ID: 1149952866

View in Genome Browser
Species Human (GRCh38)
Location 17:61009834-61009856
Sequence CCCTCTGTGCAGAAGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149952866_1149952870 24 Left 1149952866 17:61009834-61009856 CCTGGCAGCTTCTGCACAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 347
Right 1149952870 17:61009881-61009903 AACTTTGCAGCCACATTACCTGG 0: 1
1: 0
2: 1
3: 14
4: 202
1149952866_1149952871 25 Left 1149952866 17:61009834-61009856 CCTGGCAGCTTCTGCACAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 347
Right 1149952871 17:61009882-61009904 ACTTTGCAGCCACATTACCTGGG 0: 1
1: 1
2: 6
3: 47
4: 322
1149952866_1149952869 -4 Left 1149952866 17:61009834-61009856 CCTGGCAGCTTCTGCACAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 347
Right 1149952869 17:61009853-61009875 AGGGTAAAGATAAAACAGAAGGG 0: 1
1: 0
2: 5
3: 58
4: 733
1149952866_1149952868 -5 Left 1149952866 17:61009834-61009856 CCTGGCAGCTTCTGCACAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 347
Right 1149952868 17:61009852-61009874 GAGGGTAAAGATAAAACAGAAGG 0: 1
1: 0
2: 2
3: 41
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149952866 Original CRISPR CCCTCTGTGCAGAAGCTGCC AGG (reversed) Intronic
900361185 1:2289837-2289859 CCCTCTGGGCAGCACCTGGCTGG + Intronic
900503060 1:3016097-3016119 CCCTCCCTGCAGCAGCTTCCAGG - Intergenic
900565463 1:3329758-3329780 CCCTCTCTCCAGAAGCCGCACGG - Intronic
901467231 1:9430134-9430156 TCCTCTGTGCAAAAACTACCAGG + Intergenic
902192391 1:14772947-14772969 TCAACTGCGCAGAAGCTGCCTGG - Intronic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
904405688 1:30286639-30286661 ACCTCGGTTCTGAAGCTGCCCGG + Intergenic
905064692 1:35170459-35170481 CCCTCTGACCTGGAGCTGCCTGG + Intergenic
905294097 1:36943181-36943203 CACCCTGTGCAGAGGCTACCAGG - Intronic
905897970 1:41561061-41561083 CTCTCTGAGCAGCAGCTCCCAGG + Intronic
906157951 1:43625185-43625207 CCCTCAGCGCAGAGCCTGCCTGG - Intergenic
906684745 1:47756130-47756152 TCCTCTGTTCTTAAGCTGCCTGG + Intergenic
906788124 1:48634097-48634119 CCCTATGTGTAGAAGAAGCCAGG + Intronic
907051220 1:51330747-51330769 CCCTCTGCGCAGACACCGCCCGG + Intronic
908514524 1:64878975-64878997 CCCTCAGTGCAGAGGGAGCCAGG + Intronic
909929645 1:81481470-81481492 CCCTCGGCGCAGAAGCTCCCAGG + Intronic
911052224 1:93681177-93681199 CCCTCTTCGCAGAAGCCGGCCGG - Intronic
912831161 1:112955616-112955638 CCCTTGGGGCAGAAGCGGCCAGG + Exonic
913071458 1:115302757-115302779 CCCTCTGTGCCGCAGCCACCAGG + Intronic
916973537 1:170049611-170049633 CCCTCTGGGACGAAGCTTCCAGG + Intronic
918832474 1:189415984-189416006 CCCTCTGAGACGAAGCTTCCAGG - Intergenic
918847039 1:189629154-189629176 GGCTCTGTGCAGCAGCAGCCTGG - Intergenic
919486918 1:198157309-198157331 CCCTCCCGGCAGGAGCTGCCCGG - Intronic
920271033 1:204763942-204763964 CCCGCTGAGCAGTGGCTGCCAGG + Intergenic
920298706 1:204975534-204975556 CCCCCTCTGCAGAAGCTCCTTGG - Intronic
920404345 1:205697661-205697683 CCCTCTTTGGAGCAGCTACCAGG - Intergenic
920410336 1:205754458-205754480 CACTCTTTGGAGATGCTGCCAGG + Intergenic
922732999 1:227961796-227961818 TCCTCTGTGCACACGCAGCCTGG - Intergenic
922985770 1:229865162-229865184 CCCTCTGTGCAGAATCTCACGGG + Intergenic
923125212 1:231028501-231028523 CTCTCCGAGCAGAAGCAGCCTGG + Intronic
923526895 1:234779479-234779501 CCCTGTAGGCAGAAGCTACCTGG - Intergenic
924883758 1:248189717-248189739 CCCTCTGGGACGAAGCTTCCAGG + Intergenic
