ID: 1149939337

View in Genome Browser
Species Human (GRCh38)
Location 17:60846224-60846246
Sequence ATAAAGAAGTAGAATGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 9, 3: 54, 4: 591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149939337_1149939342 0 Left 1149939337 17:60846224-60846246 CCAGCCCCATTCTACTTCTTTAT 0: 1
1: 0
2: 9
3: 54
4: 591
Right 1149939342 17:60846247-60846269 CAGTTTTTTCAGTCAGGATCAGG 0: 1
1: 0
2: 1
3: 8
4: 219
1149939337_1149939341 -6 Left 1149939337 17:60846224-60846246 CCAGCCCCATTCTACTTCTTTAT 0: 1
1: 0
2: 9
3: 54
4: 591
Right 1149939341 17:60846241-60846263 CTTTATCAGTTTTTTCAGTCAGG 0: 1
1: 0
2: 1
3: 23
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149939337 Original CRISPR ATAAAGAAGTAGAATGGGGC TGG (reversed) Intronic
900808180 1:4781556-4781578 AGAAAGTGGTAGGATGGGGCGGG - Intronic
901572683 1:10174402-10174424 AAAAAGAAGAAGTATTGGGCTGG + Intronic
901897363 1:12325552-12325574 GTAGAGAAGTAGAAAGAGGCCGG - Intronic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
902682341 1:18052191-18052213 ACAAAGAAGAAGAAAGGGGGGGG - Intergenic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903274636 1:22212773-22212795 ATAAAGAATAATTATGGGGCTGG + Intergenic
903517672 1:23922933-23922955 ATAGAGAGTTAGAATGGGGCTGG - Intergenic
904166058 1:28556146-28556168 TTTAAAAAGTAGAAAGGGGCCGG - Intronic
904424234 1:30413310-30413332 ATAATGAAGAAGATTGGGGAGGG + Intergenic
904843505 1:33390076-33390098 TTTAAAAAGTAGAGTGGGGCTGG + Intronic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
905430621 1:37920366-37920388 ATACAAAAGAAGAATGTGGCCGG + Intronic
905454623 1:38079718-38079740 ATAAATAAATAAAAGGGGGCAGG - Intergenic
906177669 1:43789573-43789595 ATAAAGAAGTAGAATTGGCCAGG + Intronic
906435611 1:45793949-45793971 ATAAATAATTATAATGGGGAAGG + Intronic
907578924 1:55554551-55554573 CTAAAGAAGTCCACTGGGGCTGG + Intergenic
907632385 1:56095670-56095692 GAAAAGAAGCAGGATGGGGCAGG - Intergenic
908049398 1:60211231-60211253 AGAAAAAAGTAAAATGCGGCCGG - Intergenic
908152711 1:61320093-61320115 AAAAAGAAGTAGAATGGGAGTGG - Intronic
908200725 1:61792823-61792845 GTAAAGAAGTAAAATGGGTCAGG - Intronic
908463876 1:64372590-64372612 ATAAATAAGCAGAATGGGCTGGG + Intergenic
908756565 1:67474161-67474183 ATAAATAAGTAAAAGAGGGCCGG - Intergenic
908909474 1:69056393-69056415 TTGAAGAAGTAAAAAGGGGCCGG + Intergenic
909326280 1:74354486-74354508 AGAAAGAAGTACAAGGGGGGGGG + Intronic
910668992 1:89754126-89754148 ACAGAGAAGGAGAATGGGACAGG - Intronic
910921826 1:92356728-92356750 ATAAAAAAGGAAAATGGGCCAGG - Intronic
910983577 1:92982646-92982668 ATCAAGAAGTAACTTGGGGCCGG + Intergenic
911882546 1:103259628-103259650 ATGAATAAGTAGGAGGGGGCAGG + Intergenic
912469154 1:109894768-109894790 GTAAAGAAGGCGAATGTGGCTGG + Intergenic
913274767 1:117126181-117126203 ATAAAGAAGTAGAGAGGGATTGG - Intergenic
914245418 1:145882247-145882269 AAAAAGAAGTGGAAAGGGCCAGG - Intronic
915020220 1:152772053-152772075 AAAAATAAATAGAATGGGGGAGG - Intronic
915377842 1:155413308-155413330 ACAAAGAAGGAGCATGGGCCAGG + Intronic
915826704 1:159085677-159085699 ATCATGAAGGAGAAGGGGGCAGG + Intronic
916808545 1:168284129-168284151 ATGAAGTAGTAGAATGGGGGAGG - Intronic
917703450 1:177604768-177604790 ATAAAGAACTAGAATGAGTTGGG + Intergenic
918223230 1:182455283-182455305 ATAAAGAAATAGGAGGAGGCGGG + Intronic
918754662 1:188324231-188324253 ATAGTGAAGGAGATTGGGGCAGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919561547 1:199126169-199126191 ATAAAAAATTATAATCGGGCTGG + Intergenic
919831209 1:201541355-201541377 AAAAAGAAGTAGAGGGGGTCTGG - Intergenic
920393414 1:205625971-205625993 ATCAAGAAGTAGAACTGGGCCGG - Intronic
922248564 1:223825055-223825077 ATAAAGCAGAAGAATGGGCTAGG - Intronic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
923571256 1:235116837-235116859 TTAAAGAGTAAGAATGGGGCTGG + Intronic
923629004 1:235637354-235637376 TTAAAGAATTAGAATGAGGCTGG + Intronic
924225917 1:241921529-241921551 ATAAAGAAACAGCATGGGCCAGG + Intergenic
924303882 1:242667011-242667033 ATAAATAAATACAATGGGGTGGG - Intergenic
924683373 1:246260725-246260747 TTCAAGAAGGAAAATGGGGCTGG - Intronic
924843040 1:247734703-247734725 ATAATGAAGTCCTATGGGGCTGG + Intergenic
1062847568 10:719332-719354 TTAAAAAAATAGAATTGGGCCGG + Intergenic
1063585978 10:7352713-7352735 ATAAATAAGTACACTGGGGCCGG + Intronic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1064211101 10:13361141-13361163 ATATAGAAGTAGATAGAGGCTGG - Intergenic
1064358268 10:14639489-14639511 ATAAATAAGTGACATGGGGCTGG + Intronic
1064423108 10:15207116-15207138 AGAAAGCAGTACGATGGGGCCGG + Intergenic
1064508738 10:16065356-16065378 ATAGATAAATAAAATGGGGCTGG - Intergenic
1065049216 10:21773844-21773866 ATAAAGATGTATAAAGGGCCGGG + Intronic
1065369492 10:24969188-24969210 ATAAAGTAGTCAAATGTGGCCGG - Intergenic
1065707952 10:28488444-28488466 AAAAAGAAAAAGACTGGGGCTGG + Intergenic
1065891327 10:30123672-30123694 AAAAAGAAGTCACATGGGGCCGG - Intergenic
1065893371 10:30139705-30139727 ATAAAAATGCAGGATGGGGCTGG + Intergenic
1066118383 10:32260263-32260285 ATAAAAAAATAAAATGAGGCTGG - Intergenic
1066192228 10:33066588-33066610 CTAAAGATGTAGAAAGTGGCTGG - Intergenic
1066364179 10:34760625-34760647 TATTAGAAGTAGAATGGGGCTGG - Intronic
1066366803 10:34784731-34784753 TTAAAAAAGTATATTGGGGCCGG - Intronic
1066588223 10:36961707-36961729 ATAAGGAATAAGAAGGGGGCAGG + Intergenic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1067989577 10:51196086-51196108 GTCAAGAAGTAGAAAGGAGCAGG + Intronic
1068606968 10:59016229-59016251 ATAAGGATGAAGAATGGGGGTGG + Intergenic
