG + Intronic
991395506 5:66200495-66200517 TTCTTATACTATATATGAAATGG - Intergenic
991655563 5:68900870-68900892 TTTTTTTAAAAAAAATAAAAAGG + Intergenic
992358940 5:76016239-76016261 TTTTTTTAGAAAATTAAAAAAGG - Intergenic
992481118 5:77153254-77153276 TTGTTTTATAATTTAAAAAAAGG + Intergenic
992551962 5:77867706-77867728 TTCTGTTTAAATATATAAACAGG + Intronic
992664352 5:78991886-78991908 AACATTTAGAAGATATAAAAGGG - Intergenic
992866864 5:80966048-80966070 TTCTTGTAGAACAAATAAATAGG - Intronic
992963432 5:81977960-81977982 TTATTTTGGAAAATAAAAAAAGG - Intronic
993109698 5:83642004-83642026 TTCTTTTTAAAGCTATAAAAGGG - Intronic
994289497 5:98011729-98011751 TTCTTTGAGAATTTTTTAAAAGG - Intergenic
994315738 5:98331210-98331232 TTTTTTTAGAAGAAATAAAGAGG - Intergenic
994624621 5:102203003-102203025 TTCTTTCAGAAAATAAAAAAAGG + Intergenic
995166429 5:109048611-109048633 TTCATTTAAAAAATATAAACAGG - Intronic
995857518 5:116608860-116608882 TACTTTTAAAATATATGAATAGG - Intergenic
996409338 5:123140267-123140289 TTCTTTCAGAAAAAAAAAAAAGG + Intronic
996485781 5:124032455-124032477 TTCCTGTGGAATGTATAAAATGG - Intergenic
996663689 5:126033297-126033319 TTCTTATAGACCACATAAAATGG + Intergenic
996875590 5:128237066-128237088 TTCTTTTAGATTTTGTAAAGGGG + Intergenic
996893064 5:128446069-128446091 TTATTTTATAATATATGACACGG + Intronic
996903368 5:128569974-128569996 TTCTTTTTCAATATATAATGAGG - Intronic
996971447 5:129373790-129373812 TTCATCAACAATATATAAAAAGG + Intergenic
996985505 5:129557718-129557740 CTATTTTAGAAAATAGAAAATGG + Intronic
997002400 5:129777244-129777266 TTTTTTTAAAAAATTTAAAAAGG + Intergenic
997045454 5:130311338-130311360 TTCTTATACTATATATGAAATGG - Intergenic
997057582 5:130462496-130462518 TTCCTTTAAAATATAAGAAAAGG + Intergenic
997288331 5:132700826-132700848 GTATTTTAGAATTTATAAAAAGG - Intronic
997894800 5:137706680-137706702 TTCAATTAGAGTATATATAATGG + Intronic
997934062 5:138095511-138095533 TTATTTTAGAAGATAGAGAAAGG + Intergenic
998126229 5:139624130-139624152 TTCCTTTAGATTATGTCAAATGG - Intronic
998766204 5:145490383-145490405 TTATTTTAGAATTTATATTATGG + Intronic
998921955 5:147079066-147079088 TTCTTTTAGGTGACATAAAATGG + Intronic
999165262 5:149544219-149544241 CTCATTTAGAACATAAAAAAAGG - Intronic
999839887 5:155413536-155413558 TCCATTTAGGATATTTAAAAAGG + Intergenic
1000239780 5:159398680-159398702 TTTATTTAGAATATATCATATGG + Intergenic
1000559949 5:162774096-162774118 TTCTTCCAGAAAATATAAGAGGG - Intergenic
1000754294 5:165137407-165137429 TTCCTTGAGATTCTATAAAAGGG + Intergenic
1001182723 5:169535774-169535796 TTCTTTCAGAATATCTCCAAGGG + Intergenic
1001358512 5:171057324-171057346 AACATTTAAAATATATAAAATGG - Intronic
1001790888 5:174457108-174457130 TCTTTTTAGAAAATATATAATGG + Intergenic
1001926974 5:175644771-175644793 TTTTTTTAAAAAATAAAAAAAGG + Intergenic
1002782318 6:376799-376821 TTCAATTAAAATAGATAAAAAGG + Intergenic
1002855476 6:1034200-1034222 CTCTTTTAGAAAAAAAAAAAAGG - Intergenic
1003010749 6:2425023-2425045 TTCTTTTAGTATATTTCTAAGGG + Intergenic
1003639922 6:7868137-7868159 TTCTTTTAGAATCAAGACAAAGG + Intronic