1062916565 10:1244776-1244798 CCACCTGTGCAGAAGCTCCCTGG - Intronic
1063123903 10:3123838-3123860 CGCTCTGTGCAGGCTCTGCCTGG - Intronic
1063668488 10:8080916-8080938 AACTCTGAGCAGACGCTGCCTGG + Intergenic
1064264682 10:13816013-13816035 GGCTCTGAGCAGTAGCTGCCTGG + Intronic
1065888050 10:30096102-30096124 CAGTGTGTGGAGAAGCTGCCAGG + Intronic
1067187628 10:44043905-44043927 CCCTGTGTGGAGCAGGTGCCTGG - Intergenic
1067242828 10:44510610-44510632 CACTCTGCACTGAAGCTGCCTGG + Intergenic
1067438710 10:46296319-46296341 CTCTGTGTGCAGAATCTGCAAGG + Intronic
1067458017 10:46437307-46437329 GCCTCTTTGCAGAACCTCCCTGG - Intergenic
1067629180 10:47947327-47947349 GCCTCTTTGCAGAACCTCCCTGG + Intergenic
1067673378 10:48346847-48346869 CCCTCTCTGCCTCAGCTGCCAGG + Intronic
1068008863 10:51422498-51422520 CCCTGTGTGGAGGAGCTGCCTGG - Intronic
1070829548 10:79410009-79410031 CCCTCTGAGCTGGAGCTGTCAGG + Intronic
1072425207 10:95324281-95324303 CCCTCTGAGCATCAGCTTCCTGG - Intronic
1073323096 10:102627594-102627616 CGTTCTGTTCAGAATCTGCCAGG - Intronic
1074157352 10:110810486-110810508 CCCACTGCCCAGAACCTGCCTGG - Intronic
1074979462 10:118608198-118608220 CCCACTGTGCTGCAGCAGCCAGG - Intergenic
1075016094 10:118910871-118910893 CCCTCTGTATAGCAGTTGCCTGG - Intergenic
1075618243 10:123906947-123906969 CCAACTGCCCAGAAGCTGCCTGG + Intronic
1075683350 10:124347824-124347846 GCGTCTGTGCAGAAGCAGCACGG - Intergenic
1075732090 10:124642482-124642504 TCCCATCTGCAGAAGCTGCCCGG + Intronic
1075991088 10:126839476-126839498 CCCTCTGTTCAGAAGCCAGCTGG - Intergenic
1076413094 10:130265670-130265692 TCCTCTGGGGAGAAGCAGCCTGG + Intergenic
1076707696 10:132310624-132310646 CCCTGTGTGCCCATGCTGCCCGG + Intronic
1076799051 10:132812278-132812300 CCCCCTGTGCTGGAGCTGGCTGG + Intronic
1076919614 10:133444874-133444896 CCCTCTGTGGAGCATCAGCCAGG - Intergenic
1077211096 11:1371310-1371332 CCATCTGTGCACAGGCTCCCCGG + Intergenic
1077611570 11:3646147-3646169 CCCTCTGTGCCAAAACTGACTGG - Intronic
1079308876 11:19347071-19347093 CCCTCTCTCCAGTGGCTGCCGGG - Intergenic
1080586990 11:33691357-33691379 CCCTCTGTGCCAAAGCGGTCAGG - Intergenic
1081288661 11:41303879-41303901 CCCTCCGCCCAGCAGCTGCCCGG + Intronic
1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG + Intergenic
1083047922 11:59753539-59753561 CCCTCTGAGCAGAGGCAGACAGG + Intronic
1083467108 11:62855738-62855760 CCTTCTGTGTTGTAGCTGCCTGG - Intergenic
1084857064 11:71996149-71996171 GACTCTGTGCAAGAGCTGCCAGG - Intronic
1085277167 11:75307615-75307637 CCCTCTCCCCAGAAGCTCCCAGG + Intronic
1090664144 11:128903837-128903859 TCCGCTGTGCACAAGCTGCCCGG - Intronic
1091233649 11:134004506-134004528 ACATCTGTTCGGAAGCTGCCTGG + Intergenic
1091980643 12:4861241-4861263 TCCACTGTGCAGAAGGTGCCCGG - Intergenic
1091994493 12:4982562-4982584 CCGGCTTTTCAGAAGCTGCCTGG + Intergenic
1093135083 12:15440011-15440033 CCCTGTGTGCAGAGGCTACAGGG + Intronic
1094487891 12:30939326-30939348 ACCACTGTGCTGAAGCTGCAGGG + Intronic
1095410112 12:41912158-41912180 CCTTCTGTCCAGAGGCTGACTGG - Intergenic
1097089975 12:56497282-56497304 CCCTCTCTGCCTCAGCTGCCAGG + Intergenic
1097090532 12:56500988-56501010 CCCTCTCTGCCTCAGCTGCCAGG - Intergenic
1104067094 12:125315089-125315111 CCTTCTGTGCATAAGCTGCCTGG - Intronic
1105335113 13:19460073-19460095 CCCACTGTGCTGAAGATCCCCGG + Intronic
1105856364 13:24376090-24376112 CCCTCTCTGCCTCAGCTGCCAGG + Intergenic
1112442264 13:99433021-99433043 AGCCCTGTGCAGAAGCGGCCGGG + Intergenic