1068672794 10:59741086-59741108 ATAAAGAAATAGGCTGGGACTGG - Intergenic
1069376805 10:67801121-67801143 ATAAAGAATTAGAATGTGGTGGG + Intronic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1073546882 10:104356939-104356961 ATAATGAAGAAGAATGGGTATGG - Intronic
1074146152 10:110718910-110718932 AAAAAGAAGTAGAATTAGGCTGG - Intronic
1076253468 10:129001021-129001043 ATAAAAATGTAGAATTGGACCGG + Intergenic
1077684387 11:4277364-4277386 AAAAACAAGTAAAATTGGGCCGG + Intergenic
1077685652 11:4289402-4289424 AAAAACAAGTAAAATTGGGCCGG - Intergenic
1077690806 11:4340564-4340586 AAAAACAAGTAAAATTGGGCCGG - Intergenic
1077998631 11:7475299-7475321 TTAAAGAAGTAGGCTAGGGCAGG - Intergenic
1078810193 11:14752811-14752833 AAAAAGATTAAGAATGGGGCAGG - Intronic
1079391395 11:20024838-20024860 AAAACTAAGTAGAATGGGACAGG - Intronic
1079687078 11:23372925-23372947 AGAAAGACATAGAATGGGCCTGG + Intergenic
1079923407 11:26460405-26460427 AAAAAGAAGAAGAAAGGGGGGGG + Intronic
1079946013 11:26741536-26741558 ATAAATAGGAAGAATGGGGATGG - Intergenic
1081613179 11:44575621-44575643 GTAAAGTAGTGGGATGGGGCAGG + Intronic
1083604620 11:63970756-63970778 ACAAAAAACTAGAATGGGGTGGG + Intergenic
1083623859 11:64061976-64061998 AGAAGCAAGTAGAAGGGGGCAGG - Intronic
1084994870 11:72966863-72966885 CTAAAGAAGTAGATTTGGACTGG + Intronic
1085106610 11:73849116-73849138 AAAAAGAATTAAAAAGGGGCTGG - Intronic
1085258889 11:75193092-75193114 AGAATTAAGTGGAATGGGGCGGG + Intronic
1085562195 11:77482282-77482304 ATAAAGAAGCAAAATAGGCCGGG - Intergenic
1085874926 11:80394926-80394948 ATAAAAATGGAGAAAGGGGCCGG + Intergenic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1085957193 11:81413846-81413868 ATACAGAGGTGGAATGGGGTGGG - Intergenic
1087895451 11:103580757-103580779 GTAAAGCAGGAAAATGGGGCAGG - Intergenic
1088242151 11:107783882-107783904 AGAAAGATGAAGAAAGGGGCCGG + Intergenic
1088671689 11:112147224-112147246 TTAAAGAAAAAGAATGTGGCTGG - Intronic
1089081236 11:115777761-115777783 TTAAAAAAGAAGAATGGGTCTGG - Intergenic
1089406525 11:118202344-118202366 AAAAAGACATAGAATGGAGCTGG + Intronic
1089468246 11:118700067-118700089 ATCAAGAAGTGGAATGTGGCCGG + Intergenic
1089921970 11:122217490-122217512 ATTAAGAAGTAGAAAAAGGCCGG - Intergenic
1090062520 11:123476394-123476416 TTAAAGAAGTTAAATGGGCCGGG - Intergenic
1090286618 11:125505168-125505190 AAAAAGAGGTAGAAAGGGCCAGG + Intergenic
1091507855 12:1091183-1091205 ATAAATAATAAAAATGGGGCTGG - Intronic
1091583737 12:1804383-1804405 ATTAGGAAGGAGAATGGGACAGG - Intronic
1091851681 12:3704606-3704628 ATAGAAAAGAAGAATGGGTCTGG + Intronic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092711603 12:11343667-11343689 ATAAAAAAGAAGAAAGTGGCTGG - Intergenic
1093300411 12:17446488-17446510 ATAAAGAAATAGGATGGAGGAGG - Intergenic
1093926346 12:24912216-24912238 ATAAAAAATTAGAAGAGGGCTGG + Intronic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1095643826 12:44518539-44518561 GTAAAGAATTTGAATGAGGCCGG - Intronic
1095801541 12:46274191-46274213 ATTAAGAAGTAGAAGTGGGCCGG + Intergenic
1096062570 12:48714201-48714223 CTAAAGAAGTAGATTAGGCCGGG - Intronic
1096130352 12:49154119-49154141 ATAAAAAAGTAGAGAGGGCCAGG - Intergenic
1096138047 12:49219194-49219216 TTAAAGAAGTAGAAATTGGCCGG + Intronic
1097041926 12:56161007-56161029 CTATAGCAGCAGAATGGGGCAGG - Intronic
1097300663 12:58015168-58015190 ATGAAGAAGTAGCAATGGGCTGG - Intergenic
1098233119 12:68393080-68393102 CTTAAGAAGTAAAATTGGGCAGG + Intergenic
1098833837 12:75396382-75396404 ATAAATAATTATAATGGGCCAGG - Intronic
1099976750 12:89553782-89553804 TTAAAGAACAAGAATGGGCCAGG + Intergenic
1100492598 12:95095716-95095738 ATACAGAAGTAAAATCGGCCAGG + Intronic
1100551472 12:95650125-95650147 ATAAGTAAGTAGACTGAGGCTGG + Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100732193 12:97483727-97483749 GAAAAGAAGTAGAATTGGGGAGG - Intergenic
1101100013 12:101382107-101382129 TTAAAAATGTAAAATGGGGCTGG + Intronic
1101903552 12:108809127-108809149 AAAAAGAAGTAAAATGGGCTAGG - Intronic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102085204 12:110131641-110131663 ATAAAGTAGTTGAATGGGCCAGG - Intronic
1104089683 12:125505400-125505422 ATAAAAAAGTTTACTGGGGCCGG + Intronic
1104213680 12:126714799-126714821 ATCAAGAAGTATTATGGGGCCGG - Intergenic
1104701460 12:130907608-130907630 TTTAAGAAATAGAATGGGCCGGG - Intergenic
1104838007 12:131804403-131804425 ATAAAGATGTGTATTGGGGCTGG - Intergenic
1107767536 13:43753154-43753176 ATATAGAAGTGCAATGAGGCCGG - Intronic
1107791791 13:44009719-44009741 ATAAAGAACTTGAATGAGGGTGG + Intergenic
1107828616 13:44353615-44353637 AGGAAGAAGTGGAATGGGACTGG + Intergenic
1108954918 13:56141076-56141098 AGAATGAACTAGAAAGGGGCAGG - Intergenic
1110536797 13:76659884-76659906 ATAATGAAAAAGAATGAGGCCGG + Intergenic
1110789509 13:79571966-79571988 AGAAAGAAATAAAATGGGGATGG - Intergenic
1110861241 13:80346718-80346740 ATTAAGAAGTATAATTAGGCCGG + Intergenic
1111467256 13:88630857-88630879 GCAAAGTTGTAGAATGGGGCTGG - Intergenic
1111502235 13:89136729-89136751 AAAAAAAAGTATAATTGGGCTGG - Intergenic
1111911413 13:94316420-94316442 ATAAAGAAACAGAATGGGCCGGG + Intronic
1112252036 13:97791007-97791029 TTAAAGTAATAGGATGGGGCTGG - Intergenic
1112428222 13:99324454-99324476 ATGAAGAAGTCAAATGGAGCAGG + Intronic
1114272326 14:21108813-21108835 ATAAAGAATAAGAGTGGGCCGGG - Intergenic
1115633051 14:35264551-35264573 ATTAAGACATAGAATGGGCCGGG - Intronic
1115941395 14:38614246-38614268 AAAAAGAACTAGAAAGGGGAGGG + Intergenic
1117463257 14:55967760-55967782 ATAAAGAACTTGGATGGTGCTGG + Intergenic