1004172804 6:13310659-13310681 TTGTTTAAGAATATATACACAGG + Intronic
1004446083 6:15700065-15700087 TTCTTATTGAGTATATAGAAAGG + Intergenic
1004578763 6:16926643-16926665 TTATTTTAGAACTTTTAAAATGG - Intergenic
1004695229 6:18027041-18027063 TTGTTTCTGAATCTATAAAATGG - Intergenic
1005122137 6:22401641-22401663 GTCTTTTAGGATATAGACAATGG + Intergenic
1005877273 6:30020792-30020814 TTCCTTTAGAAAAAAAAAAAAGG + Intergenic
1006213984 6:32423049-32423071 TCCTTTAAGAATATAAAAAGAGG + Intergenic
1006878598 6:37319672-37319694 TTCTTTTAGACAAAATAGAATGG + Intronic
1008235503 6:49042550-49042572 TATTTTTTGAATATAAAAAATGG - Intergenic
1008947341 6:57112808-57112830 ATTTTGTAGAAAATATAAAATGG + Intronic
1009372747 6:62927989-62928011 ATCTTTTAGAATAAACAATATGG + Intergenic
1009386806 6:63094405-63094427 TTAGTTTAGAAGGTATAAAATGG - Intergenic
1009521913 6:64693956-64693978 ATCTTTTAAAAAATATAAGAAGG + Intronic
1009583864 6:65570904-65570926 TTCTTTTAGAATATAAACAAAGG - Intronic
1009657134 6:66561850-66561872 TTCTTTAAAAATACATAAATGGG + Intergenic
1010113837 6:72276261-72276283 TTGTTTTGGAATACATACAAAGG - Intronic
1010177781 6:73049874-73049896 TTCTTTTAGACTTTAGACAATGG - Intronic
1010275484 6:73963919-73963941 CTGTTTTAGAAAATATAAATAGG + Intergenic
1010319883 6:74494263-74494285 GTGTTTTAGAATTTGTAAAATGG + Intergenic
1010424766 6:75716006-75716028 TTATTTTAGAACAAATATAAAGG - Exonic
1010535281 6:77020313-77020335 TTATTGTAGAATATATGACATGG + Intergenic
1011149116 6:84249542-84249564 TTGTTTAAAAATATATAATAGGG + Intergenic
1011184210 6:84656544-84656566 TTCTTTTAGAATTTCTATATAGG - Intergenic
1011579643 6:88845985-88846007 TTTTTTTAGAACATAAAAGAGGG - Intronic
1011909261 6:92415136-92415158 TACTTTTAGTATATATTAAAAGG - Intergenic
1011918035 6:92534470-92534492 TTCTTTTACTACATATAAAATGG - Intergenic
1012331427 6:97994085-97994107 TTCCTTGAGAATATTTAATATGG + Intergenic
1012428867 6:99143085-99143107 TTCATTTAGAATATTAAAAGTGG + Intergenic
1012461537 6:99467616-99467638 TTCTTCTAGAAAAACTAAAAGGG + Intronic
1012529951 6:100223279-100223301 TTGTTTTTGAATATTTAAAATGG - Intergenic
1012668042 6:102002821-102002843 TTATTTATAAATATATAAAAAGG + Intronic
1012764165 6:103343338-103343360 TTCTTATAGAAAATATATATAGG + Intergenic
1012866899 6:104629044-104629066 TTAATTTAGAAGATATAAAATGG + Intergenic
1012997804 6:105991158-105991180 TTTGTTTTGAATATATAATATGG - Intergenic
1013004785 6:106062149-106062171 TTCTTTTAGGATATTTATAGAGG + Intergenic
1013640969 6:112080840-112080862 TTCTTCAAGAATTTATGAAACGG + Intronic
1013846542 6:114459632-114459654 TTTCTATAGAAAATATAAAAAGG - Intergenic
1013941505 6:115668622-115668644 TTCATTTAGAATTTCTAAGAAGG - Intergenic
1013961503 6:115906344-115906366 TTCTTTGAGAAATTATAACACGG - Intergenic
1014237883 6:118980472-118980494 ATATTTTAGAATATTTTAAATGG - Intronic
1014289835 6:119545558-119545580 TTCTTTAAGAAAATAAAAAAAGG - Intergenic
1014950268 6:127546235-127546257 TTCTTTTTCAATATCAAAAAAGG - Intronic
1014999212 6:128193400-128193422 TAGTTTTAAAATATATAAATCGG - Intronic