1113900638 13:113794917-113794939 CCTTCCGTGCAGAAGGCGCCTGG + Intronic
1113951894 13:114076645-114076667 CCCTCTCTGGAGAAGCTCGCCGG - Intronic
1118362886 14:65070715-65070737 CCCCTTGAGCAGAATCTGCCTGG - Intronic
1118726186 14:68630622-68630644 CCATCTGGGCAGGAGGTGCCAGG + Intronic
1119353683 14:73987885-73987907 ACCTTTGTGCAGAAAATGCCAGG - Exonic
1119539309 14:75428235-75428257 CCCACCGTGCAGAAGGTGCGGGG - Intronic
1121349404 14:93161530-93161552 GCATCTGTGCAGCACCTGCCAGG + Intergenic
1121742441 14:96263777-96263799 CACTCTGTGCAGCAGGTCCCAGG - Exonic
1121883728 14:97523758-97523780 CTCTCAATGCTGAAGCTGCCTGG - Intergenic
1122125489 14:99576405-99576427 CCCTGTGAGCAGCAGCTCCCGGG + Intronic
1122788996 14:104176544-104176566 CCCTGCCAGCAGAAGCTGCCTGG - Exonic
1122822169 14:104353212-104353234 CCCTCTGGGCCAGAGCTGCCCGG - Intergenic
1122924371 14:104892866-104892888 ACCTCTGGCCAGCAGCTGCCTGG + Intronic
1122987815 14:105220667-105220689 CAGGCTGTGCAGATGCTGCCTGG - Intronic
1202830977 14_GL000009v2_random:29785-29807 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1123995113 15:25713008-25713030 ACCTCTGGGCAGCAGCTGCTGGG - Intronic
1124220716 15:27847628-27847650 ACATCTGTGCAGAACCTGCCAGG - Intronic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1129069899 15:72942058-72942080 CCTGGTGTGGAGAAGCTGCCCGG + Intergenic
1129069902 15:72942076-72942098 CCCGGTGTGGAGAAGCTGCCTGG + Intergenic
1130313106 15:82771782-82771804 CCCTGTGTGCAGGAGGGGCCAGG - Intronic
1130321457 15:82846024-82846046 CCCTCTGTGCACAGTCTTCCTGG + Intronic
1131552750 15:93372188-93372210 CCATGTGGGCAGAAGCTGCTTGG + Intergenic
1132544351 16:526505-526527 CAGTCAGTGCAGAAGCTGGCAGG - Intergenic
1134303507 16:13012306-13012328 CCCTCTCTGCAGAAGTGACCTGG + Intronic
1134799263 16:17069564-17069586 CCCTCTCTGCAAAAGCTTCTAGG + Intergenic
1134900915 16:17937020-17937042 CCCCCTATGCAGAAACTGCACGG + Intergenic
1135687172 16:24507187-24507209 CTGTCTGTGCAGCAGATGCCTGG + Intergenic
1137671089 16:50279660-50279682 CCTTCTGTGCACCAGGTGCCAGG - Intronic
1139217753 16:65145708-65145730 ACTTCTGAGCAGAAGCAGCCTGG - Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1141915056 16:87090122-87090144 CCATCTGTCCAGAAGCAGCATGG - Intronic
1142379323 16:89722519-89722541 CGCTCTGTGCAGGAGCAGGCCGG + Exonic
1142384321 16:89753157-89753179 CCCTCTCTGCCTCAGCTGCCAGG + Intronic
1142390229 16:89794821-89794843 CCCACTGGGCAGACGATGCCTGG + Intronic
1142475476 17:186402-186424 CCCTCTGTGCAGCACTTGGCTGG + Intergenic
1142839077 17:2613269-2613291 GCCTCTGTGCTGAAGTGGCCAGG - Intronic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1143241517 17:5447007-5447029 CCCTCAGTGCGGACGCTGCTGGG - Intronic
1143995936 17:11006483-11006505 CCCTGTGGGCAGAGGCAGCCTGG + Intergenic
1144125560 17:12199392-12199414 CCCTCTGTGAAGATGCTTTCTGG - Intergenic
1144788321 17:17844055-17844077 CCGACAGTGCAGAAGCTCCCAGG + Intronic
1145732028 17:27198127-27198149 CCCTCTCTGCCTCAGCTGCCAGG + Intergenic
1146887986 17:36485202-36485224 TCCTCAGTGCTGAAGCTGCTGGG - Intergenic
1147403015 17:40192201-40192223 CAAACTCTGCAGAAGCTGCCAGG + Exonic
1148159300 17:45441113-45441135 CCCTTAGTGCAAAACCTGCCTGG + Intronic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1151545646 17:74791304-74791326 CCCTCACTGGAGTAGCTGCCTGG - Intronic
1151545669 17:74791400-74791422 CCCTCACTGGAGTAGCTGCCTGG - Intronic
1152568127 17:81109230-81109252 CCTTTTGAGCAGAAACTGCCAGG + Intronic