1118007106 14:61573274-61573296 ATAAAGAGGTAGGCAGGGGCTGG + Intronic
1118522334 14:66598548-66598570 ATAAAGAGGTGGAAAGAGGCTGG + Intronic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119672138 14:76527934-76527956 GTAAGGAAGTGGAATGGGGAAGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120433655 14:84452235-84452257 ATAAAAATGTAGTTTGGGGCCGG + Intergenic
1120620877 14:86763112-86763134 ATAAAGAAGCACATGGGGGCCGG + Intergenic
1120724062 14:87917704-87917726 ATAAAGAAGTATAATGAGAAAGG - Intronic
1120904853 14:89611508-89611530 ATAAAGAAAAATAATGAGGCCGG + Intronic
1120996070 14:90419613-90419635 AGGAAGAGGTAGAATGAGGCTGG + Intergenic
1121043223 14:90767519-90767541 AGAAAGAAGGAAAAGGGGGCTGG - Intronic
1121200615 14:92114116-92114138 ATAAAGAATTACAAGGAGGCTGG - Intergenic
1121290905 14:92774380-92774402 TTAAAAAGGAAGAATGGGGCCGG + Intergenic
1121724012 14:96132877-96132899 ATAAGGAGATAGAATGGGGCAGG + Intergenic
1121872194 14:97418705-97418727 TTAAATAAGTAGTATGCGGCCGG + Intergenic
1122571860 14:102709107-102709129 ATAGAGAAGTAGAAATGGCCAGG + Intronic
1123465694 15:20513370-20513392 ATATAGAAACAGAATAGGGCCGG - Intergenic
1123652422 15:22487668-22487690 ATATAGAAACAGAATAGGGCCGG + Intergenic
1123742844 15:23296529-23296551 ATATAGAAACAGAATAGGGCCGG + Intergenic
1124276418 15:28329347-28329369 ATATAGAAACAGAATAGGGCCGG - Intergenic
1124306284 15:28582260-28582282 ATATAGAAACAGAATAGGGCCGG + Intergenic
1124345241 15:28917922-28917944 AGAAAGGAGCAGAATGGGGCGGG - Intronic
1125618940 15:41041738-41041760 ATAAAGAACTAGAAGCCGGCTGG - Intronic
1125867347 15:43064864-43064886 ATAAAGATGTAAGATAGGGCCGG - Intronic
1126506955 15:49416153-49416175 ATAAACAAGTAGATTGGTGGGGG - Intronic
1128280838 15:66392956-66392978 ATAAATAAGTAAAATGTGGCAGG - Intronic
1128486511 15:68095824-68095846 ATGAAGAAAAAGAATGGGCCAGG - Intronic
1129148824 15:73673829-73673851 CTAAGGAAGCAGAAAGGGGCAGG - Intergenic
1129549963 15:76437985-76438007 ATAAAAAAGAAAAATGGGCCGGG + Intronic
1130435812 15:83898299-83898321 AAAAAGAAGAAGAATGGCGGGGG + Intronic
1130971872 15:88739966-88739988 ATAATGGAGAAGAATGGGGATGG + Intergenic
1131129973 15:89892373-89892395 TTAAATAAGTAAACTGGGGCCGG + Intronic
1131408104 15:92183275-92183297 AGACAGAAGTAGTATGGGGAGGG - Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1132022446 15:98374252-98374274 TTAAAAAAGTAAAAAGGGGCCGG + Intergenic
1133083174 16:3339750-3339772 ATATGAAAGTAAAATGGGGCCGG - Intergenic
1133106674 16:3515068-3515090 GTAAAGAAGCAAATTGGGGCTGG + Intronic
1133325197 16:4937679-4937701 ACAAAGAAGTAAACTGTGGCTGG - Intronic
1134232125 16:12437533-12437555 ATCAAGGGGCAGAATGGGGCTGG + Intronic
1134509817 16:14836999-14837021 TAAAATAAGTAAAATGGGGCCGG - Intronic
1134652993 16:15925586-15925608 ATAAATAAGAAGAAAGGGTCAGG + Intergenic
1134877608 16:17715825-17715847 ATTAAAAATTAAAATGGGGCCGG - Intergenic
1135354380 16:21757307-21757329 ACAAGGAAGGAGAGTGGGGCTGG - Intronic
1135452871 16:22573447-22573469 ACAAGGAAGGAGAGTGGGGCTGG - Intergenic
1135549497 16:23387280-23387302 AAAAAGAAGTAAAAGGTGGCTGG - Intergenic
1135662853 16:24311558-24311580 ATAAAGAAATTAAATGGGCCTGG + Intronic
1135705767 16:24673473-24673495 ATAAGGAAGTAGATTCTGGCAGG + Intergenic
1135920030 16:26641560-26641582 ATAATGCAGAAGAATGAGGCAGG - Intergenic
1136503782 16:30689348-30689370 GTAAATAAGTACAAAGGGGCCGG - Intergenic
1137354145 16:47743121-47743143 AAGAAGGAGAAGAATGGGGCTGG - Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1138245948 16:55467329-55467351 GGAAGGAAGTGGAATGGGGCAGG + Intronic
1138398280 16:56724829-56724851 ATAAAAAAATAGAAAGGGCCAGG - Intronic
1138621471 16:58214637-58214659 AAAAATAAGAATAATGGGGCTGG + Intergenic
1139453293 16:67049496-67049518 AAAAATAAACAGAATGGGGCCGG - Intronic
1139453374 16:67050496-67050518 ATAATAAAGTAGAACGTGGCCGG + Intronic
1139499831 16:67353670-67353692 ATCAAGAAATGGAAAGGGGCTGG - Intronic
1139625106 16:68181632-68181654 ATAAAAAAGTAAAATTAGGCTGG + Intronic
1140238567 16:73180956-73180978 TTAAAGAAGCACAATGGGCCAGG - Intergenic
1141310892 16:82912336-82912358 ATAAAGGTTTAGAATGGAGCAGG - Intronic
1141475964 16:84273676-84273698 ACAAAGAAGGTGATTGGGGCTGG + Intergenic
1142489344 17:267957-267979 ATCAAGAAATAAAATGGTGCTGG + Intronic
1142758591 17:2030030-2030052 ATAAAGGAGGAGATAGGGGCGGG - Intergenic
1143000479 17:3791728-3791750 ATAATGAATCAGAATGGGGCTGG + Intronic
1143654018 17:8282635-8282657 ATAAAGAACTTGACTGGGCCAGG - Intergenic
1143790159 17:9288364-9288386 ATAAAGAATTTCAATGGGCCGGG + Intronic
1143986197 17:10916503-10916525 ATAAAGAGGGAGAAAGGGCCTGG + Intergenic
1144870926 17:18370349-18370371 ACAAAGAAATGGAATGCGGCCGG + Intergenic
1145782747 17:27574024-27574046 ATAGAGATGTTTAATGGGGCTGG - Intronic
1146168362 17:30611562-30611584 TTAAAGAAGAAAAATGTGGCCGG + Intergenic
1146189258 17:30750460-30750482 GTACAGAAGTAAAATGGGGTGGG + Intergenic
1146334147 17:31954762-31954784 GTACAGAAGTAAAATGGGGTGGG + Intronic
1146421806 17:32693862-32693884 AGAAAAAAGGAGAGTGGGGCCGG + Intronic
1146520593 17:33522480-33522502 TCAAAGAACTAGAAAGGGGCAGG - Intronic
1147303204 17:39546089-39546111 ATAAAAAAGGAGGAAGGGGCCGG - Intronic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1147744114 17:42684627-42684649 AGAAAGAAGCAGAGGGGGGCCGG + Intronic
1147908727 17:43841623-43841645 ATAAAAAATTTGAAAGGGGCCGG + Intergenic
1148568847 17:48650564-48650586 ATTAAGAAGTAGTATTGGCCAGG + Intergenic
1148610069 17:48959148-48959170 AAAAATAAGTAAAATGAGGCCGG - Intronic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1149823930 17:59809290-59809312 AAAAAAAAGTTGAATGGGCCAGG - Intronic