1015067725 6:129051598-129051620 TTCATATATAATATATTAAAAGG + Intronic
1015171794 6:130262435-130262457 TTCTGTTAGAAAAAAAAAAAAGG + Intronic
1015357544 6:132296752-132296774 TCCTTTTAAAAAATATAAAAGGG - Exonic
1016239320 6:141910010-141910032 TTCTGTTAGAAAGAATAAAAAGG + Intergenic
1016292954 6:142543480-142543502 TTCTTTTAAAATAAAAAACATGG - Intergenic
1016304172 6:142666113-142666135 TTCCTTTATAATTTATAAAGGGG + Intergenic
1016711350 6:147175868-147175890 TTCTTTTAGAGTAATAAAAATGG - Intergenic
1017511328 6:155117104-155117126 TTCTTTTAGAAATTATTCAAAGG - Intronic
1017548521 6:155478802-155478824 TGCTTTTAAAATATATTTAATGG - Intergenic
1017775130 6:157674696-157674718 TTCTTTTCTTTTATATAAAATGG - Exonic
1017931610 6:158960228-158960250 TTTTTTTCTAATTTATAAAAAGG + Intergenic
1018355161 6:163007162-163007184 TTTTTATACTATATATAAAATGG - Intronic
1018444011 6:163838486-163838508 TTCCTTTAGAAAAAAAAAAAAGG - Intergenic
1018499116 6:164383822-164383844 TTATTCTAAAATAAATAAAAAGG - Intergenic
1018836661 6:167489588-167489610 TTTATCTAGAATATATAAAGAGG - Intergenic
1019077842 6:169404501-169404523 TTGTTTATGAATAAATAAAAAGG - Intergenic
1019507309 7:1398650-1398672 CTCTTTTAGAATGTATAATTTGG - Intergenic
1020031409 7:4935463-4935485 TTTTTTTAGCATTTAAAAAATGG + Intronic
1020397913 7:7738095-7738117 TTTTTTTTGAATTGATAAAAGGG + Intronic
1020412916 7:7913032-7913054 TTCTATCAGAACACATAAAAAGG + Intronic
1021010689 7:15461318-15461340 TTTTTTTTGAAAATAGAAAAGGG - Intronic
1021040798 7:15859496-15859518 TTCTTTTGGGATCTATTAAAAGG - Intergenic
1021107179 7:16651402-16651424 TTCTGTGTGGATATATAAAAAGG - Intronic
1021184663 7:17549490-17549512 TTCTTTTAGAGTAATTAAAATGG - Intergenic
1021215873 7:17914568-17914590 TTCTTTAAGAATGCTTAAAATGG - Intronic
1021564330 7:22001850-22001872 TTCTTTTGAAATAGAAAAAAAGG + Intergenic
1021720563 7:23500618-23500640 TTTTTTTAAAAAATAAAAAAAGG + Intergenic
1022054370 7:26714288-26714310 TTTTTTTAATATATATAATAAGG - Intronic
1022717610 7:32912902-32912924 TTCTCTTACAGTATATAAAGTGG - Intergenic
1022868307 7:34446375-34446397 TTTTTTCAGAAGAAATAAAATGG + Intergenic
1023130849 7:37001596-37001618 TTCATTCTGAATAAATAAAAGGG + Intronic
1023182043 7:37494394-37494416 TTGTTTTAAAATATTTCAAATGG - Intergenic
1023222594 7:37934641-37934663 TTCTTTTAAAAAATTAAAAATGG + Intronic
1023342063 7:39231472-39231494 TTTTTTAATCATATATAAAAGGG - Intronic
1023577208 7:41641101-41641123 TTATCTGAGAATATAGAAAAAGG - Intergenic
1023777002 7:43617286-43617308 TTCTTTTGTATTATATAAATTGG - Intronic
1024135113 7:46398862-46398884 TTCATTTTGTATATATAGAAGGG - Intergenic
1024347467 7:48327564-48327586 TACTTTTTTAATCTATAAAATGG - Intronic
1024490063 7:49971327-49971349 TTCTTTGAGAAGATCAAAAAAGG + Intronic
1024532081 7:50401520-50401542 TTCTTTTTGAATCTCTCAAACGG + Exonic
1024881723 7:54093992-54094014 TTGTTTCAGAATGTAGAAAAAGG - Intergenic
1025533845 7:61923634-61923656 TTTTTTTAGAATCTGCAAAAGGG + Intergenic
1025545690 7:62164310-62164332 TTTTTTTAGAATCTGCAAAAGGG - Intergenic
1025572475 7:62593386-62593408 TTCTTGTAGAATCTGTAAAGGGG - Intergenic