1152616075 17:81338497-81338519 CCCACTGTGCAGAGGCTGCTTGG - Intergenic
1152889603 17:82873015-82873037 CCGTCTGGGCAGCAGCTCCCAGG + Intronic
1153006811 18:504462-504484 CACTCTGTGCTGAAGGTGACAGG - Intergenic
1153471807 18:5454538-5454560 CCCTCTATGAATATGCTGCCTGG - Intronic
1153674357 18:7443004-7443026 CCCACTGGGCAGATGCTGGCTGG + Intergenic
1154130935 18:11736545-11736567 CCCTGTTTGCAGAAGGTGCTTGG + Intronic
1154419683 18:14215825-14215847 TCCTCTGTTCAGGTGCTGCCTGG - Intergenic
1155839847 18:30631187-30631209 CCATCTCAGAAGAAGCTGCCAGG - Intergenic
1157028527 18:43876496-43876518 CCAACTCTGGAGAAGCTGCCAGG + Intergenic
1157158258 18:45288505-45288527 ACCTCTATCCAGAAGCTGCCAGG - Intronic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1157498016 18:48170372-48170394 CCTTCTCTGGAGAGGCTGCCAGG - Intronic
1158488314 18:57888058-57888080 TCCTCTGGGAAGAAGCTGCCAGG + Intergenic
1159883794 18:73885120-73885142 CCCATTGTGCAGAAGCTGGCTGG + Intergenic
1160173498 18:76573423-76573445 GCCACTGTGCAGAAGTGGCCTGG + Intergenic
1160717189 19:581759-581781 CCCACTGAGCCGCAGCTGCCCGG - Intronic
1161089017 19:2351132-2351154 CCCGCTGTCCTGCAGCTGCCCGG + Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1164083473 19:21880533-21880555 CCCTCTCTGCCTCAGCTGCCAGG - Intergenic
1164084627 19:21889803-21889825 CCCTCTCTGCCTCAGCTGCCAGG - Intergenic
1164261566 19:23572396-23572418 CCCTCTCTGCCTCAGCTGCCAGG + Intronic
1164265233 19:23609943-23609965 CCCTGTGGGAAGAAGCTTCCAGG - Intronic
1165287910 19:34858145-34858167 CCCTCTGAGATGAAGCTTCCAGG + Intergenic
1165705135 19:37970580-37970602 CCCTCTGCACAGAAGCTGAACGG - Intronic
1165982733 19:39738299-39738321 TCCACTGTGCAGAATCTACCAGG + Intergenic
1202641719 1_KI270706v1_random:97988-98010 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
925435068 2:3829980-3830002 CCCTCTGTGAAGAAGCCGTCAGG + Intronic
925761379 2:7187941-7187963 CACCATGTGCAGAAGGTGCCTGG + Intergenic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
927813185 2:26191751-26191773 CCCTCAGAGAAGATGCTGCCTGG + Intronic
928215284 2:29356127-29356149 CCCTCTGTCCTGATGCAGCCTGG + Intronic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
928381291 2:30821110-30821132 CCCTCTCTTCATATGCTGCCAGG + Intergenic
929367058 2:41171615-41171637 TCCGCTGTGAAGATGCTGCCAGG - Intergenic
930240695 2:48932948-48932970 TCCTCTGCTCAGAAACTGCCAGG - Intergenic
931224882 2:60321016-60321038 CCCTGTGTGCTGCTGCTGCCTGG - Intergenic
932079132 2:68695371-68695393 CCCACTGTCCAGATGCAGCCAGG - Intronic
932328900 2:70886028-70886050 TCCTCTGTGCAGAAGTAGCATGG - Intergenic
932718955 2:74124091-74124113 CCCTCCGCCCAGCAGCTGCCCGG + Intergenic
934497546 2:94821439-94821461 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
934637830 2:96007132-96007154 CCCTCTGTCCAGGAGCACCCAGG - Intergenic
934750290 2:96789487-96789509 ACCTCTGTCCAGCAGCAGCCAGG - Intronic
934766897 2:96884744-96884766 ACCTTGGAGCAGAAGCTGCCTGG - Intronic
934795832 2:97098279-97098301 CCCTCTGTCCAGGAGCACCCAGG + Intergenic
938113072 2:128581976-128581998 GCAGCTGTGCAGAGGCTGCCTGG + Intergenic
939594310 2:144104894-144104916 CCCTCTGAGACGAAGCTTCCAGG + Intronic
939759346 2:146155107-146155129 CGCCCTGTGAAGAAGGTGCCTGG - Intergenic
940602151 2:155875733-155875755 CCCTCTGAGACGAAGCTTCCAGG + Intergenic
942547977 2:177084324-177084346 CCCTCTCTGCAGAAGTGGGCTGG - Intergenic
945476115 2:210284801-210284823 CCCTCTGGGCCCAAGCTGCTAGG - Intergenic