1149892101 17:60399356-60399378 ATTTAAAACTAGAATGGGGCTGG + Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1149963765 17:61141259-61141281 ATAAAGAAGTTAAATTAGGCTGG + Intronic
1150769580 17:68029871-68029893 ATAACGAAGTAGAAGTGGGATGG - Intergenic
1150996910 17:70329225-70329247 ACAAAGAAAAAGAATGGGGAGGG + Intergenic
1151430497 17:74059325-74059347 ATAAAGAAAGGGAAGGGGGCTGG + Intergenic
1151914928 17:77110895-77110917 AAAAAGAAATACATTGGGGCTGG + Intronic
1152025364 17:77805435-77805457 CTAAAGGATTAAAATGGGGCCGG + Intergenic
1152092232 17:78253325-78253347 AAATAGATGTAGAAAGGGGCAGG - Intergenic
1152774469 17:82191962-82191984 ATAAAAAAGTAGAATTAGGTTGG - Intronic
1152969770 18:150256-150278 ATAAAGAAATTGAAGGGGGTGGG - Intergenic
1153164088 18:2242097-2242119 AAAAATTAGTAAAATGGGGCTGG - Intergenic
1154114178 18:11596763-11596785 ATAAAAAAATAGAAAGAGGCTGG + Intergenic
1154991426 18:21601206-21601228 GTAAAGAAGGAGGGTGGGGCCGG + Intergenic
1155243287 18:23883650-23883672 ATAAAGCTGCAGGATGGGGCGGG - Intronic
1157847286 18:51015767-51015789 ATAGAGAATTAGATTGGGGGAGG - Intronic
1158093045 18:53737693-53737715 ATAACGTAGAAAAATGGGGCAGG - Intergenic
1158460258 18:57640139-57640161 AAAAGGAAATACAATGGGGCGGG - Intergenic
1158742151 18:60155253-60155275 TTAAAGAAATAGAATTGGGATGG - Intergenic
1159758614 18:72396740-72396762 AAAAAAAAGTAAAATAGGGCAGG - Intergenic
1160896384 19:1404108-1404130 ACAAATAATTAAAATGGGGCCGG + Intergenic
1161435469 19:4260127-4260149 GTAAAAAAGTAGAAGGGGCCGGG + Intronic
1162404142 19:10463384-10463406 AAAAAAAAAAAGAATGGGGCTGG - Intronic
1164442080 19:28286547-28286569 AAAAAGAAAAAGAAAGGGGCAGG + Intergenic
1165035217 19:33028450-33028472 ATATAGAAATAGAATTGGCCAGG - Intronic
1165218175 19:34292155-34292177 ATAAAAAAGTAGATCTGGGCGGG - Intronic
1165337217 19:35179536-35179558 AACAAGAATTAGCATGGGGCTGG + Intergenic
1165362425 19:35345119-35345141 ATAAAAAGGTAGGATGGGGCTGG + Exonic
1165698993 19:37922830-37922852 ATAAAGAAGTAAAACACGGCTGG + Intronic
1165728189 19:38126830-38126852 ATTAAAAAGTAAAATTGGGCCGG - Intronic
1166056101 19:40289932-40289954 ATAAAAAATAAAAATGGGGCCGG - Intergenic
1166169989 19:41021325-41021347 AAAAAAAAGTAGAATAGGCCAGG - Intergenic
1166682148 19:44775596-44775618 ATAAATAAATAGATTGGGCCGGG - Intergenic
1167409996 19:49338956-49338978 ATAAACCTGTCGAATGGGGCGGG + Intronic
1167419668 19:49395504-49395526 AGACAGAAATAAAATGGGGCTGG + Intronic
1168047167 19:53802409-53802431 AAAAATAAATAGAATGCGGCCGG + Intronic
1168693216 19:58389880-58389902 ATAAATAATTAAAATGTGGCCGG - Intronic
1168723151 19:58565842-58565864 TTAAAGGAGAGGAATGGGGCTGG + Intronic
1168723204 19:58566149-58566171 AAAAAGAAGAGGAATGGGCCAGG + Intronic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925855379 2:8124231-8124253 ATAAAGAAGGGAAATGGGGCCGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927593009 2:24373049-24373071 TTAAAGAAACAGAATGGGCCGGG + Intergenic
927925669 2:27011912-27011934 ATAAAGAAGAAAACTGGGCCAGG + Intronic
928378241 2:30796490-30796512 ATAAAAATGTAGAATAGGACAGG - Intronic
928508991 2:31984021-31984043 ATAAATAAGTTGAGTGGGGGAGG + Intronic
928544533 2:32317071-32317093 ATAAAAAACTAGACTAGGGCGGG - Intergenic
928573467 2:32630872-32630894 ATGAAGAAGTAAAGTGGTGCAGG + Intronic
929071975 2:38039895-38039917 AAAAAGTAGTAGGAAGGGGCAGG - Intronic
929882949 2:45853156-45853178 ATAAGAAAGGAGAATGGGGAGGG - Intronic
930184990 2:48404462-48404484 GTATTGAAGTAGAATTGGGCCGG + Intergenic
930200574 2:48548794-48548816 ATAAAAAAGAAAAATGAGGCCGG - Intronic
930258320 2:49116903-49116925 AAACAGAAATAGAATGGGGTAGG - Intronic
930321440 2:49859153-49859175 CTAAGGAAGTTGAATGTGGCAGG + Intergenic
930581808 2:53220656-53220678 ATAAAGAGGAAGAAGGGGGTAGG + Intergenic
930695372 2:54406489-54406511 ATAAAGAAATAAAAAGGGGCCGG + Intergenic
931401006 2:61931383-61931405 ATAGACAAGTTGAATGGGTCTGG + Intronic
931526134 2:63156437-63156459 ATATAGAAATACAATTGGGCCGG + Intronic
933001773 2:76933903-76933925 ATATTGAAGTAAAATGGGGAAGG - Intronic
933301706 2:80547986-80548008 ATAAAAAAGCAGAAATGGGCTGG - Intronic
934987335 2:98897093-98897115 ATAAAGGAGCAGCATGGGGGAGG - Intronic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938754652 2:134368589-134368611 AGAATGAAGTAGAAAAGGGCAGG - Intronic
939337144 2:140844362-140844384 ATAAAAAATTAGAATTAGGCTGG - Intronic
940410267 2:153354713-153354735 ACACAGGAGTAGAATGGGACTGG - Intergenic
940708710 2:157135820-157135842 TTAAAAATGTAAAATGGGGCCGG - Intergenic
941915347 2:170809280-170809302 AACATGAAGTAGAATGGGCCAGG - Intergenic
942810201 2:179990577-179990599 AGAAAGAAGAAGGAGGGGGCAGG + Intronic
942922521 2:181393848-181393870 ATAGAAAATTAAAATGGGGCTGG + Intergenic
942958813 2:181805240-181805262 ATAAAGAAGAAGTATGGGCTTGG + Intergenic
943470307 2:188287468-188287490 AAAAAGTAGTAGTATGGGCCGGG + Intergenic
943534697 2:189133414-189133436 ATAAAGAAGTTGAATAGGCTGGG - Intronic
943966054 2:194334347-194334369 ATAAAAAAGTAAAATTGGCCGGG + Intergenic
944207532 2:197172296-197172318 ATTAAGAATAATAATGGGGCCGG - Intronic
944526683 2:200626727-200626749 ACAAAGAAGGAATATGGGGCTGG + Intronic
944757711 2:202781274-202781296 ATCAAGAAGTAGAACATGGCTGG + Intronic
945879383 2:215310938-215310960 ATTAAAAAGGAGGATGGGGCCGG + Intergenic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
946907171 2:224428634-224428656 ATAAAGAGAGAGAATGGGGCGGG - Intergenic
946947284 2:224833945-224833967 AGAAAAAAGTAGAGTGGGCCAGG - Intronic
947015145 2:225611067-225611089 AGAAAGGAAGAGAATGGGGCAGG + Intronic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947707422 2:232287686-232287708 ATTAAGAAGGAAAATGGGGCTGG - Intronic