1025618747 7:63148437-63148459 TTCTTTGAAAAAATAGAAAAAGG + Intergenic
1025761272 7:64396796-64396818 CACTTTTAGATTCTATAAAAAGG + Intergenic
1025771340 7:64510354-64510376 TTTTTTTAGGCTATTTAAAAAGG - Intergenic
1026462920 7:70630645-70630667 TTCTATCAGAATATATCCAAGGG + Intronic
1026533113 7:71217581-71217603 TTCTTTAAAAATAAATAAAAAGG - Intronic
1026728409 7:72890442-72890464 TTATTTTTGTATATATATAAAGG + Intronic
1026813784 7:73492741-73492763 TTCTTTAAGAAAATATCATAGGG - Intronic
1027115424 7:75475351-75475373 TTATTTTTGTATATATATAAAGG - Intronic
1027286550 7:76651045-76651067 TTATTTTTGTATATATATAAAGG - Intergenic
1027721651 7:81750088-81750110 TTCTTCTAAAATACATATAAGGG - Intronic
1027760887 7:82277501-82277523 TTGTTGTATAATATAAAAAAAGG - Intronic
1027801441 7:82756080-82756102 TTCTTTTAGAATAATATAAATGG - Exonic
1027827681 7:83136905-83136927 TTATTTTAGAATAATAAAAAAGG - Intronic
1027876897 7:83782275-83782297 TTTTTTTCAAATATATGAAAAGG + Intergenic
1027877003 7:83783588-83783610 TTCTTTTAAAAAATAATAAAGGG + Intergenic
1027943389 7:84714095-84714117 TTCTTTTAGAAAGTTTAAAATGG - Intergenic
1028072891 7:86474362-86474384 TTTTTTTAAAAAATATAAATAGG - Intergenic
1028174329 7:87635811-87635833 TTCATTTAAAATATTTAAAAAGG - Intronic
1028433438 7:90774538-90774560 TTCATTTTGAATATATTCAATGG + Intronic
1028448212 7:90949645-90949667 TTCTTTGAACATAAATAAAAAGG - Intronic
1028450099 7:90972412-90972434 TTCTTTTAGAATACAGAAAAAGG + Intronic
1028665144 7:93334220-93334242 TTCTTTTGGATTATATAAAATGG + Intronic
1028732813 7:94171741-94171763 TTCTATGAAAATATATAATATGG - Intergenic
1028819018 7:95184207-95184229 TTCTGTTTGATTATATTAAATGG - Intronic
1028995222 7:97092734-97092756 TTATTGGAGAATAGATAAAATGG + Intergenic
1030618895 7:111768434-111768456 TTCTTTTACAAAATATAATTGGG - Intronic
1031258489 7:119486037-119486059 TTCTCTTGGAATATAATAAAAGG + Intergenic
1031747941 7:125528358-125528380 TCATTTTAGAATCTATAAAGTGG + Intergenic
1031795833 7:126173699-126173721 TTATTTTTAAATATATAAATGGG - Intergenic
1031907591 7:127478108-127478130 TACTTGAAGAAGATATAAAAAGG + Intergenic
1031950007 7:127882251-127882273 TTTTTTTAACATATATAAAAGGG - Intronic
1032447882 7:132000244-132000266 CTCTTTTAGAATACGTAAAATGG + Intergenic
1032494275 7:132349150-132349172 TTTTTTTTAAATAAATAAAAGGG + Intronic
1032642479 7:133785283-133785305 TTTTTTTTTAATATTTAAAAGGG - Intronic
1032830251 7:135617474-135617496 TCCTGTTAGATTATATATAAAGG + Intronic
1033006053 7:137564566-137564588 TTCTTTTAAAAAAAACAAAATGG + Intronic
1033123026 7:138683196-138683218 TTATTTTAAAATAAATAATAGGG + Intronic
1033517753 7:142126416-142126438 TATTTTCAGAATATAGAAAAAGG - Intronic
1033943553 7:146685258-146685280 TTCTTTTACAAAAAATAAAGCGG - Intronic
1034229020 7:149505389-149505411 TCCAATTAGAATAAATAAAAAGG + Intergenic
1034727888 7:153357100-153357122 TATTTTTAGAATATATATACAGG + Intergenic
1034779533 7:153865594-153865616 TTCTTTGCCAATATATAAAGTGG + Intergenic
1034822406 7:154228663-154228685 TTTTTTAATAATATATATAAGGG + Intronic
1034914769 7:155027926-155027948 TTACTTTGGAATATATGAAATGG + Intergenic