946794129 2:223331265-223331287 CCCTCTGGGACGAAGCTTCCAGG + Intergenic
947369163 2:229427272-229427294 CCCTCAGTGCAGAGGCTCTCTGG + Intronic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
947834570 2:233166229-233166251 CCCGCTGTGCAGAATATGCTCGG + Intronic
948373599 2:237505759-237505781 CCCTTTCTTCAGAGGCTGCCGGG + Intronic
948384780 2:237574714-237574736 CTCTCTGTCCAGAGGCTGCCAGG + Exonic
948514753 2:238497089-238497111 CCCACTGTTCAGAACCAGCCTGG - Intergenic
948624600 2:239261402-239261424 CCGTCTGTGCAGAGCCTGGCTGG - Intronic
1169112568 20:3043466-3043488 GCCTCAGGGCAGCAGCTGCCTGG + Intergenic
1169870161 20:10240979-10241001 GCCTCTGTGAAGCAGCTGCCAGG + Intronic
1170340445 20:15321064-15321086 ACAACTTTGCAGAAGCTGCCAGG - Intronic
1171352931 20:24518619-24518641 CGCTCTGGGCAGAAGGTGCTGGG + Intronic
1171389889 20:24794623-24794645 CTCTCTGTGCAGAGGCTTCTGGG - Intergenic
1171888837 20:30688182-30688204 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
1174593800 20:51667673-51667695 CCCCCTGCACAGTAGCTGCCCGG - Intronic
1175793605 20:61757624-61757646 ACCTCAGTGCAGACACTGCCAGG + Intronic
1175908478 20:62393314-62393336 CCCTCCGTGCAGATGGAGCCTGG - Intronic
1176293040 21:5056258-5056280 GGCTCTGAGCAGAAGCGGCCGGG + Intergenic
1176296268 21:5075156-5075178 TCCTCCGTGCAGATGCTGACAGG + Intergenic
1176610165 21:8874624-8874646 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1176738467 21:10574919-10574941 CCCACTGTGCTGAAGATCCCCGG - Intronic
1176853609 21:13943472-13943494 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
1177571354 21:22890860-22890882 CCCTCTGTGCAGAATCACCTGGG + Intergenic
1178935829 21:36860834-36860856 CCTACTGTGGAGAAACTGCCTGG - Intronic
1179090992 21:38265694-38265716 ACCTCTGTCCAGCAGCAGCCTGG - Intronic
1179491345 21:41743491-41743513 CCCTCTGCTCAGACGCTGCTGGG - Intronic
1179721000 21:43315990-43316012 CCCTGGGTGCCGAGGCTGCCAGG - Intergenic
1179775533 21:43659556-43659578 CCTTCTGTGCAGTCGCGGCCCGG + Exonic
1179860781 21:44186965-44186987 TCCTCCGTGCAGATGCTGACAGG - Intergenic
1179864220 21:44207392-44207414 GGCTCTGAGCAGAAGCGGCCGGG - Intergenic
1179955949 21:44738710-44738732 ACCTCTGAGCAGCAGCTGCCTGG + Intergenic
1180360224 22:11883877-11883899 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1180937839 22:19637755-19637777 CCCACGGTGCAGATGCTGCATGG - Intergenic
1181415515 22:22755997-22756019 CCCCCTCTGCAGAGCCTGCCTGG - Intronic
1181616952 22:24061431-24061453 CCTGGTGGGCAGAAGCTGCCAGG - Intronic
1182148934 22:28014938-28014960 CCCACTCTGCAGCTGCTGCCTGG - Intronic
1183189196 22:36310818-36310840 TCATCAGTGCAGAAGCTTCCAGG - Intronic
1184500770 22:44870299-44870321 ACTTCAGTGCAGAGGCTGCCAGG - Intergenic
1184690709 22:46116073-46116095 CCCTCGGTGCTCAGGCTGCCGGG - Intergenic
1185309687 22:50147196-50147218 CACTCTGTGCAGAAGCAGGGAGG + Intronic
1185309694 22:50147244-50147266 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309701 22:50147292-50147314 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309708 22:50147340-50147362 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309715 22:50147388-50147410 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309722 22:50147436-50147458 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309729 22:50147484-50147506 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309736 22:50147532-50147554 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309743 22:50147580-50147602 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185331685 22:50254872-50254894 GCCTCTGTGCTGAGCCTGCCAGG + Intronic
