ID: 1149949355

View in Genome Browser
Species Human (GRCh38)
Location 17:60968732-60968754
Sequence GTTCAGCAGCACCATGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 4, 2: 14, 3: 37, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149949355_1149949358 5 Left 1149949355 17:60968732-60968754 CCTACTACATGGTGCTGCTGAAC 0: 1
1: 4
2: 14
3: 37
4: 165
Right 1149949358 17:60968760-60968782 CTCTAATTTGGTGTCTCCTTTGG 0: 2
1: 14
2: 36
3: 86
4: 214
1149949355_1149949359 16 Left 1149949355 17:60968732-60968754 CCTACTACATGGTGCTGCTGAAC 0: 1
1: 4
2: 14
3: 37
4: 165
Right 1149949359 17:60968771-60968793 TGTCTCCTTTGGCCAAGTAATGG 0: 1
1: 0
2: 2
3: 7
4: 168
1149949355_1149949356 -7 Left 1149949355 17:60968732-60968754 CCTACTACATGGTGCTGCTGAAC 0: 1
1: 4
2: 14
3: 37
4: 165
Right 1149949356 17:60968748-60968770 GCTGAACAGCCACTCTAATTTGG 0: 3
1: 28
2: 76
3: 63
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149949355 Original CRISPR GTTCAGCAGCACCATGTAGT AGG (reversed) Intronic
901799131 1:11697348-11697370 GATCAGCAGCTCCATGTTCTGGG + Intronic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
906035203 1:42746539-42746561 GAGCAGTAGCACCATGTAGAAGG + Exonic
906126211 1:43428421-43428443 CTTCAGCAGCAGCATGGAGGAGG + Exonic
909981561 1:82108009-82108031 GTGCAGCAGCTCAATGTAGGGGG - Intergenic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
912016288 1:105040679-105040701 ATTCGGCAGCACCATGTTGAAGG + Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
912996416 1:114536369-114536391 GGGCAGCAGCACCATGGAGGTGG + Intergenic
913097279 1:115530663-115530685 CTTCTGGAGCACCATCTAGTAGG + Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
916770594 1:167903947-167903969 GTTCAGCAGTGCCATGTACATGG - Exonic
919081528 1:192872138-192872160 CTTCAGGAGCAGCATGTAGGTGG - Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923121441 1:230995832-230995854 TTTCAGCAGCAAAATGAAGTTGG - Exonic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1068007249 10:51406170-51406192 GTTCTGCAGCAGCAGGCAGTGGG - Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1072054886 10:91745224-91745246 ATTCAACAGCACCATGCCGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1078361318 11:10670072-10670094 GATCAGCAGCACCTTGTTTTTGG + Intronic
1079755806 11:24259742-24259764 ATTCAGCAGCTCTGTGTAGTGGG + Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1083089348 11:60184151-60184173 GTTAAGAAGCACCATTTAGAAGG + Intronic
1083187485 11:61026172-61026194 GTTCACCAGAACCATGAAGAGGG - Intergenic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1088521299 11:110703788-110703810 TTTAAGCAGCACCCTGGAGTAGG + Intronic
1090683887 11:129094073-129094095 TTTCAAAATCACCATGTAGTGGG + Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093166088 12:15805508-15805530 AATCAGCAGCACCATGCAGCAGG + Intronic
1093819918 12:23601824-23601846 GCTCAGCAGTAAAATGTAGTGGG - Intronic
1094457708 12:30656683-30656705 GTTCTGCAGAAACATGTAATTGG - Exonic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095284447 12:40391486-40391508 GTTCATCTGCACTGTGTAGTTGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1095926424 12:47583988-47584010 GGGCAGTAGCACCATGTAGAAGG + Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1098138272 12:67425992-67426014 GATCAGCAAGACGATGTAGTTGG - Intergenic
1098487828 12:71041946-71041968 TCTCAGCATCACCATGTACTTGG - Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101792611 12:107941592-107941614 GTTCAGCTGCACCATGCAGAAGG + Intergenic
1103915685 12:124374492-124374514 GTGAGGCAGCACCAAGTAGTGGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1107793841 13:44030002-44030024 GCTGAGCAGCACCATGTGGTTGG + Intergenic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1110245248 13:73315963-73315985 GTTCAGCAGCACCAATTATCAGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119684258 14:76618514-76618536 GTTCTGCGGCATCATGTTGTAGG + Intergenic