1035112997 7:156499966-156499988 ATGTTTTAAAATATATATAATGG - Intergenic
1035849665 8:2904160-2904182 TTCATTTAAAATTAATAAAATGG - Intergenic
1037084943 8:14836977-14836999 TTCTTTGAGTATATATGAAAAGG - Intronic
1037285783 8:17298311-17298333 TTCTTTCAGAATATAAAATTTGG - Exonic
1037698390 8:21248750-21248772 TTCTTTCAGAAGAAAAAAAAGGG - Intergenic
1038950259 8:32406336-32406358 TTGTTTTATCATCTATAAAATGG + Intronic
1039364471 8:36915906-36915928 ATATTTTAAAATATTTAAAAAGG + Intronic
1039786223 8:40836632-40836654 TTGTTTTTGACTTTATAAAAAGG - Intronic
1040637241 8:49289569-49289591 CTCTTTTATAATATATAAATGGG + Intergenic
1041087021 8:54266272-54266294 TTCTATGAGAATAACTAAAAAGG + Intergenic
1041531005 8:58867282-58867304 TTCTTTTTTAATAAAAAAAAGGG + Intronic
1041837274 8:62230571-62230593 TTCTTTTCATATATAAAAAATGG - Intergenic
1041966084 8:63678713-63678735 CTCTTTCAGAAAATAGAAAAAGG - Intergenic
1042022566 8:64383880-64383902 TTTTTTTAGAATACATCAAATGG - Intergenic
1042037495 8:64551774-64551796 TTCTTTTAAAATATGAAATATGG - Intergenic
1042071440 8:64939781-64939803 TTTTTTTAGAATAGCTATAATGG + Intergenic
1042147607 8:65747035-65747057 TTCTTTTAAATTATATAAAGAGG + Intronic
1042327622 8:67545028-67545050 TTCTTTCTAAAAATATAAAATGG - Intronic
1042743830 8:72082518-72082540 TTCTTTTAGAACATCTAATAAGG + Intronic
1043527679 8:81113510-81113532 GTCTTCTTTAATATATAAAATGG - Intergenic
1043627857 8:82286243-82286265 TTCTCTGAGCATATATAAACCGG - Intergenic
1043699955 8:83273305-83273327 TTTTTTTGGAAAAGATAAAAGGG - Intergenic
1043710806 8:83416008-83416030 TTTTTTTTTAATATATATAAAGG - Intergenic
1043887355 8:85616948-85616970 TTTTAGTACAATATATAAAATGG - Intergenic
1043935364 8:86136535-86136557 ATCTTTTTGAAGAGATAAAAAGG + Intronic
1044101380 8:88144618-88144640 TTATTTTTACATATATAAAATGG - Intronic
1044136992 8:88598625-88598647 TTCCATTACAATATATAAGAAGG - Intergenic
1044187401 8:89270831-89270853 TTCTTTTAAAATAGTTATAACGG - Intergenic
1044667548 8:94646196-94646218 TTCTTTTCGAAGATCAAAAAAGG - Exonic
1044707443 8:95022671-95022693 TTCTTTTAACACATTTAAAATGG + Intronic
1044776993 8:95700365-95700387 TTCTTTTACAAAATATATTATGG - Intergenic
1044856486 8:96481411-96481433 TCCTTTTAGAAAATATAACTTGG + Intergenic
1044873131 8:96639761-96639783 TGCTTTCAAAATATATAATAGGG + Intergenic
1045123127 8:99060305-99060327 TTCTTTAAAAATACATAAATTGG + Intronic
1045807728 8:106184818-106184840 TTGTTTTGGAATATTTCAAATGG - Intergenic
1045909711 8:107392709-107392731 TTATTTTAGAATATTTTAATGGG + Intronic
1046181777 8:110658596-110658618 TTCTTTTTGGATAAACAAAATGG + Intergenic
1046254920 8:111683263-111683285 GTGTTTTAGCATATGTAAAAGGG + Intergenic
1046347969 8:112961455-112961477 TTCTTTTGTAAAATAGAAAATGG - Intronic
1046455171 8:114449894-114449916 TTTTTTAAGAATATTTGAAAAGG + Intergenic
1046621423 8:116532552-116532574 TTCTTTTTAAAAATGTAAAATGG - Intergenic
1046644812 8:116774817-116774839 TTTTTATAGAATATATTAAATGG - Intronic
1047059854 8:121213108-121213130 CTCCTTAAGAATATAAAAAACGG - Intergenic
1047134558 8:122061626-122061648 ATCTTTTGTAATCTATAAAAGGG - Intergenic