1185345677 22:50309550-50309572 CCACCTGTGCAGAAGAGGCCTGG - Exonic
949263708 3:2132840-2132862 CCCTCTGTCCAGAAACTACAGGG + Intronic
950726210 3:14918667-14918689 CCCTCTGTTCATCTGCTGCCAGG + Intronic
954012236 3:47651493-47651515 CCCCCTGGGCAGGAGCTACCTGG - Intronic
954293541 3:49662174-49662196 CACTGTATGCAGAAGGTGCCCGG - Exonic
954327884 3:49873452-49873474 CCCACCGTGCAGTTGCTGCCTGG - Intergenic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
955755026 3:62217763-62217785 TCCACTGTGAAGAAGATGCCCGG - Intronic
955916379 3:63912290-63912312 TCCTCTGAGCAGAAGCAGGCAGG + Intronic
956504216 3:69920583-69920605 CCCTCTCTGCCTCAGCTGCCAGG + Intronic
958657273 3:97018534-97018556 CCCTCTCTGCCTCAGCTGCCAGG - Intronic
959092986 3:101924408-101924430 CCCTCTGGGATGAAGCTTCCAGG - Intergenic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
961077307 3:123993802-123993824 GCCTCTGTGGAGGGGCTGCCAGG + Intergenic
961354478 3:126327342-126327364 GCCTCTGTTCAGGAGCTTCCTGG - Intergenic
961501466 3:127338609-127338631 TCCTCTGTCCACAGGCTGCCAGG + Intergenic
962341404 3:134587562-134587584 CCCTCTGGGATGAAGCTTCCGGG - Intergenic
963039055 3:141055475-141055497 TTCTCTCTGGAGAAGCTGCCTGG + Intronic
963286079 3:143435910-143435932 CCCTCCCTGCAGGGGCTGCCTGG + Intronic
967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG + Intergenic
968231769 3:197008717-197008739 CCCTCTGTGTGGCAGGTGCCTGG - Exonic
1202736844 3_GL000221v1_random:9411-9433 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
968919774 4:3516535-3516557 GCCTGTGTGCAGAGGCTGCCAGG + Intronic
969164733 4:5298150-5298172 CCCTCTGGGAGGAAGCTTCCAGG - Intronic
970592456 4:17571328-17571350 CACTCTTTGCAGAAGCTGGTGGG - Intergenic
971633042 4:29019922-29019944 TTCTCTGTGTAGAAGGTGCCAGG - Intergenic
972212418 4:36854983-36855005 CCCTCTGTGACGAACCTTCCAGG + Intergenic
972628474 4:40823048-40823070 GCCTCTGTGAAGCACCTGCCAGG - Intronic
973385225 4:49508504-49508526 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
973613278 4:52657435-52657457 CTCTCTGTGTAGAAGCAGGCTGG - Intronic
973758179 4:54095067-54095089 CCCTCTGAGAAGAAGCAGCGGGG - Intronic
973879865 4:55259261-55259283 CCATCAGTACAGAAGCTGCATGG - Intergenic
974127585 4:57714873-57714895 CCCTCTGAGATGAAGCTTCCAGG + Intergenic
974260320 4:59518068-59518090 ACCTCTCTGCACAAGCAGCCTGG - Intergenic
976963832 4:91011572-91011594 TCCTCTGAGCCCAAGCTGCCAGG - Intronic
977458878 4:97299486-97299508 CCCTCTTTGCAGAGGCTTTCTGG + Intronic
980223225 4:129947330-129947352 CCCTCTGGGACGAAGCTTCCAGG - Intergenic
980448227 4:132939143-132939165 CCCTCTGTGCCTGAGCTGCTAGG + Intergenic
1202769092 4_GL000008v2_random:183855-183877 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
986224735 5:5801992-5802014 CCTTCTGTGCTGAACCTTCCTGG + Intergenic
986675268 5:10178434-10178456 CCCTCTGGGATGAAGCTTCCAGG + Intergenic
988687677 5:33540589-33540611 CCCTCTGGGACGAAGCTTCCAGG + Intronic
990432544 5:55750676-55750698 CCTTCTGTGCTGATGCTGCCCGG - Intronic
991093977 5:62720035-62720057 CCCTCTGAGCAGCCGCTTCCTGG + Intergenic
995326134 5:110892419-110892441 CCCTCTGGGACGAAGCTTCCAGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995659444 5:114464524-114464546 ACACCTTTGCAGAAGCTGCCTGG + Intronic
996280648 5:121726057-121726079 CCCTCTGGGACGAAGCTTCCAGG - Intergenic