948164667 2:235851700-235851722 AGAAAGAAGAAGAAGGGGACGGG + Intronic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1169129133 20:3154890-3154912 ATAAAGAAGTACAATTGGACAGG + Intronic
1169585839 20:7084306-7084328 AAAAAGAAGTATACAGGGGCAGG + Intergenic
1169825660 20:9765926-9765948 ATAACCAAGTAGAATGGGCTGGG + Intronic
1170235433 20:14098981-14099003 ATAAAAAAGCAGAACGTGGCTGG + Intronic
1170869681 20:20193908-20193930 AGAAATAATTAGAATGAGGCTGG - Intronic
1172133405 20:32671545-32671567 AAAAAATAGTAGAATGGGCCAGG + Intergenic
1172149955 20:32783220-32783242 TTAAAGAAATAAAATGGGCCAGG - Intronic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172586335 20:36087806-36087828 ATAAAAGAATAGACTGGGGCTGG - Intergenic
1173446467 20:43123148-43123170 ATAAAGAAATACCAGGGGGCCGG - Intronic
1173592286 20:44234194-44234216 ATAAAAAAGAACACTGGGGCAGG - Intergenic
1173784145 20:45780370-45780392 ATAAAGAGGTACAAAGGGCCAGG - Intronic
1173816344 20:45991446-45991468 ATCAAGAAGTAGGATGGGCCAGG + Intergenic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174259334 20:49282364-49282386 ATAAAAATGTAGATTGGGCCGGG - Intergenic
1174288958 20:49493555-49493577 ATAAATAAGAAGAGTGAGGCCGG - Intergenic
1174887122 20:54348290-54348312 ATAAAGAATTAAAATAGGCCAGG + Intergenic
1175569785 20:60010074-60010096 ACATAGCAGTAGACTGGGGCGGG + Intronic
1175858976 20:62139489-62139511 ACAAAGCAGTTGAAGGGGGCTGG - Intronic
1177153673 21:17480334-17480356 ATTAAAAAGTAAAATGTGGCTGG + Intergenic
1179488607 21:41726583-41726605 AGAAAGAAGAAGAAGGGGGGGGG - Intergenic
1180754005 22:18147684-18147706 ATAAAGAAGTACAAGGCGGGTGG - Intergenic
1181320575 22:22002688-22002710 ATAAATAAGTAACTTGGGGCTGG + Intergenic
1181735532 22:24878535-24878557 AAAAACAGGTAGACTGGGGCAGG - Intronic
1182658667 22:31909600-31909622 ATAAAAAATTAGCTTGGGGCCGG + Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182849357 22:33458722-33458744 ATAAAAAAGTAAAAATGGGCTGG - Intronic
1183436883 22:37801511-37801533 ATAAAGAAGTAAATTAGGCCAGG - Intergenic
1183567552 22:38626565-38626587 TCTAAGAAGTAAAATGGGGCCGG + Intronic
1183703085 22:39460809-39460831 ATAAATAAATAAAATGGGGGTGG + Intronic
1183985136 22:41565633-41565655 AAAAGGATGCAGAATGGGGCAGG - Intronic
1184142780 22:42588157-42588179 ACAAAAAAGTAAAATGGGGCCGG + Intronic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
1184605333 22:45570032-45570054 ACATAGAAGAAAAATGGGGCCGG + Intronic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
950232171 3:11285467-11285489 ATAAAGAAGTAAAATAGGGCTGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951697728 3:25463167-25463189 ATTAAGAAATTGAGTGGGGCTGG - Intronic
952157024 3:30654460-30654482 AGAAACAACTAGAATGGGGCTGG + Intronic
952238446 3:31505044-31505066 AAAAAAAATTAGAATGGGCCAGG - Intergenic
952405747 3:33003731-33003753 ATCAAGAAGTAGAATCTGTCTGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952739514 3:36722189-36722211 AAAATGAAGAAGTATGGGGCAGG + Intronic
953692863 3:45134418-45134440 AGAAAGAAGTAGATCTGGGCCGG - Intronic
953745237 3:45568936-45568958 ATAAATAAGTGGATTGGAGCTGG - Intronic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
955189055 3:56743397-56743419 ATAAAGAAGTTGAAGGGCACAGG + Intronic
955279372 3:57579582-57579604 AAAATGATGTAGGATGGGGCTGG - Intronic
955598754 3:60621443-60621465 ATTAAAAATTAGACTGGGGCTGG - Intronic
956077082 3:65517022-65517044 TTAAAGAGGTGGGATGGGGCCGG - Intronic
956136397 3:66103175-66103197 ATAAAGAAGTAAATGGGGGCTGG - Intergenic
957773406 3:84723255-84723277 TTCAAGAAGTAGAAAGGTGCAGG + Intergenic
957798628 3:85044968-85044990 ATATAGAAGTAGAGTGTGCCAGG - Intronic
957900833 3:86487611-86487633 TTAGAGATGTAGAAGGGGGCAGG - Intergenic
957947180 3:87079864-87079886 TTAAAGGAACAGAATGGGGCTGG + Intergenic
959538045 3:107509398-107509420 AAAAATAAGAAGAATAGGGCTGG - Intergenic
959743385 3:109747593-109747615 AGAAGGAAGTAGAATTGAGCTGG - Intergenic
960273978 3:115705989-115706011 ATAAGGAATCAGAATGGGGTAGG - Intronic
960720200 3:120618050-120618072 ATAAAAATGTAGATTGGGCCAGG - Intergenic
960869038 3:122230825-122230847 ACAGAGAAGTAGAAGGGGCCAGG - Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961555923 3:127696708-127696730 ATGAAGAAGCATCATGGGGCCGG - Intronic
961581547 3:127887454-127887476 ACAAAGAAGGAGGATGTGGCTGG + Intergenic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961697530 3:128716117-128716139 ATAAAATAATAAAATGGGGCAGG - Intergenic
962039035 3:131685485-131685507 ATTAAGAAGTAAAAGGAGGCTGG + Intronic
962207714 3:133448638-133448660 ATGAAGAGGTAGGAGGGGGCTGG + Exonic
962542989 3:136402155-136402177 ATCAATAAGTAGAATGCTGCAGG + Intronic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
964577067 3:158183064-158183086 GTAAAGAATTAGAAAGGGGAAGG - Intronic
964820623 3:160764761-160764783 ATAAAGAATTAAAATAGGCCAGG - Intronic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965190572 3:165522672-165522694 ATAAAGAAGTGGAATGGAAATGG + Intergenic
965289560 3:166861664-166861686 TTCAAGAAGTAGAATTTGGCTGG - Intergenic
966098451 3:176236298-176236320 ATGAAGAAGTAGAATGCAGTAGG + Intergenic
966153478 3:176891475-176891497 AGAAAGAGGTTTAATGGGGCCGG - Intergenic
966207663 3:177421473-177421495 AGGAAGAAGAGGAATGGGGCAGG + Intergenic
966248052 3:177830893-177830915 ATAAAGAAGCAGCATGGGAGTGG + Intergenic
966655444 3:182352335-182352357 AAAAAGAAGAACAATGGGGTCGG + Intergenic
967205365 3:187114664-187114686 ATAAAGAAGTGAAATGGGTCAGG + Intergenic
967481756 3:189980850-189980872 AAAAAGATTCAGAATGGGGCTGG + Intronic