1047234728 8:123030371-123030393 TACTTTTTGCATCTATAAAATGG + Intronic
1047872280 8:129097431-129097453 TTCCTTTAGAATATCTAAGTAGG + Intergenic
1047915856 8:129583090-129583112 TGCTTTTAGAGTAAATAAAATGG + Intergenic
1048078232 8:131096698-131096720 CTCTTTTATTATATATAAAATGG - Intergenic
1048614928 8:136063524-136063546 TTCTTTGTGACTATAGAAAATGG - Intergenic
1049817079 8:144609709-144609731 CCATTTGAGAATATATAAAAAGG - Intergenic
1050399541 9:5236875-5236897 TTCTTCTAGTAAATATAAAATGG + Intergenic
1050466427 9:5929184-5929206 TACTTTTAGAATAAATCTAAGGG - Intronic
1050798188 9:9573279-9573301 TGCTTCTAGAATATAGAAAAAGG - Intronic
1050814985 9:9799124-9799146 TATTTTTAAAATATATAAATTGG - Intronic
1051083828 9:13323637-13323659 TTCTTTTATAATAAAAAAGATGG - Intergenic
1051160518 9:14202377-14202399 ATCTTTCAGAATAGATGAAAGGG + Intronic
1051978167 9:22980163-22980185 TTCATATAAAATATTTAAAAAGG + Intergenic
1052188992 9:25634685-25634707 TTTTTTTTAAATATTTAAAATGG - Intergenic
1052218504 9:25994380-25994402 TTCATTTAAAATATACTAAATGG + Intergenic
1052452134 9:28644663-28644685 TTCTTTTTAAATAAGTAAAAGGG + Intronic
1052544831 9:29863470-29863492 TTGTCTTAGAATATAGAAAAAGG + Intergenic
1052611432 9:30780129-30780151 ACTTTTTAAAATATATAAAATGG + Intergenic
1052689272 9:31795965-31795987 TCATTTTACAATATATACAAAGG - Intergenic
1053227176 9:36370269-36370291 TTTTATTATAATATTTAAAAAGG - Intronic
1054770185 9:69076223-69076245 TTTTTTTTTAATCTATAAAATGG + Intronic
1054900292 9:70361883-70361905 ATCTTTTAAAAGATACAAAAAGG - Intergenic
1055013887 9:71595541-71595563 CTCTTTTAGAAAATATGTAAGGG + Intergenic
1055127870 9:72739714-72739736 TTCCTTTAGAAAAAAGAAAAGGG - Intronic
1055136837 9:72839550-72839572 TTATTTAAAAATTTATAAAATGG + Intergenic
1055768915 9:79695084-79695106 TTCTATTACAATTTTTAAAAAGG + Intronic
1055842902 9:80527335-80527357 TTCTTTTAGAATGTTGAATATGG - Intergenic
1055978684 9:81978645-81978667 TCTTTTTATAATATATTAAATGG + Intergenic
1056202783 9:84292561-84292583 TTCTTTTAGTGTAGAGAAAATGG - Intronic
1056741533 9:89260014-89260036 TTTTTTTTGGATATATAACAAGG - Intergenic
1056889867 9:90481207-90481229 TGTTTTTATAAAATATAAAATGG - Intergenic
1057447818 9:95130407-95130429 CCCTTTTAGAAAAAATAAAAAGG + Intronic
1057984026 9:99691158-99691180 TAGTTTTAAAATATATAAAAGGG - Intergenic
1058073317 9:100623950-100623972 TTCTGGTAAAAGATATAAAAAGG + Intergenic
1058107503 9:100989417-100989439 TTCTTTGTGAAGGTATAAAAAGG - Intergenic
1058615770 9:106826054-106826076 TTCTTCTAAAATATATATAATGG - Intergenic
1058641653 9:107092524-107092546 CTCTTTTAGAAAATAGAAAGGGG + Intergenic
1058714587 9:107712369-107712391 ATCTTGTAAAATATATAAATTGG + Intergenic
1058725326 9:107797736-107797758 TTTTTTTAGAAAATATGGAATGG + Intergenic
1059038305 9:110784201-110784223 TTCTTTTAATACATATACAATGG + Intronic
1059042844 9:110832581-110832603 TTTATTTAGAATATATTGAATGG - Intergenic
1059056328 9:110984957-110984979 TTCTTTTTGATTCTTTAAAACGG - Intronic
1059126493 9:111691992-111692014 TTTTCTGAGAATTTATAAAACGG + Exonic