1123065490 14:105616929-105616951 CTTCAGCAGCACCCTGTGCTGGG + Intergenic
1123069688 14:105636395-105636417 CTTCAGCAGCACCCTGTGCTGGG + Intergenic
1123094711 14:105761435-105761457 CTTCAGCAGCACCCTGTGCTGGG + Intergenic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1132397394 15:101483928-101483950 GTCCAGAAGCACCATGCGGTAGG + Intronic
1136417185 16:30111444-30111466 GGGCAGCAGCCCCAGGTAGTAGG + Exonic
1137534099 16:49304501-49304523 GTCTATCAGCACCATGTGGTTGG - Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139276023 16:65728351-65728373 GATCATTAGCACCTTGTAGTTGG - Intergenic
1141708066 16:85680307-85680329 ATTCAGCAGCGCCATTCAGTGGG + Intronic
1142282932 16:89158912-89158934 GATCAGACGCACCATGTAGGGGG - Intergenic
1142607921 17:1092119-1092141 GCTCAGCAGCAGCCTGTACTGGG + Intronic
1144065608 17:11621602-11621624 GTTCAGCATCACCATGTGCCAGG + Intronic
1144654193 17:17025039-17025061 TTTCAGCAGGACCATGTGGTTGG - Intergenic
1144853294 17:18254783-18254805 GTTCAGCACCAGCATGTTCTTGG + Exonic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149640087 17:58197123-58197145 GGCCAGCAGCCCCAGGTAGTTGG - Exonic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157813134 18:50711901-50711923 GATCACCAGTACCATGTTGTGGG + Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1161621382 19:5299115-5299137 GCACACCGGCACCATGTAGTGGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1164726507 19:30469072-30469094 GGTCAACAGCACCATGTTGCAGG - Intronic
1165097747 19:33418933-33418955 GGTCAGCATCACCGTGTAGCCGG + Intronic
1165360886 19:35336312-35336334 GTTCAGCTGCACCGTGTCATTGG - Exonic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
934875586 2:97916448-97916470 GCTCTGCAGCTCCTTGTAGTTGG - Intronic
935830197 2:106994192-106994214 CTTCAGCAGCTACAAGTAGTTGG + Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939579539 2:143931479-143931501 ATCCAGCAGCAACCTGTAGTGGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
942415256 2:175751998-175752020 TTTCAGCTGCACTATGTAGGAGG + Intergenic
942796886 2:179831712-179831734 GTTCAGCAGTAGCAAGTACTGGG + Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943802181 2:192074678-192074700 GGTCAACAGCAACATGTAGCTGG + Intronic
944277691 2:197858002-197858024 GTTCAACAGCCCCATGATGTAGG - Intronic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
947814151 2:233024601-233024623 GTTCAGCTGCCCCATCTGGTGGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1168780414 20:484402-484424 GCTCAGCAGCCACATGTGGTTGG - Intronic
1170658024 20:18308703-18308725 TTTAAGCAGCAGCATGTAGCTGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1172180633 20:33001327-33001349 GGTCAGCAGGTCCTTGTAGTGGG - Intronic
1176220251 20:63966194-63966216 GGTCAGCAGCACCATTTTGCAGG + Exonic
1176664922 21:9677543-9677565 ATTCCTCAGCACCATGCAGTTGG - Intergenic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1179730034 21:43362518-43362540 GCTCAGCAGCACCATCTGCTTGG + Intergenic
1180575980 22:16774916-16774938 GTGCAGCAGTACCATGAGGTAGG - Intergenic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
1181623862 22:24108815-24108837 CCTAAGCAGCACCATGTAGATGG - Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
959608109 3:108264067-108264089 GTTCAACAGCATCATGTAAGAGG + Intergenic
959846173 3:111036151-111036173 GTGCTGCAGCACCATGCAGAGGG - Intergenic
961812299 3:129528855-129528877 GATCAGCAGAAACATGTAGGCGG - Exonic
962247860 3:133812289-133812311 GTTCATCACCACCATCTTGTGGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963448665 3:145448527-145448549 GTTCTACAGCAACAGGTAGTCGG - Intergenic
963819267 3:149869996-149870018 ATTCAGTAGCACCATACAGTAGG - Intronic