967669899 3:192220309-192220331 ATAGGGAAGTAGAATGGTGAAGG - Intronic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
969009563 4:4050641-4050663 ATATAGAAGTTAAATGGGCCAGG - Intergenic
969236541 4:5869385-5869407 AGAAAGAAGTAAACTGGGCCAGG + Intronic
969744625 4:9060424-9060446 ATATAGAAGTTAAATGGGCCAGG + Intergenic
969928022 4:10603606-10603628 AGAAAGAGGCAGAATTGGGCAGG + Intronic
970417439 4:15873382-15873404 ATCAAGAATTAGAATGGGGCTGG + Intergenic
970664832 4:18324765-18324787 ATAAAGAAGAGGAATTGGGCAGG - Intergenic
971391268 4:26187723-26187745 ATAAATTAGTAGATGGGGGCTGG + Intronic
971391728 4:26192301-26192323 ATAAAGTTAAAGAATGGGGCTGG - Intronic
971641125 4:29134642-29134664 ATAAGGAAATAGAATGTGGAGGG + Intergenic
971788296 4:31134164-31134186 TAAAAGAAGTAGAATGGGCCAGG + Intronic
972508382 4:39743306-39743328 ATAAAAAAGAAGAATAGGCCAGG + Intronic
972517943 4:39826778-39826800 TTAAAAATGTAGAATGGGCCGGG - Intronic
972578067 4:40370321-40370343 ATTAAGAAGTAGAATAGGGCAGG + Intergenic
972596023 4:40530594-40530616 AAAAAGAAGAAAAATAGGGCTGG - Intronic
972628002 4:40819635-40819657 ATAAAGAATAAAAAAGGGGCAGG + Intronic
972687850 4:41368461-41368483 ATGAAGACAAAGAATGGGGCAGG + Intronic
972794811 4:42404910-42404932 AGAAAGAAAGAGAAGGGGGCTGG + Intergenic
974332442 4:60497989-60498011 ATAAAAGAGAATAATGGGGCAGG - Intergenic
975078671 4:70246964-70246986 GTAAAGAAGTAATATGAGGCCGG - Intronic
975317786 4:72975092-72975114 GTAAAGGAGTAGAATCTGGCAGG + Intergenic
975561968 4:75716808-75716830 ATAAAGAACTAGAAGAGGCCGGG - Intronic
975704570 4:77099135-77099157 ATAAAAAAATGGAATGTGGCTGG - Intergenic
975956514 4:79847064-79847086 TTAAAGAACTAGAATTGGCCAGG + Intergenic
975976100 4:80098387-80098409 ATAAAGAAATAGGATTTGGCTGG + Intronic
976196960 4:82542250-82542272 GTAAATAAATAGAATGGGCCAGG + Intronic
976241041 4:82956918-82956940 ATAAAGAAGTAGAAATGGCTGGG - Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976673595 4:87680600-87680622 ATAAAGAATTGGAATGCAGCAGG + Intergenic
976967914 4:91067638-91067660 TTAAAGAAGAAGGATGGGGTGGG - Intronic
978745446 4:112189088-112189110 ATAAAGAATTAGATTGGGCCGGG + Exonic
978964115 4:114721697-114721719 ATAAAGCAGAACAATGAGGCTGG + Intergenic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
979267705 4:118722471-118722493 ATAACAAAGTTGAATAGGGCAGG + Intergenic
979346325 4:119591817-119591839 AGAAGGAAGGAGAATGGGGAGGG + Intronic
979625244 4:122837275-122837297 AGAAAGGAGTAGAATGAGACTGG - Intronic
979809342 4:125016014-125016036 ATAAAGAAGTAGTATGGATTAGG - Intergenic
980535504 4:134115643-134115665 ATAAAGAAGTACAATTTGGCTGG + Intergenic
980651012 4:135714434-135714456 ATAAAGAAGGAAAATTAGGCTGG - Intergenic
981295887 4:143131149-143131171 ATAAATAAATACAATGGGCCAGG + Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984333774 4:178360873-178360895 ACAAAGAAGTTCAATGAGGCAGG - Intergenic
984467743 4:180122947-180122969 ATAAACAAGTAGGATGGGCCAGG + Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
985164279 4:187076031-187076053 ATAAAGAACATGATTGGGGCTGG + Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987607927 5:20162760-20162782 ATAAAGAAATAAAATTTGGCTGG + Intronic
987939957 5:24521246-24521268 TTAAAGAAGTAAAAGTGGGCCGG + Intronic
988292186 5:29301324-29301346 ATAAAGAAGACTAATCGGGCCGG - Intergenic
988944596 5:36183561-36183583 TTTAAGAAGTAGAATTTGGCTGG - Exonic
989126534 5:38058519-38058541 CAAAAGAAGTACAATGGGGCAGG + Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989626838 5:43437809-43437831 TTAAAGAAGCAGGATGGGTCTGG + Intergenic
990727097 5:58768076-58768098 AGCAAGAAGAGGAATGGGGCTGG + Intronic
990797905 5:59565173-59565195 AAAGAGAAGGAGAATGGGACAGG + Intronic
990817800 5:59805087-59805109 ATTAAGAAACAGAATGTGGCAGG - Intronic
990906384 5:60807701-60807723 ATAAAAGAATAAAATGGGGCCGG + Intronic
991475896 5:67019157-67019179 ATATACAAGAAGACTGGGGCGGG + Intronic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992006637 5:72484773-72484795 ATAAGGAAGTGTGATGGGGCTGG - Intronic
992253507 5:74898878-74898900 ATAAAGAAACAGAACAGGGCTGG - Intergenic
993072514 5:83183115-83183137 ATGATGAATTAGAATGGTGCTGG - Intronic
993425833 5:87763157-87763179 ATAAAGCAGTGGAAAGGGGGTGG - Intergenic
993922439 5:93823708-93823730 ATAAAGTAGTAGGCTGAGGCAGG + Intronic
993923229 5:93832744-93832766 AAAAAAAAGTAGAATTGGACAGG - Intronic
994076007 5:95650800-95650822 TTAAAGAAGTTGGATAGGGCCGG + Intronic
995133232 5:108652815-108652837 TAAAAGAAGTAGAATGGGTCAGG - Intergenic
996087576 5:119320659-119320681 AAAAAGAAAAAGAAGGGGGCCGG - Intronic
996442604 5:123509124-123509146 ACAATGAAGTAGAACGGGGAAGG - Intergenic
996545334 5:124671932-124671954 ATAAAGAAGCCCAAGGGGGCTGG - Intronic
996550526 5:124725509-124725531 AAAAATAATTAGAATGGGGGAGG - Intronic
996864275 5:128102296-128102318 ATCAAGAAATAGAATGTTGCTGG + Intronic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
997083293 5:130766065-130766087 CTAAAGAAATAGAATTGGCCGGG - Intergenic
997277259 5:132605337-132605359 CTAAAAGAGAAGAATGGGGCGGG - Intronic
997807831 5:136936989-136937011 ATAAAGAGCTAAAATGTGGCCGG + Intergenic
998660078 5:144226866-144226888 ATAAAGAAATAGATTTGGCCAGG - Intronic
998895172 5:146791152-146791174 AGTAAGGAGTAGAATGGTGCGGG + Intronic
999291184 5:150427597-150427619 ACCAAGAAGGAGAATGGGGAAGG - Intergenic
999546768 5:152637682-152637704 AAAAACAAGTACAAAGGGGCTGG + Intergenic
999794568 5:154977006-154977028 AGACAGAAGTAGAATGGTGGTGG - Intergenic
999825315 5:155268016-155268038 ATAAAGCAGTAGAAGGCTGCGGG + Intergenic
1000354782 5:160384012-160384034 ATAAAGAAGGAATATGGGGCTGG + Intergenic