1059263431 9:113002704-113002726 TTCATTTAGAATATAGCACATGG - Intergenic
1059598600 9:115750861-115750883 TATTTTTAAAATAAATAAAAAGG + Intergenic
1059744969 9:117191365-117191387 TTCACTTTCAATATATAAAAGGG + Intronic
1059905045 9:118973750-118973772 TTTTTTAAAAAGATATAAAAAGG - Intergenic
1061751558 9:132781219-132781241 TTATTTCAGAACAAATAAAATGG - Intronic
1062515544 9:136933187-136933209 TTCTTTGAGAATACTTAAAGTGG + Intronic
1202798466 9_KI270719v1_random:149395-149417 TTCTTTAAGAATATGTCAGACGG + Intergenic
1185981981 X:4789987-4790009 TTATTTTAAAATATGTAAGATGG + Intergenic
1186582776 X:10838968-10838990 TTCTTTTGCAATATTTAATAAGG - Intergenic
1186733836 X:12440039-12440061 TTTTTTAAAAATCTATAAAATGG + Intronic
1186827390 X:13354096-13354118 TTATTTTAGAATTTATATTATGG + Intergenic
1187058866 X:15766780-15766802 TTCTTTTAAAATATATTTAGTGG + Intronic
1187108677 X:16272706-16272728 TTTTTTTACATCATATAAAAGGG + Intergenic
1187164053 X:16788006-16788028 TTCTTTTAGAATACAAAGAGAGG - Intronic
1187451429 X:19399962-19399984 TTCTTTCAGAAAATATCAAAGGG - Intronic
1187911072 X:24111634-24111656 TTCTTTTTGAGGAGATAAAAAGG - Intergenic
1187999167 X:24962878-24962900 TTAATTTTGAATATATATAATGG + Intronic
1188130720 X:26428482-26428504 TTATTCTAGATTATATAAAAAGG + Intergenic
1188333403 X:28898634-28898656 TTCTATTAGATTATAAAAATAGG - Intronic
1188350067 X:29118680-29118702 TTGTTCTAGACTATATAAACTGG - Intronic
1188447557 X:30272003-30272025 TTTTTTGAGAACATATAGAAGGG - Intergenic
1189158099 X:38780837-38780859 TAATTTTAGAAGATATAAAAAGG + Intergenic
1189436527 X:40997816-40997838 TTATTTTAAAAAATATACAAAGG + Intergenic
1189602159 X:42638733-42638755 TTGTTTTAGAATTTGTTAAATGG - Intergenic
1189646763 X:43141677-43141699 TTCTTCTAGTACAAATAAAATGG + Intergenic
1190000109 X:46677752-46677774 TTCTTTCAGAAAATAGAAGAGGG - Intronic
1190038226 X:47046874-47046896 TTGTTTTAAAATAACTAAAAGGG + Intronic
1190531166 X:51378071-51378093 TAGTTCTAGACTATATAAAAAGG - Intergenic
1190683576 X:52850950-52850972 TCCTTTGTGAATGTATAAAAGGG - Intergenic
1190690847 X:52911819-52911841 TTCTTTTAGACTATAGAGGAGGG + Intergenic
1190695136 X:52943973-52943995 TTCTTTTAGACTATAGAGGAGGG - Intronic
1190786249 X:53652065-53652087 TAGTTTTAAAATATATAAAAAGG + Intronic
1190951024 X:55142937-55142959 CTCATTTAAAATATATAACAGGG + Intronic
1191074923 X:56442494-56442516 TTTTTTTAGAAGAAATATAAAGG + Intergenic
1191238274 X:58154466-58154488 TGTTTTTAAAATATATAAAAGGG + Intergenic
1191239253 X:58168309-58168331 TTTTTGTAGAATCTACAAAAGGG + Intergenic
1191239426 X:58171180-58171202 TTTTTGTAGAATATACAAAGGGG + Intergenic
1191581670 X:62769231-62769253 TTCTTGTAGAATCTACAAAGGGG - Intergenic
1191584635 X:62809893-62809915 TTTTTTTAGAATCTATGAAGGGG - Intergenic
1192033460 X:67539726-67539748 TGCTATTAAAATATATTAAAAGG + Intergenic
1192751344 X:73995296-73995318 TTCTTTTAAGATATTTATAATGG - Intergenic
1193110516 X:77724950-77724972 ATATTTTTCAATATATAAAAAGG - Intronic
1193212533 X:78824132-78824154 TTATTTTAGAAAATATCAAATGG - Intergenic
1193419316 X:81264597-81264619 CTCTGTTAGAATATATATAGGGG + Intronic
