ID: 1149949355 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:60968732-60968754 |
Sequence | GTTCAGCAGCACCATGTAGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 221 | |||
Summary | {0: 1, 1: 4, 2: 14, 3: 37, 4: 165} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149949355_1149949359 | 16 | Left | 1149949355 | 17:60968732-60968754 | CCTACTACATGGTGCTGCTGAAC | 0: 1 1: 4 2: 14 3: 37 4: 165 |
||
Right | 1149949359 | 17:60968771-60968793 | TGTCTCCTTTGGCCAAGTAATGG | 0: 1 1: 0 2: 2 3: 7 4: 168 |
||||
1149949355_1149949358 | 5 | Left | 1149949355 | 17:60968732-60968754 | CCTACTACATGGTGCTGCTGAAC | 0: 1 1: 4 2: 14 3: 37 4: 165 |
||
Right | 1149949358 | 17:60968760-60968782 | CTCTAATTTGGTGTCTCCTTTGG | 0: 2 1: 14 2: 36 3: 86 4: 214 |
||||
1149949355_1149949356 | -7 | Left | 1149949355 | 17:60968732-60968754 | CCTACTACATGGTGCTGCTGAAC | 0: 1 1: 4 2: 14 3: 37 4: 165 |
||
Right | 1149949356 | 17:60968748-60968770 | GCTGAACAGCCACTCTAATTTGG | 0: 3 1: 28 2: 76 3: 63 4: 122 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149949355 | Original CRISPR | GTTCAGCAGCACCATGTAGT AGG (reversed) | Intronic | ||