ID: 1149949355

View in Genome Browser
Species Human (GRCh38)
Location 17:60968732-60968754
Sequence GTTCAGCAGCACCATGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 4, 2: 14, 3: 37, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149949355_1149949359 16 Left 1149949355 17:60968732-60968754 CCTACTACATGGTGCTGCTGAAC 0: 1
1: 4
2: 14
3: 37
4: 165
Right 1149949359 17:60968771-60968793 TGTCTCCTTTGGCCAAGTAATGG 0: 1
1: 0
2: 2
3: 7
4: 168
1149949355_1149949358 5 Left 1149949355 17:60968732-60968754 CCTACTACATGGTGCTGCTGAAC 0: 1
1: 4
2: 14
3: 37
4: 165
Right 1149949358 17:60968760-60968782 CTCTAATTTGGTGTCTCCTTTGG 0: 2
1: 14
2: 36
3: 86
4: 214
1149949355_1149949356 -7 Left 1149949355 17:60968732-60968754 CCTACTACATGGTGCTGCTGAAC 0: 1
1: 4
2: 14
3: 37
4: 165
Right 1149949356 17:60968748-60968770 GCTGAACAGCCACTCTAATTTGG 0: 3
1: 28
2: 76
3: 63
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149949355 Original CRISPR GTTCAGCAGCACCATGTAGT AGG (reversed) Intronic