997146380 5:131438551-131438573 ACATCTGTGAAGAAGATGCCAGG + Intronic
997512056 5:134460760-134460782 CACTCTGGGCAGAAGGGGCCTGG - Intergenic
997623195 5:135314005-135314027 GTCTCTGAGCAGAAGCTGCTGGG - Intronic
997661111 5:135590298-135590320 CCCTCTGAGCAAAGCCTGCCTGG + Intergenic
999100474 5:149019943-149019965 CCCTGTGAGCAGAGGCTTCCAGG - Intronic
999229429 5:150052889-150052911 CCCTCTGTGGAGAGGGTCCCAGG - Intronic
999321008 5:150615109-150615131 ACCTCTGTGCAGGAGCTGTGGGG - Intronic
1002027389 5:176404749-176404771 CCCTTTGTGCAGCAGGTCCCGGG + Intronic
1002338447 5:178496746-178496768 CCCTTTTTGCCCAAGCTGCCAGG - Intronic
1002941817 6:1723660-1723682 CCCTCTGTGCAGAAGATCTTGGG + Intronic
1003564804 6:7214076-7214098 ACCTCTGTGCAGAGGAAGCCTGG - Intronic
1005051837 6:21691580-21691602 CCCCCTGTGCAGGAACTACCTGG - Intergenic
1005465454 6:26108273-26108295 CCCTCTTTACAGAATCTCCCAGG + Intergenic
1005709756 6:28491750-28491772 CCCTCTTTGCCTCAGCTGCCAGG + Intergenic
1006382261 6:33706409-33706431 CCAGCTGTGGAGAAGCTGGCAGG + Intronic
1007766481 6:44163321-44163343 CCCTGTGTGGAGCAGCTGACAGG - Intronic
1007809114 6:44473988-44474010 CTCTCTGCGCAGAAGCTGACCGG + Intergenic
1007822370 6:44570135-44570157 CCCTCGGGGCTGGAGCTGCCGGG + Intergenic
1012569630 6:100707646-100707668 CTCTCTTAGCAGTAGCTGCCTGG - Intronic
1016691449 6:146942973-146942995 CCCTCTGGGATGAAGCTTCCAGG - Intergenic
1018667227 6:166149716-166149738 CCCACTGGGCAGATGTTGCCAGG + Intergenic
1018685893 6:166304335-166304357 GCCTCTGTCCAGATGCTGCCTGG - Intergenic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1018945371 6:168344145-168344167 CCCTCTGAAGAGCAGCTGCCAGG - Intergenic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019669554 7:2270105-2270127 CCCTCTGCCCAGCAGCTCCCTGG - Intronic
1020557720 7:9691204-9691226 CCCTCTGGGAAGAAGCTTCCAGG - Intergenic
1020557805 7:9691723-9691745 CCCTCTAGGGAGAAGCTTCCAGG + Intergenic
1021653711 7:22854530-22854552 CCCACTCAGCAGAAGCCGCCAGG + Intergenic
1022049115 7:26647921-26647943 CCCTCAGTGAGGAAGCTCCCTGG + Intergenic
1023703262 7:42912915-42912937 CCCTCTTTGCAGATGGTGTCAGG + Intronic
1024407432 7:48998620-48998642 CCATGTGTTCAGAAGCTTCCTGG - Intergenic
1025025429 7:55512778-55512800 CCCTCTGTGCAGAAGTCAGCTGG - Intronic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1029460808 7:100693336-100693358 CCCTCCGTGCAGCAGCTCCCTGG - Intergenic
1030094419 7:105885307-105885329 TCCTCTTTCCAGACGCTGCCTGG - Intronic
1031970474 7:128061432-128061454 CCCTGTGTGGAGAAGCTGTGGGG + Intronic
1031991693 7:128202874-128202896 CTGTCTGTGCAGAGGGTGCCAGG + Intergenic
1032317867 7:130856499-130856521 CCCTCAGTCCAGTATCTGCCTGG + Intergenic
1032533852 7:132644455-132644477 GACACTGGGCAGAAGCTGCCAGG - Intronic
1032864159 7:135909327-135909349 CCCTCTCTCCAGAGGCAGCCTGG - Intergenic
1034172121 7:149070837-149070859 CCCGCTGTGCAGCAGCTGGTGGG + Exonic
1034990754 7:155546726-155546748 CCCACAGTGCAGAAGCTACTTGG - Intergenic
1035354713 7:158270212-158270234 CCCCGTGGGCAGAGGCTGCCTGG + Intronic
1035464217 7:159064346-159064368 CCCTCTGTGCAGAACCCTCCGGG + Intronic
1035579728 8:731996-732018 CCCTGTGTCCAGCAGGTGCCTGG - Intronic
1037990545 8:23318876-23318898 AGCCCTGAGCAGAAGCTGCCTGG - Intronic
1039475261 8:37836266-37836288 CTGCCTGTGCAGCAGCTGCCTGG - Intronic
1039555972 8:38475233-38475255 TCCTCTGGGCAGAGGCAGCCGGG - Intergenic
1039887823 8:41665210-41665232 CCCTCTCGGCTGAAGCAGCCCGG + Intronic
1040071031 8:43188988-43189010 CCCTCTGAGACGAAGCTTCCAGG - Intronic