964612206 3:158626975-158626997 GATCAGCTGCAACATGTTGTCGG - Intergenic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965841565 3:172911336-172911358 GCTGAGCAGCACCTTCTAGTGGG + Intronic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967167004 3:186790028-186790050 GTTCATCAGCACCATCTGCTAGG + Exonic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968480253 4:830111-830133 AGTCAGCAGCACCAGGTAGCCGG + Intergenic
968719086 4:2186380-2186402 GGTCAGTAGGACCATGTTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
973924039 4:55719008-55719030 GAGCAGCAGCCCCATGGAGTAGG + Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
985655555 5:1129785-1129807 GTTCAGAAGCACCTTGGAGCCGG + Intergenic
986923583 5:12717804-12717826 TTTCAGCTCCACCATGTGGTGGG - Intergenic
989228359 5:39056519-39056541 CTTCAGCACCCCCACGTAGTTGG - Intronic
991889599 5:71317222-71317244 GTCCAGCACCACCCTGAAGTAGG - Intergenic
992815943 5:80438260-80438282 GTTCAGCATCACTAATTAGTGGG - Exonic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
996217233 5:120884224-120884246 GTTCAGCAGTCACATGTGGTTGG - Intergenic
998274336 5:140737832-140737854 GTTCAGCAGCATAATGGAGGAGG + Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999660379 5:153856429-153856451 GTTCAGCAGCACCATGACACAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1002972688 6:2040298-2040320 GTTGATCAGCACCAGGTGGTGGG + Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1005887715 6:30109496-30109518 GTTCAGTAGCCACATGTGGTTGG - Intronic
1007253032 6:40509408-40509430 GGTCAGCAGCTCAATGTAGTGGG + Intronic
1007585726 6:42988071-42988093 GTAGAGCAGCTCCATGCAGTAGG - Intronic
1010428624 6:75753146-75753168 TTTCAGCAGTAGGATGTAGTTGG + Intronic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1014656112 6:124106203-124106225 CTTCACAAGCACTATGTAGTAGG - Intronic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1015736177 6:136402457-136402479 GTGCAGGAGCACCGTGTTGTGGG - Intronic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018177889 6:161194047-161194069 GTTCAGCAGCCTCATGTGGCTGG - Intronic
1018702388 6:166437192-166437214 GTTTAGGAGCACCAGGGAGTGGG + Intronic
1021593395 7:22289445-22289467 GTACAACAGCACTATGAAGTAGG - Intronic
1021738853 7:23665026-23665048 GTTCAGAAGCAAGATGGAGTGGG + Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1034594605 7:152177789-152177811 GTTCAGCAGCACAACATACTGGG - Exonic
1034595156 7:152182445-152182467 GTTCAGATACACCAAGTAGTGGG - Exonic
1037282772 8:17261814-17261836 ATTCAGCAGCTCCATGTTGTAGG - Intronic
1038347231 8:26743532-26743554 GTTTAGCAGCACCAGGTGGTTGG - Intergenic
1038751770 8:30302726-30302748 GTTCAGCAGCAGCATGGAGGAGG - Intergenic
1040764930 8:50897363-50897385 ATTCAGCAGTACCATGAAGGCGG + Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041569911 8:59326241-59326263 GTTCAGTAGCCCCCTGTGGTTGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1048019184 8:130522679-130522701 GATCAGCAAAACCATGTAGGAGG - Intergenic
1048739089 8:137534411-137534433 GTTCACCAGCACTATTTGGTAGG + Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050268752 9:3919074-3919096 GGTCAGCAGTACCATCCAGTTGG - Intronic
1050580705 9:7052769-7052791 GTGCAGCAGCACCACCTCGTGGG - Intronic
1050652170 9:7787299-7787321 GTCCAGCAGCATCATGGACTGGG - Intergenic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1052939225 9:34118847-34118869 CTTCAGCACCACCAAGTAGCTGG - Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1059375917 9:113881611-113881633 GTTCAGCAGCCACATGTGGCTGG + Intronic
1059584732 9:115593726-115593748 GTATATCAGCACCATCTAGTGGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1203661179 Un_KI270753v1:44206-44228 ATTCCTCAGCACCATGCAGTTGG + Intergenic
1185735121 X:2490258-2490280 CTTCAGCAGCACCTTGAAGGTGG + Exonic
1186085309 X:5983001-5983023 TTGCAGCATCACCATGTAATGGG + Intronic
1186858409 X:13647615-13647637 GTGCAGCAACTCCATGTACTAGG + Intergenic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1199719667 X:150533682-150533704 GGTCAGCACCAAAATGTAGTAGG + Intergenic