1193880354 X:86913427-86913449 TTCTTTTTTAATATTTAAAGAGG - Intergenic
1194026727 X:88762288-88762310 ATTTTTTAGATTATATGAAATGG + Intergenic
1194050881 X:89067019-89067041 TTCTGTTGGAATAGCTAAAATGG - Intergenic
1194156400 X:90394384-90394406 TGCTTTTAAAATAGATGAAAGGG - Intergenic
1194244226 X:91491974-91491996 TTCTCATAGTATATACAAAATGG - Intergenic
1194524623 X:94964306-94964328 TTCTATTAGAATAATTAATAAGG - Intergenic
1194607176 X:95995059-95995081 TTTTTTCTGAATATATCAAAAGG + Intergenic
1194636730 X:96353809-96353831 TACCTATAGAATATATACAAAGG + Intergenic
1194639027 X:96380308-96380330 TTTATTTAGGAGATATAAAAAGG - Intergenic
1194874362 X:99168079-99168101 TTATTGTAGCAAATATAAAAGGG - Intergenic
1195324209 X:103744748-103744770 AACTTTCAGAAGATATAAAAAGG + Intergenic
1195624254 X:106991217-106991239 TTCTTTGAGAACGTATAACAGGG - Intronic
1195828998 X:109034908-109034930 TTCATTTAGAATTTAATAAATGG + Intergenic
1195898969 X:109777796-109777818 TTCTTTTAGAATAGAAAGGATGG + Intergenic
1196239207 X:113321277-113321299 TTCTTCTAGATTATCTAATATGG - Intergenic
1196538344 X:116874608-116874630 TTTTTTTTTAATTTATAAAAAGG - Intergenic
1196627342 X:117891441-117891463 TTGTTTTAGACTACTTAAAAAGG - Intergenic
1197170555 X:123429205-123429227 TTCTTATTGATTATTTAAAAAGG - Intronic
1197235422 X:124057070-124057092 TTCCTTTAGAAAATATTAAAAGG + Intronic
1197265345 X:124363365-124363387 TTCATTTATAATATATTATAGGG + Intronic
1197424278 X:126275857-126275879 TCTTTTTGGAATAGATAAAAAGG - Intergenic
1197456484 X:126682708-126682730 TTCTTCTAAAAAATAGAAAAAGG + Intergenic
1197743986 X:129918431-129918453 TTCTTTTAGAATATTTCTAGAGG - Intronic
1197744535 X:129922780-129922802 ATCATTTAGAATATATTATAGGG + Intronic
1197971741 X:132121583-132121605 TTTTTTTTTAATCTATAAAATGG - Intronic
1198591156 X:138183939-138183961 TTCCTTTAGAATTTATCAACAGG + Intergenic
1198786436 X:140293496-140293518 TTCTTTCAGAAAATAGAAGAGGG - Intergenic
1198834865 X:140794479-140794501 TTATTTTAAAATCTAGAAAAAGG - Intergenic
1198849251 X:140948009-140948031 AACTTTGAGAATATATAAGAGGG - Intergenic
1199072398 X:143493462-143493484 GTCTTTTAAATCATATAAAAAGG + Intergenic
1199118659 X:144024016-144024038 ATCTTTTTGAATACAAAAAAGGG + Intergenic
1199376501 X:147117093-147117115 TTCTTTTAGATTACATGGAAGGG + Intergenic
1199502630 X:148524911-148524933 TTCCTTTAGAACACTTAAAAGGG - Intronic
1199537681 X:148921633-148921655 TACATTTAGAATGTAGAAAAGGG - Intronic
1199750597 X:150813633-150813655 TTTTGTTAGAAAATATTAAAAGG - Intronic
1199835373 X:151585034-151585056 ATGTTTTAGGATATAGAAAATGG + Intronic
1199865972 X:151850476-151850498 TTCTTTTGGTATATATCCAAAGG + Intergenic
1200563207 Y:4733289-4733311 TTCTCATAGTATATACAAAATGG - Intergenic
1200731524 Y:6748099-6748121 TTCTTTTAAAGTATTTATAAAGG + Intergenic
1201320817 Y:12696634-12696656 TTATTTTAAATTAGATAAAATGG - Intergenic
1201722036 Y:17109630-17109652 TTCTTTTAAAAAATTTAAATTGG - Intergenic
1202327094 Y:23703234-23703256 TTCTTTTAAAATATGTCAAGAGG - Intergenic
1202543676 Y:25966818-25966840 TTCTTTTAAAATATGTCAAGAGG + Intergenic