1040276455 8:46016446-46016468 GACCCTGTGCAGGAGCTGCCAGG + Intergenic
1040890723 8:52313840-52313862 CTCTCTGGGCAGAAGTTGCCAGG - Intronic
1041314949 8:56551085-56551107 CCCTCTGAGACGAAGCTTCCAGG + Intergenic
1043759100 8:84043274-84043296 CCATTTGTCCAGAAACTGCCTGG - Intergenic
1043957628 8:86379953-86379975 CCCTCTGTTGAGTAACTGCCAGG - Intronic
1044701435 8:94968660-94968682 ACCCCTGTGCAGAACCTTCCAGG - Intronic
1046106584 8:109673307-109673329 CCCTCTGGGATGAAGCTCCCAGG + Intronic
1047483156 8:125303752-125303774 CACACTGTGCAGAAGATGACAGG + Intronic
1047565204 8:126036636-126036658 TCCTATGTGCAAAAGCTGGCAGG + Intergenic
1047800107 8:128300078-128300100 TTCTCTGTACAGAAGCTGCCTGG - Intergenic
1048028969 8:130613122-130613144 TCCTCTGTGCAGTAGATGCAAGG + Intergenic
1048833344 8:138496933-138496955 CTCTCCGTGCAACAGCTGCCCGG + Intergenic
1049322086 8:142001964-142001986 CCCGCGTTGCAGAAGCTGCAGGG - Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049492293 8:142911848-142911870 CCATTTGTGCAGGAGCTGGCTGG + Exonic
1049540851 8:143208138-143208160 CCTGATGTGCAGAGGCTGCCAGG + Intergenic
1049799721 8:144512154-144512176 CCGTCTGCGCAGAACCTTCCAGG - Exonic
1050973826 9:11911775-11911797 CCCTCTGGGATGAAGCTTCCAGG - Intergenic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1052735244 9:32335098-32335120 TCATCTGTGCACAGGCTGCCTGG + Intergenic
1053007966 9:34616510-34616532 GCCACTGAGCAGAACCTGCCTGG - Intronic
1053289532 9:36870931-36870953 CCCTCAGGGCAGGGGCTGCCTGG + Intronic
1053659598 9:40259032-40259054 TCCTCTGTTCAGGCGCTGCCTGG - Intronic
1054371726 9:64405331-64405353 TCCTCTGTTCAGGCGCTGCCTGG - Intronic
1054525000 9:66117184-66117206 TCCTCTGTTCAGGCGCTGCCTGG + Intronic
1054679345 9:67895048-67895070 TCCTCTGTTCAGGCGCTGCCTGG - Intronic
1056285409 9:85082737-85082759 CCCTCTGAGCAGAACCAGCGTGG + Intergenic
1056619085 9:88195480-88195502 GCATCTGTGCAGAATCTGCACGG - Intergenic
1060199352 9:121643407-121643429 TCCCCTCTGGAGAAGCTGCCTGG + Intronic
1060888744 9:127174969-127174991 CCCTCTGTGCCGGGGCTCCCTGG + Intronic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1061773996 9:132948588-132948610 CTCTCTGTGCAGCAGCCTCCTGG + Intronic
1062036081 9:134383179-134383201 CCCTCTGGGGTGAAGCGGCCTGG - Intronic
1062104161 9:134743678-134743700 CATTATGTGCAGAAGCAGCCTGG + Intronic
1203693974 Un_GL000214v1:77570-77592 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
1203705571 Un_KI270742v1:39855-39877 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1203558426 Un_KI270744v1:25950-25972 TCCTCTGTTCAGGCGCTGCCTGG + Intergenic
1203642299 Un_KI270751v1:26493-26515 TCCTCTGTTCAGGCGCTGCCTGG - Intergenic
1189267218 X:39726055-39726077 CCCTGTGTGCAGGGGCTGGCAGG + Intergenic
1191115478 X:56847521-56847543 CCCTCTGGGAAGAAGCTTCCAGG + Intergenic
1192406486 X:70890986-70891008 CCCTCTGGGATGAAGCTTCCAGG + Intronic
1193723776 X:85017375-85017397 AGCTCTGTGCACAGGCTGCCTGG - Intronic
1195948278 X:110238822-110238844 CCCTCTGGGATGAAGCTTCCAGG + Intronic
1197614209 X:128674378-128674400 CCCTCTGGGATGAAGCTTCCAGG - Intergenic
1198366040 X:135941121-135941143 CCCTCTGAGATGAAGCTTCCAGG - Intergenic
1199676185 X:150191118-150191140 CTCTCTGTGCAGAGGCTGCTTGG - Intergenic
1199940251 X:152619300-152619322 CTCTGTGTGCAGACTCTGCCTGG + Intergenic
1201963792 Y:19709599-19709621 CCCTGTGAGCAGAAGGGGCCAGG + Exonic
1202596696 Y:26548060-26548082 CCCACTGTGCTGAAGATCCCCGG - Intergenic