1000550003 5:162649948-162649970 ATAAACATGTAGAATGCAGCAGG - Intergenic
1000917074 5:167095384-167095406 ATAAAGAAGGGGGATTGGGCTGG + Intergenic
1001561528 5:172672542-172672564 ATAAGGAAATAGAGTGGGGGGGG - Intronic
1002065810 5:176651123-176651145 TTAAAGGGGTAGGATGGGGCTGG + Intronic
1002308579 5:178298750-178298772 CTAAAGGAGCAGAATGGGCCAGG + Intronic
1002804248 6:557321-557343 TAAAAGAAGTAGAATTTGGCCGG + Intronic
1003700546 6:8459951-8459973 ATCAAGAAGTAGAAAGAGGCTGG - Intergenic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004542282 6:16562403-16562425 AGAAAGAAGGGGAATGGGGAAGG + Intronic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004765267 6:18719810-18719832 ATAAAGAGGAAGATTGGGCCCGG - Intergenic
1005870875 6:29974050-29974072 ATATAGAATTAGAAAGAGGCTGG + Intergenic
1006488579 6:34366077-34366099 AAAAGTAAGTAGAATGGGTCAGG + Intronic
1006627587 6:35408376-35408398 AGAAGGAAGGAGAATGGAGCTGG + Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007639548 6:43326896-43326918 AGAAAAAAGTTAAATGGGGCCGG + Intronic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1007930117 6:45683077-45683099 ATTAAGAATTACAATGGGCCAGG - Intergenic
1007942891 6:45798818-45798840 ATACGGAAGTAGATTTGGGCAGG - Intergenic
1008122140 6:47631148-47631170 ATAAAGAAATTAAATGGGCCAGG + Intergenic
1008624034 6:53300475-53300497 ATAAAGCAGAATAAAGGGGCTGG + Intronic
1009051379 6:58280722-58280744 AGAAAGAAGGAGAATTGGGAAGG + Intergenic
1009195236 6:60676860-60676882 TGAAAGTAGTAGAATGGGGTGGG + Intergenic
1011083680 6:83515776-83515798 ATTAAAAAGTAGAAAAGGGCCGG - Intronic
1011283793 6:85703483-85703505 ATAAACAAATAGAATGGGTAAGG - Intergenic
1012244470 6:96911340-96911362 CTCAGGAAGTAGAATGGGTCAGG - Intergenic
1012581479 6:100875248-100875270 TTAAAGAAGGAGAAAGGAGCAGG + Intronic
1012754382 6:103206196-103206218 ATAAAGAAGAAGTATAGGTCAGG - Intergenic
1013262916 6:108464088-108464110 ATCAACAAGTAGAATAGGGTTGG - Intronic
1013525262 6:110968283-110968305 AAAAATAAGTAAAATGAGGCCGG + Intergenic
1013627654 6:111953484-111953506 AAAAAAAAGTTGAAAGGGGCAGG - Intergenic
1014464642 6:121740396-121740418 ATAAAACATAAGAATGGGGCTGG + Intergenic
1014742576 6:125163424-125163446 ATAAAGAAGTAAATTGGGCATGG + Intronic
1014881081 6:126725400-126725422 ATAAAGGAGGAGAAAGGGGCAGG + Intergenic
1014892323 6:126857846-126857868 TTAAAAATGCAGAATGGGGCTGG - Intergenic
1015228906 6:130890968-130890990 ATTAAGCAGTAGAATTGTGCTGG - Intronic
1015258507 6:131207629-131207651 CTAAAGATGTAGTATGTGGCTGG - Intronic
1015314783 6:131806354-131806376 ATATAGTAGAAGATTGGGGCCGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015502246 6:133946448-133946470 ATAAAAAATTAAAATGGGGAAGG + Intergenic
1015884008 6:137897604-137897626 ATAAATAAATAAAATGGGCCAGG - Intergenic
1016500549 6:144715699-144715721 AGAAAGAAGTAGAAAAGGGTGGG - Intronic
1016779560 6:147943114-147943136 ATGAAGCAATAGAATGGGCCAGG - Intergenic
1016920734 6:149290455-149290477 CTAGTGAAGTAGAGTGGGGCAGG - Intronic
1017087531 6:150728296-150728318 ATAAAAAAGTAAAATGATGCCGG + Intronic
1017256868 6:152343453-152343475 AAAAAGAAAGAGAATGGGGCCGG - Intronic
1017455601 6:154598360-154598382 AGAAAGAAATATAATGGTGCTGG - Intergenic
1017827309 6:158091443-158091465 AAAAAAAAAAAGAATGGGGCTGG + Intronic
1017942556 6:159065919-159065941 ATTAAGAAGTTGAGTGGGGGTGG + Intergenic
1018699396 6:166414766-166414788 AAAATGAATTAGAATGCGGCTGG + Intronic
1020380667 7:7542051-7542073 ATAAAGAAAGAAGATGGGGCTGG + Intergenic
1020907417 7:14080628-14080650 TTAAACAAGTAGAATTGGCCAGG - Intergenic
1021129461 7:16893916-16893938 CTAATGAAGTGGAAAGGGGCAGG - Intergenic
1021225134 7:18017868-18017890 ATAAAGAAGTTCAGTGTGGCTGG - Intergenic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1021740132 7:23678768-23678790 TCATAGAGGTAGAATGGGGCTGG + Intergenic
1021750219 7:23791318-23791340 ATTAAGAAGTTGGATGGAGCTGG + Intronic
1022025457 7:26444101-26444123 ATAAAGAAGCAATAAGGGGCAGG - Intergenic
1022191996 7:28025522-28025544 ATAACATAGTAGAATGAGGCTGG - Intronic
1022252591 7:28623176-28623198 ATAAAGAAGTAGATGGGGACAGG - Intronic
1023018416 7:35987877-35987899 AGTAAGAAGTAGAATGAGCCAGG + Intergenic
1023446035 7:40232572-40232594 ATTAAGAAGAAAAATGGGGTAGG + Intronic
1023991046 7:45128905-45128927 ATAAAAAATTAAAATAGGGCTGG - Intergenic
1024531364 7:50395672-50395694 ATAAATAAGAAGAAAAGGGCAGG - Intronic
1025039128 7:55624346-55624368 ATAAAGAAGCAAGATGTGGCTGG - Intergenic
1025778621 7:64579714-64579736 TTAAATAAGTAGGATGGGGTGGG + Intergenic
1025901880 7:65751271-65751293 ATAAAGATGTAAGGTGGGGCTGG + Intergenic
1025975624 7:66367353-66367375 ATAAATAAGTATCAAGGGGCCGG - Intronic
1026154548 7:67815735-67815757 AAAAAGAAGAGGAAGGGGGCTGG + Intergenic
1026264685 7:68785875-68785897 AAAAAGAAGAAGGTTGGGGCCGG + Intergenic
1026891903 7:73987255-73987277 ATAAATAAGTAAAATGGGGCCGG - Intergenic
1026900933 7:74037127-74037149 AAAAAGAAATAGGAAGGGGCCGG - Intronic
1026901496 7:74039918-74039940 AGAAAGAAGGAGGATGGAGCTGG + Intronic
1026961269 7:74409275-74409297 AAAAAAAAATAGAATGGGCCGGG + Intergenic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1028271063 7:88790078-88790100 GAAAAGAATTAGAATGGTGCTGG + Intronic
1029068693 7:97877386-97877408 ATATAGAAGTTAAATGGGCCAGG - Intergenic
1029092872 7:98062071-98062093 CAAAAGAAGTAGAATCAGGCTGG - Intergenic
1029143483 7:98429007-98429029 TTAAAAAAATAGGATGGGGCCGG + Intergenic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029673931 7:102053104-102053126 AAAAAGACATATAATGGGGCCGG - Intronic
1030356109 7:108544229-108544251 ATAAAGAAGGACATTGGGCCAGG + Intronic
