ID: 1149951546

View in Genome Browser
Species Human (GRCh38)
Location 17:60993154-60993176
Sequence CGTGGAATACAAGATCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149951546 Original CRISPR CGTGGAATACAAGATCTATG AGG (reversed) Intronic
902446190 1:16466098-16466120 GGTGGAATACTAGATCTCTGGGG + Intergenic
906184964 1:43855131-43855153 AGTGGAATGTAAGATCTCTGAGG - Intronic
907595038 1:55712079-55712101 CGTGGATCACATGATCTATAAGG + Intergenic
907988180 1:59553430-59553452 CAAGGAATACGAGCTCTATGGGG + Intronic
908477517 1:64504764-64504786 GGTGGACTGCAAGTTCTATGAGG + Intronic
910659153 1:89652236-89652258 CATTGAAAACAGGATCTATGTGG + Intronic
911336908 1:96592271-96592293 AGTGGAATAAAAGTTTTATGAGG - Intergenic
917975409 1:180234791-180234813 CGTGGAAAACCAGAGCTAGGCGG + Intronic
918741731 1:188140340-188140362 CATGGAACACAAGTTCTATAGGG - Intergenic
924895752 1:248336674-248336696 TGTGGAAGACAAGATTTTTGGGG + Intergenic
1064686768 10:17869929-17869951 CGTGGAAGACAAGATTAATTTGG - Intronic
1067735654 10:48848326-48848348 CTTGGAATACAAGTTCTTAGTGG - Intronic
1068992872 10:63168586-63168608 CGTGAAATACAAGTTTTAGGAGG + Intronic
1072847150 10:98844154-98844176 AGTGGAGTACATGATCTCTGAGG + Intronic
1073411799 10:103348952-103348974 AATGGAACACAAGATGTATGGGG + Exonic
1076686995 10:132202648-132202670 CGTGGAGTACAACATCTTCGAGG + Exonic
1078381365 11:10844353-10844375 CAGGGAATGTAAGATCTATGAGG - Intronic
1085691707 11:78669573-78669595 CGTGCAATACAAGATGGATGAGG - Exonic
1085996376 11:81919733-81919755 TGTGGAATATAAGCTCAATGAGG + Intergenic
1086319860 11:85633875-85633897 ATTAGAATACAAGTTCTATGAGG + Intronic
1089949852 11:122515524-122515546 AGTGGTAAACAAGATGTATGAGG - Intergenic
1092581060 12:9842068-9842090 CTTGGAATACAAAATTTAAGAGG - Intronic
1093555698 12:20471026-20471048 CTTGAAATCCAAGATCTAGGTGG - Intronic
1099059236 12:77885042-77885064 CATGGAACACAACATCTATCAGG + Intronic
1106109192 13:26761620-26761642 CTTGGAACTTAAGATCTATGAGG - Intergenic
1106571672 13:30933322-30933344 TGTGAAATACAAAATCTCTGTGG - Intronic
1106779302 13:33041063-33041085 CGTGGAAAATAGGATCTAGGAGG - Intronic
1108325122 13:49323026-49323048 TTTGGAAAACAAGACCTATGTGG - Intronic
1112773759 13:102821826-102821848 CGGGGAATACAACACTTATGAGG + Exonic
1119914247 14:78382507-78382529 CTTGCAATGCTAGATCTATGTGG - Intronic
1121959587 14:98247117-98247139 GGTGGAACACAAGATGAATGCGG - Intergenic
1127737002 15:61850855-61850877 GGAGGCATACAAGCTCTATGTGG - Intergenic
1129263820 15:74383410-74383432 CTGGCAATACAAGATCTAGGAGG + Intergenic
1130693408 15:86105682-86105704 CTTTGAATACAACCTCTATGTGG + Intergenic
1131304144 15:91226383-91226405 TGAGGAAGACGAGATCTATGAGG + Exonic
1133080934 16:3319651-3319673 ACTGGAATACAAGTTCCATGAGG - Intergenic
1140840492 16:78833902-78833924 AGTGGAATATAAGTTCTTTGAGG + Intronic
1140961483 16:79917258-79917280 CTTGGAATATAAGTTCCATGTGG - Intergenic
1143990403 17:10954805-10954827 ACTGGATTATAAGATCTATGGGG + Intergenic
1144461370 17:15461181-15461203 CATGGAATTCAAGTTCTAAGAGG - Intronic
1149951546 17:60993154-60993176 CGTGGAATACAAGATCTATGAGG - Intronic
1150978850 17:70119518-70119540 CATGGAATGCAAGAGTTATGAGG - Intronic
1151121676 17:71799750-71799772 CATGGAATACAGTAGCTATGTGG + Intergenic
1155068187 18:22286862-22286884 CCTGGAATACAACCTCTAAGAGG - Intergenic
1159604295 18:70459009-70459031 CCTGGAATACAAGCCCCATGAGG + Intergenic
1164109174 19:22138319-22138341 AATGGAACACAAGATATATGGGG - Intergenic
928106900 2:28476437-28476459 TATGGAATACAAGTTCCATGAGG + Intronic
928410426 2:31050040-31050062 CATGGTATACAAGCTCTTTGTGG - Intronic