1030359138 7:108577152-108577174 ATCAAGAAGTAGAAAGCGGCTGG + Intergenic
1031375037 7:121014254-121014276 ATAAAGATGTAGAATTGGGCCGG + Intronic
1032252951 7:130273344-130273366 AGAAAGAAAAAGAAGGGGGCGGG - Intronic
1032462690 7:132123715-132123737 AAACAGAAGTGGGATGGGGCTGG + Exonic
1033274750 7:139963055-139963077 ATAAAGAAGTAGAATTTCCCGGG - Intronic
1033528707 7:142242658-142242680 ATAAAGATGTAGCATGCGGGTGG + Intergenic
1033888335 7:145976467-145976489 AAAAATTACTAGAATGGGGCCGG + Intergenic
1034333189 7:150301063-150301085 ATAAACACTTAGAATGGGGCTGG + Intronic
1034525533 7:151658189-151658211 ATAAATAAGAATAATAGGGCTGG + Intronic
1034664852 7:152808825-152808847 GTAAACACTTAGAATGGGGCTGG - Intronic
1035105855 7:156441066-156441088 ATGAAGCAGGAGAATGGGTCTGG - Intergenic
1036884409 8:12540766-12540788 ATATAGAAGTTAAATGGGCCAGG - Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037874132 8:22530535-22530557 ATAAAAAGGAAGAATGGGCCGGG + Intronic
1038721070 8:30035847-30035869 ATAAAGAAGTTGAGTAAGGCCGG + Intergenic
1039583495 8:38685988-38686010 ATAAAAAAGTAGGTGGGGGCTGG - Intergenic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1040469278 8:47723723-47723745 AAAAATAAGTATAATTGGGCTGG - Intronic
1040659688 8:49556915-49556937 ATAAAGAAATACAAGGAGGCTGG + Intergenic
1040915160 8:52561677-52561699 CTTAATAAGTAGCATGGGGCTGG - Intronic
1041594152 8:59626816-59626838 ATAAAGATGTATAACAGGGCTGG + Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1041654876 8:60338930-60338952 ATAAAGAAGTTGAATGAGTTTGG - Intergenic
1042396980 8:68304281-68304303 ATCCAGAAGTGGAATTGGGCTGG - Exonic
1042492643 8:69417486-69417508 ATTAAAAAGTAGACTGGGTCTGG - Intergenic
1042565311 8:70104696-70104718 ATAAATAAATAAAATGTGGCAGG - Intergenic
1042593187 8:70418099-70418121 ATTAAGAAGTAGAAATGGGAGGG - Intergenic
1042752315 8:72171276-72171298 TTAAAGAAACAGAATGGGCCTGG + Intergenic
1044041005 8:87368343-87368365 ATAAAAAAGTAGATTGGGCATGG + Intronic
1044134136 8:88563142-88563164 ATTAAGGAGTAAAATGGGGGAGG + Intergenic
1044143416 8:88683317-88683339 ATACAGAAATAGAATAGGGAAGG - Intergenic
1044374184 8:91449803-91449825 ATAAAGAAGATGAAAGGGCCGGG - Intergenic
1044704969 8:94999710-94999732 AAAAATAAATAGAATGGGCCCGG - Intronic
1044971973 8:97628639-97628661 ATAAAGAAATAGAATATGTCTGG + Intergenic
1044988445 8:97775225-97775247 AGATAGAAGTAGAAGCGGGCCGG + Exonic
1045028419 8:98111906-98111928 ATAAAGAAGAACAATGGTTCTGG - Intronic
1045421097 8:102015937-102015959 AAAAAGAAGAAGGGTGGGGCTGG + Intronic
1047598417 8:126402236-126402258 ATAAAGAAGGAAAAAGGGCCCGG + Intergenic
1048249573 8:132851325-132851347 ATAAATAATTAGAATGGAGGAGG + Intergenic
1049922110 9:374760-374782 TTAAAAAAGTAAAAAGGGGCCGG - Intronic
1050325729 9:4495641-4495663 ATCAAGGAGTAGAATGAGGGAGG + Intronic
1050344364 9:4671897-4671919 ATAATGATGCAGAGTGGGGCTGG - Intergenic
1050777445 9:9283672-9283694 AAAAAAAAGTTGACTGGGGCTGG + Intronic
1051031716 9:12688493-12688515 ATGAAGAGGTAGAAGGGGTCAGG + Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1052259652 9:26499272-26499294 AAAAAGAAGTAGAGTGAGGTTGG + Intergenic
1052713370 9:32085239-32085261 ATAAAGCAGAATAATTGGGCTGG - Intergenic
1053252943 9:36590214-36590236 ATATAAAACTAGAATGAGGCTGG - Intronic
1053551240 9:39081425-39081447 ATAGAGAATTGGAAGGGGGCTGG - Intronic
1053815351 9:41901522-41901544 ATAGAGAATTGGAAGGGGGCTGG - Intronic
1054615245 9:67285918-67285940 ATAGAGAATTGGAAGGGGGCTGG + Intergenic
1055309816 9:74967073-74967095 ATAAATAAGTAGCATGGGCTGGG + Intergenic
1055393496 9:75848680-75848702 TTAAAGAAGTAGAAATAGGCCGG + Intergenic
1055969979 9:81902231-81902253 CTAAAGAAGTCGTATGGGGATGG - Intergenic
1058579319 9:106437639-106437661 AGAAAGAAGAAGAAGGGGGGAGG - Intergenic
1059547019 9:115186995-115187017 ATTAAGAAGTACAGTGGGGGAGG - Intronic
1059625954 9:116066296-116066318 AGAAAGAAGCAGAATTGGGCAGG - Intergenic
1061111357 9:128573748-128573770 AAAAAAAAGTAGAAAAGGGCTGG - Intronic
1061186528 9:129057899-129057921 ATAAAGAAGAAAAATGGACCGGG - Intronic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1185714486 X:2330225-2330247 AAAAAAAAGTAGAAGGGGCCAGG + Intronic
1185808797 X:3085788-3085810 ATAAATATGTAGTTTGGGGCTGG + Intronic
1186291082 X:8099851-8099873 AAAAAGAAGAATAATTGGGCTGG + Intergenic
1186496022 X:10013936-10013958 TTAAAAAAGAAGAATGGGCCGGG - Intergenic
1186829642 X:13377938-13377960 ATAAAGAAGAATAAAGGGGTGGG - Intergenic
1186979476 X:14943953-14943975 TGAAAGAAGTTGAATGGGGGTGG - Intergenic
1187973820 X:24685670-24685692 AAAAAGAAATAGAACAGGGCTGG + Intergenic
1189070580 X:37859724-37859746 ATATAGATCTACAATGGGGCAGG + Intronic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190867614 X:54397876-54397898 ATAAAGAAGTAGATACAGGCTGG - Intergenic
1193896759 X:87123833-87123855 ATTGGGAAATAGAATGGGGCAGG + Intergenic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195992819 X:110699563-110699585 TTAAAGGAGTAGAAGTGGGCAGG - Intronic
1196777981 X:119358214-119358236 AAAAGGAAGAATAATGGGGCAGG + Intergenic
1196779558 X:119371170-119371192 ATAAAAAAAGAAAATGGGGCCGG - Intergenic
1197606796 X:128594574-128594596 ATAAAGAAGTAAAGAGAGGCCGG - Intergenic
1197993893 X:132351466-132351488 AGGAAGTAGTAGAATGGGACAGG + Intergenic
1198389027 X:136155060-136155082 AGAAAGAAATGAAATGGGGCAGG - Intronic
1198697663 X:139359921-139359943 ATAAAGAAGTAGAATTTTGGAGG + Intergenic
1199621573 X:149706075-149706097 ATGTAGAAGTAAAATGGGACTGG - Intronic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic
1202051362 Y:20784181-20784203 ATGAAGAAGTAAAATGGGACTGG + Intergenic