930567041 2:53033977-53033999 AGTGGAATACAAGTTCTTTGGGG + Intergenic
932133961 2:69212363-69212385 AGTGGAAAAGAAGATCCATGAGG + Intronic
933310344 2:80652592-80652614 TGGGGAATTCAAGACCTATGGGG + Intergenic
938703389 2:133898867-133898889 CGTGGCAGACAGGATATATGAGG + Intergenic
941440588 2:165530080-165530102 CATAGACTAGAAGATCTATGAGG + Intronic
942872889 2:180756940-180756962 CGGTGAACACAAGATATATGAGG + Intergenic
945012521 2:205480525-205480547 GGAGGAATACAAGATATATAAGG - Intronic
947139864 2:227010764-227010786 AGTGTAATGCAAGCTCTATGAGG - Intronic
1170526731 20:17246116-17246138 CCTGGATTGCAAGCTCTATGGGG - Intronic
1171216183 20:23354050-23354072 TGTGGATTTCAAGACCTATGTGG + Exonic
951622412 3:24617630-24617652 TGTGTAATACAAGGTCTAGGAGG - Intergenic
952181068 3:30917316-30917338 GGTGGAACACAAGATATTTGGGG - Intergenic
955536201 3:59926390-59926412 ATTGGAATATAAGCTCTATGGGG - Intronic
962387149 3:134940797-134940819 AGTGGAATATAAGGTCCATGCGG + Intronic
981063854 4:140460362-140460384 AGTGGAAGACATCATCTATGAGG - Intronic
982753071 4:159185559-159185581 AGTGGAATATATGATCTTTGGGG - Intronic
983812579 4:172081710-172081732 AGTGGAACACAAGATGAATGTGG + Intronic
984342293 4:178472436-178472458 CCTGTAATACAAGCTCTTTGGGG + Intergenic
984342458 4:178474852-178474874 CCTGTAATACAAGTTCTTTGGGG + Intergenic
985368868 4:189263772-189263794 CCTGGAATATAAGCTCTATGAGG - Intergenic
985820742 5:2158416-2158438 CATGGAATATAAGAACTGTGGGG - Intergenic
990748301 5:58983373-58983395 AGTGTAATACACGATCTATCAGG - Intronic
991410559 5:66341475-66341497 CTTGGAATACAAGCTGTATAAGG - Intergenic
993273809 5:85830541-85830563 GGTGGAATCCAAGATCTTTTTGG - Intergenic
995334126 5:110979122-110979144 AGTAGAATATAAAATCTATGAGG + Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
1001272858 5:170328626-170328648 ACTGGAATACAAAATGTATGGGG - Intergenic
1010161188 6:72857969-72857991 TGAGGAATGCAAGTTCTATGAGG - Intronic
1015978478 6:138815354-138815376 CGTGAAATTCAAGATATGTGTGG + Intronic
1026253819 7:68693582-68693604 CATGGAAGGCAAGATCTGTGAGG - Intergenic
1031659699 7:124406589-124406611 CCTGGAATACCAAATATATGAGG + Intergenic
1032797775 7:135291353-135291375 CCTTGAATGCAAGAACTATGGGG + Intergenic
1033723906 7:144091946-144091968 CTTGGAAGACAAAATCTAGGTGG - Intergenic
1041505823 8:58596625-58596647 CTTTGAATTCAAGATGTATGTGG + Intronic
1044226839 8:89729021-89729043 CATGGAATACATGATCATTGGGG - Intergenic
1045539741 8:103072121-103072143 CGTGGAACAAAAGATATTTGTGG + Exonic
1048136477 8:131751368-131751390 CATGGAATACAAGGTACATGTGG - Intergenic
1051048063 9:12899291-12899313 TGTGGAAAAAAAAATCTATGAGG - Intergenic
1052501093 9:29291427-29291449 AGGGGAATAAAAGATCTAGGAGG - Intergenic
1053116274 9:35506137-35506159 TGTGGGATACAAAATCAATGGGG + Intronic
1055073185 9:72188524-72188546 TGCAGAATGCAAGATCTATGGGG + Intronic
1057293585 9:93822504-93822526 CGTTGAATACCTGGTCTATGAGG + Intergenic
1058531163 9:105905724-105905746 CTTGGAACACAGGATCCATGGGG + Intergenic
1189169753 X:38897729-38897751 CCTGGAATACAATATGTGTGAGG - Intergenic
1189186236 X:39057837-39057859 AGTGGAATTCAAGCTCCATGAGG - Intergenic
1191915805 X:66200121-66200143 CGTGGAAAATGAGATCTATATGG + Intronic
1194694609 X:97030556-97030578 CGTGGGATACAAGCTATATTTGG + Intronic
1194967135 X:100301236-100301258 GGTGGAATAGAAGAGCTAAGAGG + Intronic
1196434003 X:115658494-115658516 CGTTGCATATAAGGTCTATGAGG - Intergenic
1199586180 X:149418985-149419007 TGTGCAATACAATGTCTATGAGG + Intergenic
1200127933 X:153825647-153825669 CGTGGAATAAAGGAACCATGTGG + Intronic